Mercurial > repos > jankanis > blast2html
changeset 106:ed71448ee154
add new test files
| author | Jan Kanis <jan.code@jankanis.nl> |
|---|---|
| date | Mon, 07 Jul 2014 11:50:50 +0200 |
| parents | b3b5ee557170 |
| children | ee2b105d772a |
| files | test-data/blast xml example3b.html test-data/blast xml example4b.html |
| diffstat | 2 files changed, 5094 insertions(+), 0 deletions(-) [+] |
line wrap: on
line diff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/blast xml example3b.html Mon Jul 07 11:50:50 2014 +0200 @@ -0,0 +1,3509 @@ +<!DOCTYPE html> +<html> + <head> + <meta charset="UTF-8"> + <meta name=generator content="blast2html; see https://github.com/thehyve/blast2html/"> + + <title>Blast output</title> + + <style> + body { + color: #333333; + font-family: Arial,Sans-Serif; + } + + :link { + color: #336699; + } + + .right { + float: right; + } + + /* Galaxy with html sanitization enabled strips the header of this html page. If so, show the user a warning.*/ + #strip_html_warning { + display: none; + } + + #content { + margin: 0 2em; + padding: 0.5em; + border: 1px solid #888888; + background-color: #d3dff5; + } + + h1, h2, h3, h4, h5, h6 { + color: #2A6979; + font-family: arial,verdana,sans-serif; + letter-spacing: -1px; + margin: 1.2em 0 0.3em; + } + + h1 { + border-bottom: 1px solid #CCCCCC; + font-size: 150%; + padding-bottom: 0.1em; + } + + h2 { + font-size: 120%; + font-weight: bold; + } + + h4.darkHeader { + color: #4D4D4D; + letter-spacing: 0; + font-weight: bold; + } + + #nodata { + font-weight: bold; + } + + .index { + margin-bottom: 3em; + } + .index div.indexentry { + margin: 1.2em 1.6em; + font-weight: bold; + font-size: 100%; + } + + .headerdata { + font-size: 90%; + } + .headerdata .param { + font-weight: bold; + text-align: right; + padding: 0 1em; + } + + .grey { + background-color: #eeeeee; + border: 1px solid #cccccc; + padding: 1em; + } + + .white { + background-color: white; + border: 1px solid #cccccc; + padding: 1.5em 2%; + } + + .graphicrow { + clear: left; + width: 100%; + } + + .graphicitem { + float: left; + } + + + + .graphics .grey { + text-align: center; + } + + .graphic { + background-color: white; + border: 2px solid black; + padding: 1.5em; + margin: auto; + } + + .centered, .defline, div.legend, div.tablewrapper { + margin-left: auto; + margin-right: auto; + } + + .defline { + background-color: white; + border: 1px solid black; + margin: .5em auto; + padding-left: .2em; + padding-right: .2em; + max-width: 50em; + text-align: left; + height: 2.8em; + overflow: hidden; + } + + div.legend { + max-width: 40em; + } + div.legend div { + width: 100%; + color: white; + font-weight: bold; + border-spacing: 0; + } + div.legend div .graphicitem { + width: 20%; + padding: 0; + margin: 0; + border: none; + } + + div.tablewrapper { + width: 50%; + min-width: 60em; + } + + /* For small widths we give the graphic 100% */ + @media (max-width: 72.5em) { + div.tablewrapper { + width: 100%; + min-width: 0px; + } + } + + .scale { + width: 100%; + margin: .5em 0; + font-weight: bold; + } + .scale div { + color: red; + text-align: left; + } + .scale .graphicrow { + margin: .5em 0 .5em 0; + color: white; + } + .scale .graphicitem { + position: relative; + } + .scale .graphicitem div { + margin: 0 1px; + padding: 0 2px; + text-align: right; + background-color: red; + color: white; + } + .scale .graphicitem:first-child div { + margin-left: 0px; + } + .scale .graphicitem:last-child div { + margin-right: 0px; + } + .scale .graphicitem .lastlabel { + position: absolute; + top: 0px; + left: 100%; + background-color: transparent; + color: red; + } + + a.matchresult { + display: block; + margin: 0; + padding: 0; + } + div.matchrow { + margin-top: 4px; + } + div.matchrow, div.matchitem { + height: 4px; + } + + + table.descriptiontable { + font-size: 85%; + border: 1px solid #97b0c8; + border-spacing: 0; + color: #222222; + line-height: 1.3em; + background-color: white; + } + table.descriptiontable col:first-child { + width: 100%; + } + table.descriptiontable tr:hover { + background-color: #D5DEE3; + } + table.descriptiontable th { + color: #14376C; + font-weight: normal; + background-color: #F0F0F0; + background: