Mercurial > repos > jankanis > blast2html
comparison test-data/blast xml example4.html @ 59:f611cf649c90
update tests
author | Jan Kanis <jan.code@jankanis.nl> |
---|---|
date | Tue, 27 May 2014 12:50:52 +0200 |
parents | 3bb5da68305e |
children | fa8a93bdefd7 |
comparison
equal
deleted
inserted
replaced
58:39df29f647e8 | 59:f611cf649c90 |
---|---|
124 padding-left: .2em; | 124 padding-left: .2em; |
125 padding-right: .2em; | 125 padding-right: .2em; |
126 max-width: 50em; | 126 max-width: 50em; |
127 text-align: left; | 127 text-align: left; |
128 height: 2.8em; | 128 height: 2.8em; |
129 overflow-y: hidden; | 129 overflow: hidden; |
130 } | 130 } |
131 | 131 |
132 div.legend { | 132 div.legend { |
133 max-width: 40em; | 133 max-width: 40em; |
134 } | 134 } |
499 </div> | 499 </div> |
500 <div style="clear: left"></div> | 500 <div style="clear: left"></div> |
501 </div> | 501 </div> |
502 | 502 |
503 <a class=matchresult | 503 <a class=matchresult |
504 href="#hit1" | 504 href="#hit1-1" |
505 onmouseover='document.getElementById("defline1").innerHTML="AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000"' | 505 onmouseover='document.getElementById("defline1").innerHTML="AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000"' |
506 onmouseout='document.getElementById("defline1").innerHTML="Mouse-over to show defline and scores, click to show alignments"' | 506 onmouseout='document.getElementById("defline1").innerHTML="Mouse-over to show defline and scores, click to show alignments"' |
507 title="AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000"> | 507 title="AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000"> |
508 <div class="matchrow graphicrow"> | 508 <div class="matchrow graphicrow"> |
509 <div class="matchitem graphicitem" | 509 <div class="matchitem graphicitem" |
510 style="background-color: black; width: 100.0%"></div> | 510 style="background-color: black; width: 100.0%"></div> |
511 </div> | 511 </div> |
512 </a> | 512 </a> |
513 | 513 |
514 <a class=matchresult | 514 <a class=matchresult |
515 href="#hit2" | 515 href="#hit1-2" |
516 onmouseover='document.getElementById("defline1").innerHTML="DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000"' | 516 onmouseover='document.getElementById("defline1").innerHTML="DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000"' |
517 onmouseout='document.getElementById("defline1").innerHTML="Mouse-over to show defline and scores, click to show alignments"' | 517 onmouseout='document.getElementById("defline1").innerHTML="Mouse-over to show defline and scores, click to show alignments"' |
518 title="DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000"> | 518 title="DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000"> |
519 <div class="matchrow graphicrow"> | 519 <div class="matchrow graphicrow"> |
520 <div class="matchitem graphicitem" | 520 <div class="matchitem graphicitem" |
545 <th>E value</th> | 545 <th>E value</th> |
546 <th>Ident</th> | 546 <th>Ident</th> |
547 <th>Accession</th> | 547 <th>Accession</th> |
548 </tr> | 548 </tr> |
549 <tr> | 549 <tr> |
550 <td><div><a href="#hit1" | 550 <td><div><a href="#hit1-1" |
551 title="AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000" | 551 title="AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000" |
552 id="description1"> | 552 id="description1-1"> |
553 AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000 | 553 AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000 |
554 </a></div></td> | 554 </a></div></td> |
555 <td>40.1</td> | 555 <td>40.1</td> |
556 <td>40.1</td> | 556 <td>40.1</td> |
557 <td>100%</td> | 557 <td>100%</td> |
558 <td>1.513e-07</td> | 558 <td>1.513e-07</td> |
559 <td>100%</td> | 559 <td>100%</td> |
560 <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&log$=nuclalign">5</a></td> | 560 <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&log$=nuclalign">5</a></td> |
561 </tr> | 561 </tr> |
562 <tr> | 562 <tr> |
563 <td><div><a href="#hit2" | 563 <td><div><a href="#hit1-2" |
564 title="DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000" | 564 title="DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000" |
565 id="description2"> | 565 id="description1-2"> |
566 DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000 | 566 DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000 |
