Mercurial > repos > jankanis > blast2html
diff test-data/blast xml example4.html @ 70:0ef071bba164
Modify test data to include a negative frame sequence that is split in multiple lines
author | Jan Kanis <jan.code@jankanis.nl> |
---|---|
date | Wed, 18 Jun 2014 14:22:57 +0200 |
parents | fa8a93bdefd7 |
children | 05500bdd7376 |
line wrap: on
line diff
--- a/test-data/blast xml example4.html Wed Jun 18 14:12:00 2014 +0200 +++ b/test-data/blast xml example4.html Wed Jun 18 14:22:57 2014 +0200 @@ -1570,9 +1570,9 @@ <div class=hotspot id=hotspot7-2-1> <p class=range> - <span class=range>Range 1: 1516 to 1589</span> - <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&log$=nuclalign&from=1516&to=1589">GenBank</a> - <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=graph&log$=nuclalign&from=1516&to=1589">Graphics</a> + <span class=range>Range 1: 1589 to 1516</span> + <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&log$=nuclalign&from=1589&to=1516">GenBank</a> + <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=graph&log$=nuclalign&from=1589&to=1516">Graphics</a> </p> <table class=hotspotstable> @@ -1584,16 +1584,16 @@ <td>0.0</td> <td>64/74(86%)</td> <td>0/74(0%)</td> - <td>Plus/Plus</td> + <td>Plus/Minus</td> </tr> </table> <pre class=alignmentgraphic>Query 1 GAGGAAATGCGTATTCAATTCAACGACATGAACAGCGCCTTGACCACAGCTATCCCATTG 60 ||||| ||||| || || ||||||||||||||||||||| ||||||| || |||||| | -Subject 1516 GAGGAGATGCGCATCCAGTTCAACGACATGAACAGCGCCCTGACCACCGCCATCCCACTC 1575</pre> +Subject 1589 GAGGAGATGCGCATCCAGTTCAACGACATGAACAGCGCCCTGACCACCGCCATCCCACTC 1530</pre> <pre class=alignmentgraphic>Query 61 TTCGCAGTCCAGAA 74 ||||| |||||||| -Subject 1576 TTCGCCGTCCAGAA 1589</pre> +Subject 1529 TTCGCCGTCCAGAA 1516</pre> </div> </div>