linear-gradient(#FFFFFF, #F0F0F0); + border-bottom: 1px solid #D4DFE9; + border-right: 1px solid #CFCFCF; + border-left: 0px solid black; + border-top: 0px solid black; + } + table.descriptiontable td { + overflow: hidden; + text-align: center; + padding: .4em .8em; + } + table.descriptiontable td div { + width: 1em; + overflow: visible; + white-space: nowrap; + text-align: left; + } + + + + .alignments .white { + padding: 1.5em 1em; + } + + .alignment { + border-top: 1px solid black; + padding-left: 1em; + padding-right: 1em; + } + + div.linkheader { + padding-top: .2em; + font-size: 85%; + color: #14376C; + } + div.linkheader a.linkheader { + margin-right: 1em; + } + div.linkheader .right a { + text-decoration: none; + } + + .title .hittitle { + color: #222222; + margin-bottom: .3em; + } + .title .titleinfo { + font-size: 80%; + margin-top: 0; + margin-bottom: .3em; + } + .title .titleinfo .b { + color: #606060; + font-weight: bold; + font-size: 90%; + } + + .moretitles { + margin: 1.2em; + } + .moretitles .titleinfo { + margin: 0; + padding: 0; + } + .moretitles .hittitle { + margin: .4em 0 .2em 0; + padding: 0; + } + + a.showmoretitles { + font-size: 75%; + color: #336699; + font-weight: bold; + margin-top: 0; + } + a.showmoretitles:hover { + } + + .hotspot { + color: #606060; + font-family: verdana, arial, sans-serif; + margin-bottom: 2.5em; + } + + .hotspot p.range { + font-size: 70%; + margin-top: 0; + margin-top: 1em; + margin-bottom: .2em; + } + .hotspot p.range span.range { + font-weight: bold; + } + .hotspot p.range a.range { + margin-left: .5em; + } + + table.hotspotstable { + border-top: 1px solid; + border-bottom: 1px solid; + text-align: left; + border-collapse: collapse; + } + table.hotspotstable th, table.hotspotstable td { + padding: .1em 1em; + } + table.hotspotstable th { + font-size: 70%; + } + table.hotspotstable td { + min-width: 7em; + color: #222222; + font-size: 80%; + } + + pre.alignmentgraphic { + color: #222222; + } + + footer { + text-align: center; + color: #cccccc; + font-size: 70%; + margin-top: 1em; + } + footer :link { + color: #5588cc; + } + + </style> + + <script type="text/javascript"> + function toggle_visibility(id) { + var e = document.getElementById(id); + if(e.style.display != 'block') + e.style.display = 'block'; + else + e.style.display = 'none'; + } + </script> + + </head> + + + <body> + + <div id="strip_html_warning"> + <!-- This div should be hidden by the header css block. Galaxy + strips all css, breaking this page but making this warning + visible. This warning contains some ugly old skool tabular html + layout that is not stripped. --> + <table bgcolor="#FFE5C9"><tr><td><font color="red"><b> + <font size=5><center>This html page seems to have been stripped by Galaxy.</center></font> + Disable Galaxy's html sanitization feature to view the full page (see <font face=monospace>sanitize_all_html</font> in your galaxy's universe_wsgi.ini), or download this page instead of viewing it in Galaxy. + </b></font></td></tr></table> + </div> + + <div id=content> + + + <section class=index> + <h1>Queries</h1> + + <div class=indexentry><a href="#match1"> + Query_1: Forward_Primer|NOST-Spec_(Genetic_ID) + (20 letters, 0 hits) + </a></div> + <div class=indexentry><a href="#match2"> + Query_1: Forward_Primer|NOST-Spec_(Genetic_ID) + (20 letters, 0 hits) + </a></div> + <div class=indexentry><a href="#match3"> + Query_1: Forward_Primer|NOST-Spec_(Genetic_ID) + (20 letters, 1 hits) + </a></div> + <div class=indexentry><a href="#match4"> + Query_1: Forward_Primer|NOST-Spec_(Genetic_ID) + (20 letters, 0 hits) + </a></div> + <div class=indexentry><a href="#match5"> + Query_1: Forward_Primer|NOST-Spec_(Genetic_ID) + (20 letters, 0 hits) + </a></div> + <div class=indexentry><a href="#match6"> + Query_1: Forward_Primer|NOST-Spec_(Genetic_ID) + (20 letters, 1 hits) + </a></div> + <div class=indexentry><a href="#match7"> + Query_1: Forward_Primer|NOST-Spec_(Genetic_ID) + (20 letters, 0 hits) + </a></div> + <div class=indexentry><a href="#match8"> + Query_1: Forward_Primer|NOST-Spec_(Genetic_ID) + (20 letters, 0 hits) + </a></div> + <div class=indexentry><a href="#match9"> + Query_2: Reverse_Primer|NOST-Spec_(Genetic_ID) + (20 