567 </a></div></td> | 567 </a></div></td> |
568 <td>40.1</td> | 568 <td>40.1</td> |
569 <td>40.1</td> | 569 <td>40.1</td> |
570 <td>100%</td> | 570 <td>100%</td> |
581 | 581 |
582 <section class=alignments> | 582 <section class=alignments> |
583 <h2>Alignments</h2> | 583 <h2>Alignments</h2> |
584 | 584 |
585 <div class=grey><div class=white> | 585 <div class=grey><div class=white> |
586 <div class=alignment id=hit1> | 586 <div class=alignment id=hit1-1> |
587 | 587 |
588 <div class=linkheader> | 588 <div class=linkheader> |
589 <div class=right><a href="#description1">Descriptions</a></div> | 589 <div class=right><a href="#description1-1">Descriptions</a></div> |
590 <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&log$=nuclalign">GenBank</a> | 590 <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&log$=nuclalign">GenBank</a> |
591 <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=graph&log$=nuclalign">Graphics</a> | 591 <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=graph&log$=nuclalign">Graphics</a> |
592 </div> | 592 </div> |
593 | 593 |
594 <div class=title> | 594 <div class=title> |
599 <span class=b>Number of Matches:</span> 1 | 599 <span class=b>Number of Matches:</span> 1 |
600 </p> | 600 </p> |
601 </div> | 601 </div> |
602 | 602 |
603 | 603 |
604 <div class=hotspot> | 604 <div class=hotspot id=hotspot1-1-1> |
605 <p class=range> | 605 <p class=range> |
606 <span class=range>Range 1: 2119 to 2138</span> | 606 <span class=range>Range 1: 2119 to 2138</span> |
607 <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&log$=nuclalign&from=2119&to=2138">GenBank</a> | 607 <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&log$=nuclalign&from=2119&to=2138">GenBank</a> |
608 <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=graph&log$=nuclalign&from=2119&to=2138">Graphics</a> | 608 <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=graph&log$=nuclalign&from=2119&to=2138">Graphics</a> |
609 </p> | 609 </p> |
626 Subject 2119 AGCGCGCAAACTAGGATAAA 2138</pre> | 626 Subject 2119 AGCGCGCAAACTAGGATAAA 2138</pre> |
627 </div> | 627 </div> |
628 | 628 |
629 </div> | 629 </div> |
630 | 630 |
631 <div class=alignment id=hit2> | 631 <div class=alignment id=hit1-2> |
632 | 632 |
633 <div class=linkheader> | 633 <div class=linkheader> |
634 <div class=right><a href="#description2">Descriptions</a></div> | 634 <div class=right><a href="#description1-2">Descriptions</a></div> |
635 <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&log$=nuclalign">GenBank</a> | 635 <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&log$=nuclalign">GenBank</a> |
636 <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=graph&log$=nuclalign">Graphics</a> | 636 <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=graph&log$=nuclalign">Graphics</a> |
637 </div> | 637 </div> |
638 | 638 |
639 <div class=title> | 639 <div class=title> |
644 <span class=b>Number of Matches:</span> 1 | 644 <span class=b>Number of Matches:</span> 1 |
645 </p> | 645 </p> |
646 </div> | 646 </div> |
647 | 647 |
648 | 648 |
649 <div class=hotspot> | 649 <div class=hotspot id=hotspot1-2-1> |
650 <p class=range> | 650 <p class=range> |
651 <span class=range>Range 1: 200 to 219</span> | 651 <span class=range>Range 1: 200 to 219</span> |
652 <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&log$=nuclalign&from=200&to=219">GenBank</a> | 652 <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&log$=nuclalign&from=200&to=219">GenBank</a> |
653 <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=graph&log$=nuclalign&from=200&to=219">Graphics</a> | 653 <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=graph&log$=nuclalign&from=200&to=219">Graphics</a> |
654 </p> | 654 </p> |
781 </div> | 781 </div> |
782 <div style="clear: left"></div> | 782 <div style="clear: left"></div> |
783 </div> | 783 </div> |
784 | 784 |
785 <a class=matchresult | 785 <a class=matchresult |
786 href="#hit1" | 786 href="#hit3-1" |
787 onmouseover='document.getElementById("defline3").innerHTML="AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000"' | 787 onmouseover='document.getElementById("defline3").innerHTML="AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000"' |
788 onmouseout='document.getElementById("defline3").innerHTML="Mouse-over to show defline and scores, click to show alignments"' | 788 onmouseout='document.getElementById("defline3").innerHTML="Mouse-over to show defline and scores, click to show alignments"' |
789 title="AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000"> | 789 title="AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000"> |
790 <div class="matchrow graphicrow"> | 790 <div class="matchrow graphicrow"> |
791 <div class="matchitem graphicitem" | 791 <div class="matchitem graphicitem" |
792 style="background-color: black; width: 100.0%"></div> | 792 style="background-color: black; width: 100.0%"></div> |
793 </div> | 793 </div> |
794 </a> | 794 </a> |
795 | 795 |
796 <a class=matchresult | 796 <a class=matchresult |
797 href="#hit2" | 797 href="#hit3-2" |
798 onmouseover='document.getElementById("defline3").innerHTML="DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000"' | 798 onmouseover='document.getElementById("defline3").innerHTML="DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000"' |
799 onmouseout='document.getElementById("defline3").innerHTML="Mouse-over to show defline and scores, click to show alignments"' | 799 onmouseout='document.getElementById("defline3").innerHTML="Mouse-over to show defline and scores, click to show alignments"' |
800 title="DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000"> | 800 title="DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000"> |
801 <div class="matchrow graphicrow"> | 801 <div class="matchrow graphicrow"> |
802 <div class="matchitem graphicitem" | 802 <div class="matchitem graphicitem" |
803 style="background-color: black; width: 100.0%"></div> | 803 style="background-color: black; width: 100.0%"></div> |
804 </div> | 804 </div> |
805 </a> | 805 </a> |
806 | 806 |
807 <a class=matchresult | 807 <a class=matchresult |
808 href="#hit3" | 808 href="#hit3-3" |
809 onmouseover='document.getElementById("defline3").innerHTML="AJ308515.1|GenBank|insert_GTS-40-3-2|Synthetic_construct_for_NOS_3\u0027UTR/plant_junction_region.|-9105899556052450000"' | 809 onmouseover='document.getElementById("defline3").innerHTML="AJ308515.1|GenBank|insert_GTS-40-3-2|Synthetic_construct_for_NOS_3\u0027UTR/plant_junction_region.|-9105899556052450000"' |
810 onmouseout='document.getElementById("defline3").innerHTML="Mouse-over to show defline and scores, click to show alignments"' | 810 onmouseout='document.getElementById("defline3").innerHTML="Mouse-over to show defline and scores, click to show alignments"' |
811 title="AJ308515.1|GenBank|insert_GTS-40-3-2|Synthetic_construct_for_NOS_3'UTR/plant_junction_region.|-9105899556052450000"> | 811 title="AJ308515.1|GenBank|insert_GTS-40-3-2|Synthetic_construct_for_NOS_3'UTR/plant_junction_region.|-9105899556052450000"> |
812 <div class="matchrow graphicrow"> | 812 <div class="matchrow graphicrow"> |
813 <div class="matchitem graphicitem" | 813 <div class="matchitem graphicitem" |
840 <th>E value</th> | 840 <th>E value</th> |
841 <th>Ident</th> | 841 <th>Ident</th> |
842 <th>Accession</th> | 842 <th>Accession</th> |
843 </tr> | 843 </tr> |
844 <tr> | 844 <tr> |
845 <td><div><a href="#hit1" | 845 <td><div><a href="#hit3-1" |
846 title="AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000" | 846 title="AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000" |
847 id="description1"> | 847 id="description3-1"> |
848 AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000 | 848 AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000 |
849 </a></div></td> | 849 </a></div></td> |
850 <td>40.1</td> | 850 <td>40.1</td> |
851 <td>40.1</td> | 851 <td>40.1</td> |
852 <td>100%</td> | 852 <td>100%</td> |
853 <td>1.513e-07</td> | 853 <td>1.513e-07</td> |
854 <td>100%</td> | 854 <td>100%</td> |
855 <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&log$=nuclalign">5</a></td> | 855 <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&log$=nuclalign">5</a></td> |
856 </tr> | 856 </tr> |
857 <tr> | 857 <tr> |
858 <td><div><a href="#hit2" | 858 <td><div><a href="#hit3-2" |
859 title="DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000" | 859 title="DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000" |
860 id="description2"> | 860 id="description3-2"> |
861 DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000 | 861 DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000 |
862 </a></div></td> | 862 </a></div></td> |