letters, 0 hits) + </a></div> + <div class=indexentry><a href="#match10"> + Query_2: Reverse_Primer|NOST-Spec_(Genetic_ID) + (20 letters, 0 hits) + </a></div> + <div class=indexentry><a href="#match11"> + Query_2: Reverse_Primer|NOST-Spec_(Genetic_ID) + (20 letters, 0 hits) + </a></div> + <div class=indexentry><a href="#match12"> + Query_2: Reverse_Primer|NOST-Spec_(Genetic_ID) + (20 letters, 0 hits) + </a></div> + <div class=indexentry><a href="#match13"> + Query_2: Reverse_Primer|NOST-Spec_(Genetic_ID) + (20 letters, 0 hits) + </a></div> + <div class=indexentry><a href="#match14"> + Query_2: Reverse_Primer|NOST-Spec_(Genetic_ID) + (20 letters, 0 hits) + </a></div> + <div class=indexentry><a href="#match15"> + Query_2: Reverse_Primer|NOST-Spec_(Genetic_ID) + (20 letters, 0 hits) + </a></div> + <div class=indexentry><a href="#match16"> + Query_2: Reverse_Primer|NOST-Spec_(Genetic_ID) + (20 letters, 0 hits) + </a></div> + <div class=indexentry><a href="#match17"> + Query_3: Probe|NOST-Spec_(Genetic_ID) + (20 letters, 0 hits) + </a></div> + <div class=indexentry><a href="#match18"> + Query_3: Probe|NOST-Spec_(Genetic_ID) + (20 letters, 1 hits) + </a></div> + <div class=indexentry><a href="#match19"> + Query_3: Probe|NOST-Spec_(Genetic_ID) + (20 letters, 1 hits) + </a></div> + <div class=indexentry><a href="#match20"> + Query_3: Probe|NOST-Spec_(Genetic_ID) + (20 letters, 0 hits) + </a></div> + <div class=indexentry><a href="#match21"> + Query_3: Probe|NOST-Spec_(Genetic_ID) + (20 letters, 0 hits) + </a></div> + <div class=indexentry><a href="#match22"> + Query_3: Probe|NOST-Spec_(Genetic_ID) + (20 letters, 1 hits) + </a></div> + <div class=indexentry><a href="#match23"> + Query_3: Probe|NOST-Spec_(Genetic_ID) + (20 letters, 0 hits) + </a></div> + <div class=indexentry><a href="#match24"> + Query_3: Probe|NOST-Spec_(Genetic_ID) + (20 letters, 0 hits) + </a></div> + <div class=indexentry><a href="#match25"> + Query_4: Forward_Primer|QL-ELE-Bt-F1(mod)/Bt-R + (24 letters, 0 hits) + </a></div> + <div class=indexentry><a href="#match26"> + Query_4: Forward_Primer|QL-ELE-Bt-F1(mod)/Bt-R + (24 letters, 0 hits) + </a></div> + <div class=indexentry><a href="#match27"> + Query_4: Forward_Primer|QL-ELE-Bt-F1(mod)/Bt-R + (24 letters, 0 hits) + </a></div> + <div class=indexentry><a href="#match28"> + Query_4: Forward_Primer|QL-ELE-Bt-F1(mod)/Bt-R + (24 letters, 0 hits) + </a></div> + <div class=indexentry><a href="#match29"> + Query_4: Forward_Primer|QL-ELE-Bt-F1(mod)/Bt-R + (24 letters, 0 hits) + </a></div> + <div class=indexentry><a href="#match30"> + Query_4: Forward_Primer|QL-ELE-Bt-F1(mod)/Bt-R + (24 letters, 0 hits) + </a></div> + <div class=indexentry><a href="#match31"> + Query_4: Forward_Primer|QL-ELE-Bt-F1(mod)/Bt-R + (24 letters, 0 hits) + </a></div> + <div class=indexentry><a href="#match32"> + Query_4: Forward_Primer|QL-ELE-Bt-F1(mod)/Bt-R + (24 letters, 0 hits) + </a></div> + <div class=indexentry><a href="#match33"> + Query_5: Reverse_Primer|QL-ELE-Bt-F1(mod)/Bt-R + (20 letters, 0 hits) + </a></div> + <div class=indexentry><a href="#match34"> + Query_5: Reverse_Primer|QL-ELE-Bt-F1(mod)/Bt-R + (20 letters, 0 hits) + </a></div> + <div class=indexentry><a href="#match35"> + Query_5: Reverse_Primer|QL-ELE-Bt-F1(mod)/Bt-R + (20 letters, 0 hits) + </a></div> + <div class=indexentry><a href="#match36"> + Query_5: Reverse_Primer|QL-ELE-Bt-F1(mod)/Bt-R + (20 letters, 0 hits) + </a></div> + <div class=indexentry><a href="#match37"> + Query_5: Reverse_Primer|QL-ELE-Bt-F1(mod)/Bt-R + (20 letters, 0 hits) + </a></div> + <div class=indexentry><a href="#match38"> + Query_5: Reverse_Primer|QL-ELE-Bt-F1(mod)/Bt-R + (20 letters, 0 hits) + </a></div> + <div class=indexentry><a href="#match39"> + Query_5: Reverse_Primer|QL-ELE-Bt-F1(mod)/Bt-R + (20 letters, 0 hits) + </a></div> + <div class=indexentry><a href="#match40"> + Query_5: Reverse_Primer|QL-ELE-Bt-F1(mod)/Bt-R + (20 letters, 0 hits) + </a></div> + <div class=indexentry><a href="#match41"> + Query_6: Probe|QL-ELE-Bt-F1(mod)/Bt-R + (25 letters, 0 hits) + </a></div> + <div class=indexentry><a href="#match42"> + Query_6: Probe|QL-ELE-Bt-F1(mod)/Bt-R + (25 letters, 0 hits) + </a></div> + <div