863 <td>40.1</td> | 863 <td>40.1</td> |
864 <td>40.1</td> | 864 <td>40.1</td> |
865 <td>100%</td> | 865 <td>100%</td> |
866 <td>1.513e-07</td> | 866 <td>1.513e-07</td> |
867 <td>100%</td> | 867 <td>100%</td> |
868 <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&log$=nuclalign">2</a></td> | 868 <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&log$=nuclalign">2</a></td> |
869 </tr> | 869 </tr> |
870 <tr> | 870 <tr> |
871 <td><div><a href="#hit3" | 871 <td><div><a href="#hit3-3" |
872 title="AJ308515.1|GenBank|insert_GTS-40-3-2|Synthetic_construct_for_NOS_3'UTR/plant_junction_region.|-9105899556052450000" | 872 title="AJ308515.1|GenBank|insert_GTS-40-3-2|Synthetic_construct_for_NOS_3'UTR/plant_junction_region.|-9105899556052450000" |
873 id="description3"> | 873 id="description3-3"> |
874 AJ308515.1|GenBank|insert_GTS-40-3-2|Synthetic_construct_for_NOS_3'UTR/plant_junction_region.|-9105899556052450000 | 874 AJ308515.1|GenBank|insert_GTS-40-3-2|Synthetic_construct_for_NOS_3'UTR/plant_junction_region.|-9105899556052450000 |
875 </a></div></td> | 875 </a></div></td> |
876 <td>34.2</td> | 876 <td>34.2</td> |
877 <td>34.2</td> | 877 <td>34.2</td> |
878 <td>85%</td> | 878 <td>85%</td> |
889 | 889 |
890 <section class=alignments> | 890 <section class=alignments> |
891 <h2>Alignments</h2> | 891 <h2>Alignments</h2> |
892 | 892 |
893 <div class=grey><div class=white> | 893 <div class=grey><div class=white> |
894 <div class=alignment id=hit1> | 894 <div class=alignment id=hit3-1> |
895 | 895 |
896 <div class=linkheader> | 896 <div class=linkheader> |
897 <div class=right><a href="#description1">Descriptions</a></div> | 897 <div class=right><a href="#description3-1">Descriptions</a></div> |
898 <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&log$=nuclalign">GenBank</a> | 898 <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&log$=nuclalign">GenBank</a> |
899 <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=graph&log$=nuclalign">Graphics</a> | 899 <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=graph&log$=nuclalign">Graphics</a> |
900 </div> | 900 </div> |
901 | 901 |
902 <div class=title> | 902 <div class=title> |
907 <span class=b>Number of Matches:</span> 1 | 907 <span class=b>Number of Matches:</span> 1 |
908 </p> | 908 </p> |
909 </div> | 909 </div> |
910 | 910 |
911 | 911 |
912 <div class=hotspot> | 912 <div class=hotspot id=hotspot3-1-1> |
913 <p class=range> | 913 <p class=range> |
914 <span class=range>Range 1: 2143 to 2162</span> | 914 <span class=range>Range 1: 2143 to 2162</span> |
915 <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&log$=nuclalign&from=2143&to=2162">GenBank</a> | 915 <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&log$=nuclalign&from=2143&to=2162">GenBank</a> |
916 <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=graph&log$=nuclalign&from=2143&to=2162">Graphics</a> | 916 <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=graph&log$=nuclalign&from=2143&to=2162">Graphics</a> |
917 </p> | 917 </p> |
934 Subject 2143 CGCGCGCGGTGTCATCTATG 2162</pre> | 934 Subject 2143 CGCGCGCGGTGTCATCTATG 2162</pre> |
935 </div> | 935 </div> |
936 | 936 |
937 </div> | 937 </div> |
938 | 938 |
939 <div class=alignment id=hit2> | 939 <div class=alignment id=hit3-2> |
940 | 940 |
941 <div class=linkheader> | 941 <div class=linkheader> |
942 <div class=right><a href="#description2">Descriptions</a></div> | 942 <div class=right><a href="#description3-2">Descriptions</a></div> |
943 <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&log$=nuclalign">GenBank</a> | 943 <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&log$=nuclalign">GenBank</a> |
944 <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=graph&log$=nuclalign">Graphics</a> | 944 <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=graph&log$=nuclalign">Graphics</a> |
945 </div> | 945 </div> |
946 | 946 |
947 <div class=title> | 947 <div class=title> |
952 <span class=b>Number of Matches:</span> 1 | 952 <span class=b>Number of Matches:</span> 1 |
953 </p> | 953 </p> |
954 </div> | 954 </div> |
955 | 955 |
956 | 956 |
957 <div class=hotspot> | 957 <div class=hotspot id=hotspot3-2-1> |
958 <p class=range> | 958 <p class=range> |
959 <span class=range>Range 1: 224 to 243</span> | 959 <span class=range>Range 1: 224 to 243</span> |
960 <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&log$=nuclalign&from=224&to=243">GenBank</a> | 960 <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&log$=nuclalign&from=224&to=243">GenBank</a> |
961 <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=graph&log$=nuclalign&from=224&to=243">Graphics</a> | 961 <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=graph&log$=nuclalign&from=224&to=243">Graphics</a> |
962 </p> | 962 </p> |
979 Subject 224 CGCGCGCGGTGTCATCTATG 243</pre> | 979 Subject 224 CGCGCGCGGTGTCATCTATG 243</pre> |
980 </div> | 980 </div> |
981 | 981 |
982 </div> | 982 </div> |
983 | 983 |
984 <div class=alignment id=hit3> | 984 <div class=alignment id=hit3-3> |
985 | 985 |
986 <div class=linkheader> | 986 <div class=linkheader> |
987 <div class=right><a href="#description3">Descriptions</a></div> | 987 <div class=right><a href="#description3-3">Descriptions</a></div> |
988 <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&log$=nuclalign">GenBank</a> | 988 <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&log$=nuclalign">GenBank</a> |
989 <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=graph&log$=nuclalign">Graphics</a> | 989 <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=graph&log$=nuclalign">Graphics</a> |
990 </div> | 990 </div> |
991 | 991 |
992 <div class=title> | 992 <div class=title> |
997 <span class=b>Number of Matches:</span> 1 | 997 <span class=b>Number of Matches:</span> 1 |
998 </p> | 998 </p> |
999 </div> | 999 </div> |
1000 | 1000 |
1001 | 1001 |
1002 <div class=hotspot> | 1002 <div class=hotspot id=hotspot3-3-1> |
1003 <p class=range> | 1003 <p class=range> |
1004 <span class=range>Range 1: 2 to 18</span> | 1004 <span class=range>Range 1: 2 to 18</span> |
1005 <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&log$=nuclalign&from=2&to=18">GenBank</a> | 1005 <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&log$=nuclalign&from=2&to=18">GenBank</a> |
1006 <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=graph&log$=nuclalign&from=2&to=18">Graphics</a> | 1006 <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=graph&log$=nuclalign&from=2&to=18">Graphics</a> |
1007 </p> | 1007 </p> |
1157 </div> | 1157 </div> |
1158 <div style="clear: left"></div> | 1158 <div style="clear: left"></div> |
1159 </div> | 1159 </div> |
1160 | 1160 |
1161 <a class=matchresult | 1161 <a class=matchresult |
1162 href="#hit1" | 1162 href="#hit6-1" |
1163 onmouseover='document.getElementById("defline6").innerHTML="EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000"' | 1163 onmouseover='document.getElementById("defline6").innerHTML="EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000"' |
1164 onmouseout='document.getElementById("defline6").innerHTML="Mouse-over to show defline and scores, click to show alignments"' | 1164 onmouseout='document.getElementById("defline6").innerHTML="Mouse-over to show defline and scores, click to show alignments"' |
1165 title="EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000"> | 1165 title="EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000"> |
1166 <div class="matchrow graphicrow"> | 1166 <div class="matchrow graphicrow"> |
1167 <div class="matchitem graphicitem" | 1167 <div class="matchitem graphicitem" |
1170 style="background-color: transparent; width: 12.0%"></div> | 1170 style="background-color: transparent; width: 12.0%"></div> |
1171 </div> | 1171 </div> |
1172 </a> | 1172 </a> |
1173 | 1173 |
1174 <a class=matchresult | 1174 <a class=matchresult |
1175 href="#hit2" | 1175 href="#hit6-2" |
1176 onmouseover='document.getElementById("defline6").innerHTML="AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000"' | 1176 onmouseover='document.getElementById("defline6").innerHTML="AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000"' |
1177 onmouseout='document.getElementById("defline6").innerHTML="Mouse-over to show defline and scores, click to show alignments"' | 1177 onmouseout='document.getElementById("defline6").innerHTML="Mouse-over to show defline and scores, click to show alignments"' |
1178 title="AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000"> | 1178 title="AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000"> |
1179 <div class="matchrow graphicrow"> | 1179 <div class="matchrow graphicrow"> |