class=indexentry><a href="#match43"> + Query_6: Probe|QL-ELE-Bt-F1(mod)/Bt-R + (25 letters, 0 hits) + </a></div> + <div class=indexentry><a href="#match44"> + Query_6: Probe|QL-ELE-Bt-F1(mod)/Bt-R + (25 letters, 0 hits) + </a></div> + <div class=indexentry><a href="#match45"> + Query_6: Probe|QL-ELE-Bt-F1(mod)/Bt-R + (25 letters, 0 hits) + </a></div> + <div class=indexentry><a href="#match46"> + Query_6: Probe|QL-ELE-Bt-F1(mod)/Bt-R + (25 letters, 0 hits) + </a></div> + <div class=indexentry><a href="#match47"> + Query_6: Probe|QL-ELE-Bt-F1(mod)/Bt-R + (25 letters, 1 hits) + </a></div> + <div class=indexentry><a href="#match48"> + Query_6: Probe|QL-ELE-Bt-F1(mod)/Bt-R + (25 letters, 1 hits) + </a></div> + <div class=indexentry><a href="#match49"> + Query_7: Amplicon|QL-ELE-Bt-F1(mod)/Bt-R + (74 letters, 0 hits) + </a></div> + <div class=indexentry><a href="#match50"> + Query_7: Amplicon|QL-ELE-Bt-F1(mod)/Bt-R + (74 letters, 0 hits) + </a></div> + <div class=indexentry><a href="#match51"> + Query_7: Amplicon|QL-ELE-Bt-F1(mod)/Bt-R + (74 letters, 0 hits) + </a></div> + <div class=indexentry><a href="#match52"> + Query_7: Amplicon|QL-ELE-Bt-F1(mod)/Bt-R + (74 letters, 0 hits) + </a></div> + <div class=indexentry><a href="#match53"> + Query_7: Amplicon|QL-ELE-Bt-F1(mod)/Bt-R + (74 letters, 0 hits) + </a></div> + <div class=indexentry><a href="#match54"> + Query_7: Amplicon|QL-ELE-Bt-F1(mod)/Bt-R + (74 letters, 0 hits) + </a></div> + <div class=indexentry><a href="#match55"> + Query_7: Amplicon|QL-ELE-Bt-F1(mod)/Bt-R + (74 letters, 1 hits) + </a></div> + <div class=indexentry><a href="#match56"> + Query_7: Amplicon|QL-ELE-Bt-F1(mod)/Bt-R + (74 letters, 1 hits) + </a></div> + + </section> + + + <section class=match id=match1> + + <h1>Nucleotide Sequence (20 letters)</h1> + + <section class=header> + + <table class=headerdata> + <tr><td class=param>Query ID:</td><td>Query_1</td></tr> + <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> + <tr><td class=param>Query length:</td><td>20</td></tr> + <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> + <tr><td class=param>Database:</td><td></td></tr> + </table> + + </section> + + <section> + <h2>No Hits</h2> + <div class=grey> + <table class=headerdata> + <tr><td class=param>Message:</td><td>No hits found</td></tr> + </table> + </div> + </section> + </section> + + <section class=match id=match2> + + <h1>Nucleotide Sequence (20 letters)</h1> + + <section class=header> + + <table class=headerdata> + <tr><td class=param>Query ID:</td><td>Query_1</td></tr> + <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> + <tr><td class=param>Query length:</td><td>20</td></tr> + <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> + <tr><td class=param>Database:</td><td></td></tr> + </table> + + </section> + + <section> + <h2>No Hits</h2> + <div class=grey> + <table class=headerdata> + <tr><td class=param>Message:</td><td>No hits found</td></tr> + </table> + </div> + </section> + </section> + + <section class=match id=match3> + + <h1>Nucleotide Sequence (20 letters)</h1> + + <section class=header> + + <table class=headerdata> + <tr><td class=param>Query ID:</td><td>Query_1</td></tr> + <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> + <tr><td class=param>Query length:</td><td>20</td></tr> + <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> + <tr><td class=param>Database:</td><td></td></tr> + </table> + + </section> + + + <section class=graphics> + <h2>Graphic Summary</h2> + + <div class=grey> + <h3 class=centered>Distribution of 56 Blast Hits on the Query Sequence</h3> + + <div class=defline id=defline3> + Mouse-over to show defline and scores, click to show alignments + </div> + + <div class=graphic> + <h4 class=darkHeader>Color key for alignment scores</h4> + <div class=legend><div class=graphicrow> + <div class=graphicitem style="background-color: black"><40</div> + <div class=graphicitem style="background-color: blue">40–50</div> + <div class=graphicitem style="background-color: green">50–80</div> + <div class=graphicitem style="background-color: magenta">80–200</div> + <div class=graphicitem style="background-color: red">200≤</div> + </div></div> + <div style="clear: left"></div> + + <div