1180 <div class="matchitem graphicitem" | 1180 <div class="matchitem graphicitem" |
1207 <th>E value</th> | 1207 <th>E value</th> |
1208 <th>Ident</th> | 1208 <th>Ident</th> |
1209 <th>Accession</th> | 1209 <th>Accession</th> |
1210 </tr> | 1210 </tr> |
1211 <tr> | 1211 <tr> |
1212 <td><div><a href="#hit1" | 1212 <td><div><a href="#hit6-1" |
1213 title="EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000" | 1213 title="EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000" |
1214 id="description1"> | 1214 id="description6-1"> |
1215 EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000 | 1215 EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000 |
1216 </a></div></td> | 1216 </a></div></td> |
1217 <td>36.2</td> | 1217 <td>36.2</td> |
1218 <td>36.2</td> | 1218 <td>36.2</td> |
1219 <td>88%</td> | 1219 <td>88%</td> |
1220 <td>3.148e-06</td> | 1220 <td>3.148e-06</td> |
1221 <td>95%</td> | 1221 <td>95%</td> |
1222 <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&log$=nuclalign">7</a></td> | 1222 <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&log$=nuclalign">7</a></td> |
1223 </tr> | 1223 </tr> |
1224 <tr> | 1224 <tr> |
1225 <td><div><a href="#hit2" | 1225 <td><div><a href="#hit6-2" |
1226 title="AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000" | 1226 title="AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000" |
1227 id="description2"> | 1227 id="description6-2"> |
1228 AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000 | 1228 AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000 |
1229 </a></div></td> | 1229 </a></div></td> |
1230 <td>36.2</td> | 1230 <td>36.2</td> |
1231 <td>36.2</td> | 1231 <td>36.2</td> |
1232 <td>88%</td> | 1232 <td>88%</td> |
1243 | 1243 |
1244 <section class=alignments> | 1244 <section class=alignments> |
1245 <h2>Alignments</h2> | 1245 <h2>Alignments</h2> |
1246 | 1246 |
1247 <div class=grey><div class=white> | 1247 <div class=grey><div class=white> |
1248 <div class=alignment id=hit1> | 1248 <div class=alignment id=hit6-1> |
1249 | 1249 |
1250 <div class=linkheader> | 1250 <div class=linkheader> |
1251 <div class=right><a href="#description1">Descriptions</a></div> | 1251 <div class=right><a href="#description6-1">Descriptions</a></div> |
1252 <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&log$=nuclalign">GenBank</a> | 1252 <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&log$=nuclalign">GenBank</a> |
1253 <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=graph&log$=nuclalign">Graphics</a> | 1253 <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=graph&log$=nuclalign">Graphics</a> |
1254 </div> | 1254 </div> |
1255 | 1255 |
1256 <div class=title> | 1256 <div class=title> |
1261 <span class=b>Number of Matches:</span> 1 | 1261 <span class=b>Number of Matches:</span> 1 |
1262 </p> | 1262 </p> |
1263 </div> | 1263 </div> |
1264 | 1264 |
1265 | 1265 |
1266 <div class=hotspot> | 1266 <div class=hotspot id=hotspot6-1-1> |
1267 <p class=range> | 1267 <p class=range> |
1268 <span class=range>Range 1: 2344 to 2365</span> | 1268 <span class=range>Range 1: 2344 to 2365</span> |
1269 <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&log$=nuclalign&from=2344&to=2365">GenBank</a> | 1269 <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&log$=nuclalign&from=2344&to=2365">GenBank</a> |
1270 <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=graph&log$=nuclalign&from=2344&to=2365">Graphics</a> | 1270 <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=graph&log$=nuclalign&from=2344&to=2365">Graphics</a> |
1271 </p> | 1271 </p> |
1288 Subject 2344 ACATGAACAGCGCCCTGACCAC 2365</pre> | 1288 Subject 2344 ACATGAACAGCGCCCTGACCAC 2365</pre> |
1289 </div> | 1289 </div> |
1290 | 1290 |
1291 </div> | 1291 </div> |
1292 | 1292 |
1293 <div class=alignment id=hit2> | 1293 <div class=alignment id=hit6-2> |
1294 | 1294 |
1295 <div class=linkheader> | 1295 <div class=linkheader> |
1296 <div class=right><a href="#description2">Descriptions</a></div> | 1296 <div class=right><a href="#description6-2">Descriptions</a></div> |
1297 <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&log$=nuclalign">GenBank</a> | 1297 <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&log$=nuclalign">GenBank</a> |
1298 <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=graph&log$=nuclalign">Graphics</a> | 1298 <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=graph&log$=nuclalign">Graphics</a> |