class=tablewrapper> + + <div class=scale> + <div>query:</div> + <div class=graphicrow> + <div> + <div class=graphicitem style="width: 10%"> + <div>2</div> + </div> + <div class=graphicitem style="width: 10%"> + <div>4</div> + </div> + <div class=graphicitem style="width: 10%"> + <div>6</div> + </div> + <div class=graphicitem style="width: 10%"> + <div>8</div> + </div> + <div class=graphicitem style="width: 10%"> + <div>10</div> + </div> + <div class=graphicitem style="width: 10%"> + <div>12</div> + </div> + <div class=graphicitem style="width: 10%"> + <div>14</div> + </div> + <div class=graphicitem style="width: 10%"> + <div>16</div> + </div> + <div class=graphicitem style="width: 10%"> + <div>18</div> + </div> + <div class=graphicitem style="width: 10%"> + <div>20</div> + </div> + </div> + </div> + <div style="clear: left"></div> + </div> + + <a class=matchresult + href="#hit3-1" + onmouseover='document.getElementById("defline3").innerHTML="DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000"' + onmouseout='document.getElementById("defline3").innerHTML="Mouse-over to show defline and scores, click to show alignments"' + title="DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000"> + <div class="matchrow graphicrow"> + <div class="matchitem graphicitem" + style="background-color: black; width: 100%"></div> + </div> + </a> + + </div> + </div> + </div> + </section> + + + + <section class=descriptions> + <h2>Descriptions</h2> + + <div class=grey><div class=white> + <h4 class=darkHeader>Sequences producing significant alignments:</h4> + + <table class=descriptiontable> + <col/><col/><col/><col/><col/><col/><col/> + <tr> + <th>Description</th> + <th>Max score</th> + <th>Total score</th> + <th>Query cover</th> + <th>E value</th> + <th>Ident</th> + <th>Accession</th> + </tr> + <tr> + <td><div><a href="#hit3-1" + title="DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000" + id="description3-1"> + DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000 + </a></div></td> + <td>37.4</td> + <td>37.4</td> + <td>100%</td> + <td>7.011e-08</td> + <td>100%</td> + <td><a href="http://example.com/example-genebank?id=Subject_3">Subject_3</a></td> + </tr> + </table> + + </div></div> + </section> + + + + <section class=alignments> + <h2>Alignments</h2> + + <div class=grey><div class=white> + <div class=alignment id=hit3-1> + + <div class=linkheader> + <div class=right><a href="#description3-1">Descriptions</a></div> + <a class="linkheader" href="http://example.com/example-genebank?id=Subject_3">Gene Bank</a> + </div> + + <div class=title> + <p class=hittitle>DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000</p> + <p class=titleinfo> + <span class=b>Sequence ID:</span> <a href="http://example.com/example-genebank?id=Subject_3">Subject_3</a> + <span class=b>Length:</span> 323 + <span class=b>Number of Matches:</span> 1 + </p> + </div> + + + <div class=hotspot id=hotspot3-1-1> + <p class=range> + <span class=range>Range 1: 200 to 219</span> + </p> + + <table class=hotspotstable> + <tr> + <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> + </tr> + <tr> + <td>37.4 bits(40)</td> + <td>0.0</td> + <td>20/20(100%)</td> + <td>0/20(0%)</td> + <td>Plus/Plus</td> + </tr> + </table> + + <pre class=alignmentgraphic>Query 1 AGCGCGCAAACTAGGATAAA 20 + |||||||||||||||||||| +Subject 200 AGCGCGCAAACTAGGATAAA 219</pre> + </div> + + </div> + + </div></div> + </section> + </section> + + <section class=match id=match4> + + <h1>Nucleotide Sequence (20 letters)</h1> + + <section class=header> + + <table class=headerdata> + <tr><td class=param>Query ID:</td><td>Query_1</td></tr> + <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> + <tr><td class=param>Query length:</td><td>20</td></tr> + <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> + <tr><td class=param>Database:</td><td></td></tr> + </table> + + </section> + + <section> + <h2>No Hits</h2> + <div class=grey> + <table class=headerdata> + <tr><td class=param>Message:</td><td>No hits found</td></tr> + </table> + </div> + </section> + </section> + + <section class=match id=match5> + + <h1>Nucleotide Sequence (20 letters)</h1> + + <section class=header> + + <table class=headerdata> + <tr><td class=param>Query ID:</td><td>Query_1</td></tr> + <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> + <tr><td class=param>Query length:</td><td>20</td></tr> + <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> + <tr><td class=param>Database:</td><td></td></tr> + </table> + + </section> + + <section> + <h2>No Hits</h2> + <div class=grey> + <table class=headerdata> + <tr><td class=param>Message:</td><td>No hits found</td></tr> + </table> + </div> + </section> + </section> + + <section class=match id=match6> + + <h1>Nucleotide Sequence (20 letters)</h1> + + <section class=header> + + <table class=headerdata> + <tr><td class=param>Query ID:</td><td>Query_1</td></tr> + <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> + <tr><td class=param>Query length:</td><td>20</td></tr> + <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> + <tr><td class=param>Database:</td><td></td></tr> + </table> + + </section> + + + <section class=graphics> + <h2>Graphic Summary</h2> + + <div class=grey> + <h3 class=centered>Distribution of 56 Blast Hits on the Query Sequence</h3> + + <div class=defline id=defline6> + Mouse-over to show defline and scores, click to show alignments + </div> + + <div class=graphic> + <h4 class=darkHeader>Color key for alignment scores</h4> + <div class=legend><div class=graphicrow> + <div class=graphicitem style="background-color: black"><40</div> + <div class=graphicitem style="background-color: blue">40–50</div> + <div class=graphicitem style="background-color: green">50–80</div> + <div class=graphicitem style="background-color: magenta">80–200</div> + <div class=graphicitem style="background-color: red">200≤</div> + </div></div> + <div style="clear: left"></div> + + <div class=tablewrapper> + + <div class=scale> + <div>query:</div> + <div class=graphicrow> + <div> + <div class=graphicitem style="width: 10%"> + <div>2</div> + </div> + <div class=graphicitem style="width: 10%"> + <div>4</div> + </div> + <div class=graphicitem style="width: 10%"> + <div>6</div> + </div> + <div class=graphicitem style="width: 10%"> + <div>8</div> + </div> + <div class=graphicitem style="width: 10%"> + <div>10</div> + </div> + <div class=graphicitem style="width: 10%"> + <div>12</div> + </div> + <div class=graphicitem style="width: 10%"> + <div>14</div> + </div> + <div class=graphicitem style="width: 10%"> + <div>16</div> + </div> + <div class=graphicitem style="width: 10%"> + <div>18</div> + </div> + <div class=graphicitem style="width: 10%"> + <div>20</div> + </div> + </div> + </div> + <div style="clear: left"></div> + </div> + + <a class=matchresult + href="#hit6-1" + onmouseover='document.getElementById("defline6").innerHTML="AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000"' + onmouseout='document.getElementById("defline6").innerHTML="Mouse-over to show defline and scores, click to show alignments"' + title="AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000"> + <div class="matchrow graphicrow"> + <div class="matchitem graphicitem" + style="background-color: black; width: 100%"></div> + </div> + </a> + + </div> + </div> + </div> + </section> + + + + <section class=descriptions> + <h2>Descriptions</h2> + + <div class=grey><div class=white> + <h4 class=darkHeader>Sequences producing significant alignments:</h4> + + <table class=descriptiontable> + <col/><col/><col/><col/><col/><col/><col/> + <tr> + <th>Description</th> + <th>Max score</th> + <th>Total score</th> + <th>Query cover</th> + <th>E value</th> + <th>Ident</th> + <th>Accession</th> + </tr> + <tr> + <td><div><a href="#hit6-1" + title="AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000" + id="description6-1"> + AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000 + </a></div></td> + <td>37.4</td> + <td>37.4</td> + <td>100%</td> + <td>7.011e-08</td> + <td>100%</td> + <td><a href="http://example.com/example-genebank?id=Subject_6">Subject_6</a></td> + </tr> + </table> + + </div></div> + </section> + + + + <section class=alignments> + <h2>Alignments</h2> + + <div class=grey><div class=white> + <div class=alignment id=hit6-1> + + <div class=linkheader> + <div class=right><a href="#description6-1">Descriptions</a></div> + <a