1299 </div> | 1299 </div> |
1300 | 1300 |
1301 <div class=title> | 1301 <div class=title> |
1306 <span class=b>Number of Matches:</span> 1 | 1306 <span class=b>Number of Matches:</span> 1 |
1307 </p> | 1307 </p> |
1308 </div> | 1308 </div> |
1309 | 1309 |
1310 | 1310 |
1311 <div class=hotspot> | 1311 <div class=hotspot id=hotspot6-2-1> |
1312 <p class=range> | 1312 <p class=range> |
1313 <span class=range>Range 1: 1541 to 1562</span> | 1313 <span class=range>Range 1: 1541 to 1562</span> |
1314 <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&log$=nuclalign&from=1541&to=1562">GenBank</a> | 1314 <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&log$=nuclalign&from=1541&to=1562">GenBank</a> |
1315 <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=graph&log$=nuclalign&from=1541&to=1562">Graphics</a> | 1315 <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=graph&log$=nuclalign&from=1541&to=1562">Graphics</a> |
1316 </p> | 1316 </p> |
1418 </div> | 1418 </div> |
1419 <div style="clear: left"></div> | 1419 <div style="clear: left"></div> |
1420 </div> | 1420 </div> |
1421 | 1421 |
1422 <a class=matchresult | 1422 <a class=matchresult |
1423 href="#hit1" | 1423 href="#hit7-1" |
1424 onmouseover='document.getElementById("defline7").innerHTML="EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000"' | 1424 onmouseover='document.getElementById("defline7").innerHTML="EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000"' |
1425 onmouseout='document.getElementById("defline7").innerHTML="Mouse-over to show defline and scores, click to show alignments"' | 1425 onmouseout='document.getElementById("defline7").innerHTML="Mouse-over to show defline and scores, click to show alignments"' |
1426 title="EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000"> | 1426 title="EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000"> |
1427 <div class="matchrow graphicrow"> | 1427 <div class="matchrow graphicrow"> |
1428 <div class="matchitem graphicitem" | 1428 <div class="matchitem graphicitem" |
1429 style="background-color: green; width: 100.0%"></div> | 1429 style="background-color: green; width: 100.0%"></div> |
1430 </div> | 1430 </div> |
1431 </a> | 1431 </a> |
1432 | 1432 |
1433 <a class=matchresult | 1433 <a class=matchresult |
1434 href="#hit2" | 1434 href="#hit7-2" |
1435 onmouseover='document.getElementById("defline7").innerHTML="AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000"' | 1435 onmouseover='document.getElementById("defline7").innerHTML="AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000"' |
1436 onmouseout='document.getElementById("defline7").innerHTML="Mouse-over to show defline and scores, click to show alignments"' | 1436 onmouseout='document.getElementById("defline7").innerHTML="Mouse-over to show defline and scores, click to show alignments"' |
1437 title="AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000"> | 1437 title="AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000"> |
1438 <div class="matchrow graphicrow"> | 1438 <div class="matchrow graphicrow"> |
1439 <div class="matchitem graphicitem" | 1439 <div class="matchitem graphicitem" |
1464 <th>E value</th> | 1464 <th>E value</th> |
1465 <th>Ident</th> | 1465 <th>Ident</th> |
1466 <th>Accession</th> | 1466 <th>Accession</th> |
1467 </tr> | 1467 </tr> |
1468 <tr> | 1468 <tr> |
1469 <td><div><a href="#hit1" | 1469 <td><div><a href="#hit7-1" |
1470 title="EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000" | 1470 title="EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000" |
1471 id="description1"> | 1471 id="description7-1"> |
1472 EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000 | 1472 EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000 |
1473 </a></div></td> | 1473 </a></div></td> |
1474 <td>67.9</td> | 1474 <td>67.9</td> |
1475 <td>67.9</td> | 1475 <td>67.9</td> |
1476 <td>100%</td> | 1476 <td>100%</td> |
1477 <td>3.564e-15</td> | 1477 <td>3.564e-15</td> |
1478 <td>86%</td> | 1478 <td>86%</td> |
1479 <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&log$=nuclalign">7</a></td> | 1479 <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&log$=nuclalign">7</a></td> |
1480 </tr> | 1480 </tr> |
1481 <tr> | 1481 <tr> |