class="linkheader" href="http://example.com/example-genebank?id=Subject_6">Gene Bank</a> + </div> + + <div class=title> + <p class=hittitle>AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000</p> + <p class=titleinfo> + <span class=b>Sequence ID:</span> <a href="http://example.com/example-genebank?id=Subject_6">Subject_6</a> + <span class=b>Length:</span> 2457 + <span class=b>Number of Matches:</span> 1 + </p> + </div> + + + <div class=hotspot id=hotspot6-1-1> + <p class=range> + <span class=range>Range 1: 2119 to 2138</span> + </p> + + <table class=hotspotstable> + <tr> + <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> + </tr> + <tr> + <td>37.4 bits(40)</td> + <td>0.0</td> + <td>20/20(100%)</td> + <td>0/20(0%)</td> + <td>Plus/Plus</td> + </tr> + </table> + + <pre class=alignmentgraphic>Query 1 AGCGCGCAAACTAGGATAAA 20 + |||||||||||||||||||| +Subject 2119 AGCGCGCAAACTAGGATAAA 2138</pre> + </div> + + </div> + + </div></div> + </section> + </section> + + <section class=match id=match7> + + <h1>Nucleotide Sequence (20 letters)</h1> + + <section class=header> + + <table class=headerdata> + <tr><td class=param>Query ID:</td><td>Query_1</td></tr> + <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> + <tr><td class=param>Query length:</td><td>20</td></tr> + <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> + <tr><td class=param>Database:</td><td></td></tr> + </table> + + </section> + + <section> + <h2>No Hits</h2> + <div class=grey> + <table class=headerdata> + <tr><td class=param>Message:</td><td>No hits found</td></tr> + </table> + </div> + </section> + </section> + + <section class=match id=match8> + + <h1>Nucleotide Sequence (20 letters)</h1> + + <section class=header> + + <table class=headerdata> + <tr><td class=param>Query ID:</td><td>Query_1</td></tr> + <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> + <tr><td class=param>Query length:</td><td>20</td></tr> + <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> + <tr><td class=param>Database:</td><td></td></tr> + </table> + + </section> + + <section> + <h2>No Hits</h2> + <div class=grey> + <table class=headerdata> + <tr><td class=param>Message:</td><td>No hits found</td></tr> + </table> + </div> + </section> + </section> + + <section class=match id=match9> + + <h1>Nucleotide Sequence (20 letters)</h1> + + <section class=header> + + <table class=headerdata> + <tr><td class=param>Query ID:</td><td>Query_1</td></tr> + <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> + <tr><td class=param>Query length:</td><td>20</td></tr> + <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> + <tr><td class=param>Database:</td><td></td></tr> + </table> + + </section> + + <section> + <h2>No Hits</h2> + <div class=grey> + <table class=headerdata> + <tr><td class=param>Message:</td><td>No hits found</td></tr> + </table> + </div> + </section> + </section> + + <section class=match id=match10> + + <h1>Nucleotide Sequence (20 letters)</h1> + + <section class=header> + + <table class=headerdata> + <tr><td class=param>Query ID:</td><td>Query_1</td></tr> + <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> + <tr><td class=param>Query length:</td><td>20</td></tr> + <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> + <tr><td class=param>Database:</td><td></td></tr> + </table> + + </section> + + <section> + <h2>No Hits</h2> + <div class=grey> + <table class=headerdata> + <tr><td class=param>Message:</td><td>No hits found</td></tr> + </table> + </div> + </section> + </section> + + <section class=match id=match11> + + <h1>Nucleotide Sequence (20 letters)</h1> + + <section class=header> + + <table class=headerdata> + <tr><td class=param>Query ID:</td><td>Query_1</td></tr> + <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> + <tr><td class=param>Query length:</td><td>20</td></tr> + <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> + <tr><td class=param>Database:</td><td></td></tr> + </table> + + </section> + + <section> + <h2>No Hits</h2> + <div class=grey> + <table class=headerdata> + <tr><td class=param>Message:</td><td>No hits found</td></tr> + </table> + </div> + </section> + </section> + + <section class=match id=match12> + + <h1>Nucleotide Sequence (20 letters)</h1> + + <section