1482 <td><div><a href="#hit2" | 1482 <td><div><a href="#hit7-2" |
1483 title="AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000" | 1483 title="AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000" |
1484 id="description2"> | 1484 id="description7-2"> |
1485 AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000 | 1485 AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000 |
1486 </a></div></td> | 1486 </a></div></td> |
1487 <td>67.9</td> | 1487 <td>67.9</td> |
1488 <td>67.9</td> | 1488 <td>67.9</td> |
1489 <td>100%</td> | 1489 <td>100%</td> |
1500 | 1500 |
1501 <section class=alignments> | 1501 <section class=alignments> |
1502 <h2>Alignments</h2> | 1502 <h2>Alignments</h2> |
1503 | 1503 |
1504 <div class=grey><div class=white> | 1504 <div class=grey><div class=white> |
1505 <div class=alignment id=hit1> | 1505 <div class=alignment id=hit7-1> |
1506 | 1506 |
1507 <div class=linkheader> | 1507 <div class=linkheader> |
1508 <div class=right><a href="#description1">Descriptions</a></div> | 1508 <div class=right><a href="#description7-1">Descriptions</a></div> |
1509 <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&log$=nuclalign">GenBank</a> | 1509 <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&log$=nuclalign">GenBank</a> |
1510 <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=graph&log$=nuclalign">Graphics</a> | 1510 <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=graph&log$=nuclalign">Graphics</a> |
1511 </div> | 1511 </div> |
1512 | 1512 |
1513 <div class=title> | 1513 <div class=title> |
1518 <span class=b>Number of Matches:</span> 1 | 1518 <span class=b>Number of Matches:</span> 1 |
1519 </p> | 1519 </p> |
1520 </div> | 1520 </div> |
1521 | 1521 |
1522 | 1522 |
1523 <div class=hotspot> | 1523 <div class=hotspot id=hotspot7-1-1> |
1524 <p class=range> | 1524 <p class=range> |
1525 <span class=range>Range 1: 2319 to 2392</span> | 1525 <span class=range>Range 1: 2319 to 2392</span> |
1526 <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&log$=nuclalign&from=2319&to=2392">GenBank</a> | 1526 <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&log$=nuclalign&from=2319&to=2392">GenBank</a> |
1527 <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=graph&log$=nuclalign&from=2319&to=2392">Graphics</a> | 1527 <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=graph&log$=nuclalign&from=2319&to=2392">Graphics</a> |
1528 </p> | 1528 </p> |
1545 Subject 2319 GAGGAGATGCGCATCCAGTTCAACGACATGAACAGCGCCCTGACCACCGCCATCCCACTCTTCGCCGTCCAGAA 2392</pre> | 1545 Subject 2319 GAGGAGATGCGCATCCAGTTCAACGACATGAACAGCGCCCTGACCACCGCCATCCCACTCTTCGCCGTCCAGAA 2392</pre> |
1546 </div> | 1546 </div> |
1547 | 1547 |
1548 </div> | 1548 </div> |
1549 | 1549 |
1550 <div class=alignment id=hit2> | 1550 <div class=alignment id=hit7-2> |
1551 | 1551 |
1552 <div class=linkheader> | 1552 <div class=linkheader> |
1553 <div class=right><a href="#description2">Descriptions</a></div> | 1553 <div class=right><a href="#description7-2">Descriptions</a></div> |
1554 <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&log$=nuclalign">GenBank</a> | 1554 <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&log$=nuclalign">GenBank</a> |
1555 <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=graph&log$=nuclalign">Graphics</a> | 1555 <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=graph&log$=nuclalign">Graphics</a> |
1556 </div> | 1556 </div> |
1557 | 1557 |
1558 <div class=title> | 1558 <div class=title> |
1563 <span class=b>Number of Matches:</span> 1 | 1563 <span class=b>Number of Matches:</span> 1 |
1564 </p> | 1564 </p> |
1565 </div> | 1565 </div> |
1566 | 1566 |
1567 | 1567 |
1568 <div class=hotspot> | 1568 <div class=hotspot id=hotspot7-2-1> |
1569 <p class=range> | 1569 <p class=range> |
1570 <span class=range>Range 1: 1516 to 1589</span> | 1570 <span class=range>Range 1: 1516 to 1589</span> |
1571 <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&log$=nuclalign&from=1516&to=1589">GenBank</a> | 1571 <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&log$=nuclalign&from=1516&to=1589">GenBank</a> |
1572 <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=graph&log$=nuclalign&from=1516&to=1589">Graphics</a> | 1572 <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=graph&log$=nuclalign&from=1516&to=1589">Graphics</a> |
1573 </p> | 1573 </p> |