class=header> + + <table class=headerdata> + <tr><td class=param>Query ID:</td><td>Query_1</td></tr> + <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> + <tr><td class=param>Query length:</td><td>20</td></tr> + <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> + <tr><td class=param>Database:</td><td></td></tr> + </table> + + </section> + + <section> + <h2>No Hits</h2> + <div class=grey> + <table class=headerdata> + <tr><td class=param>Message:</td><td>No hits found</td></tr> + </table> + </div> + </section> + </section> + + <section class=match id=match13> + + <h1>Nucleotide Sequence (20 letters)</h1> + + <section class=header> + + <table class=headerdata> + <tr><td class=param>Query ID:</td><td>Query_1</td></tr> + <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> + <tr><td class=param>Query length:</td><td>20</td></tr> + <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> + <tr><td class=param>Database:</td><td></td></tr> + </table> + + </section> + + <section> + <h2>No Hits</h2> + <div class=grey> + <table class=headerdata> + <tr><td class=param>Message:</td><td>No hits found</td></tr> + </table> + </div> + </section> + </section> + + <section class=match id=match14> + + <h1>Nucleotide Sequence (20 letters)</h1> + + <section class=header> + + <table class=headerdata> + <tr><td class=param>Query ID:</td><td>Query_1</td></tr> + <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> + <tr><td class=param>Query length:</td><td>20</td></tr> + <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> + <tr><td class=param>Database:</td><td></td></tr> + </table> + + </section> + + <section> + <h2>No Hits</h2> + <div class=grey> + <table class=headerdata> + <tr><td class=param>Message:</td><td>No hits found</td></tr> + </table> + </div> + </section> + </section> + + <section class=match id=match15> + + <h1>Nucleotide Sequence (20 letters)</h1> + + <section class=header> + + <table class=headerdata> + <tr><td class=param>Query ID:</td><td>Query_1</td></tr> + <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> + <tr><td class=param>Query length:</td><td>20</td></tr> + <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> + <tr><td class=param>Database:</td><td></td></tr> + </table> + + </section> + + <section> + <h2>No Hits</h2> + <div class=grey> + <table class=headerdata> + <tr><td class=param>Message:</td><td>No hits found</td></tr> + </table> + </div> + </section> + </section> + + <section class=match id=match16> + + <h1>Nucleotide Sequence (20 letters)</h1> + + <section class=header> + + <table class=headerdata> + <tr><td class=param>Query ID:</td><td>Query_1</td></tr> + <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> + <tr><td class=param>Query length:</td><td>20</td></tr> + <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> + <tr><td class=param>Database:</td><td></td></tr> + </table> + + </section> + + <section> + <h2>No Hits</h2> + <div class=grey> + <table class=headerdata> + <tr><td class=param>Message:</td><td>No hits found</td></tr> + </table> + </div> + </section> + </section> + + <section class=match id=match17> + + <h1>Nucleotide Sequence (20 letters)</h1> + + <section class=header> + + <table class=headerdata> + <tr><td class=param>Query ID:</td><td>Query_1</td></tr> + <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> + <tr><td class=param>Query length:</td><td>20</td></tr> + <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> + <tr><td class=param>Database:</td><td></td></tr> + </table> + + </section> + + <section> + <h2>No Hits</h2> + <div class=grey> + <table class=headerdata> + <tr><td class=param>Message:</td><td>No hits found</td></tr> + </table> + </div> + </section> + </section> + + <section class=match id=match18> + + <h1>Nucleotide Sequence (20 letters)</h1> + + <section class=header> + + <table class=headerdata> + <tr><td class=param>Query ID:</td><td>Query_1</td></tr> + <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> + <tr><td class=param>Query length:</td><td>20</td></tr> + <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> + <tr><td class=param>Database:</td><td></td></tr> + </table> + + </section> + + + <section class=graphics> + <h2>Graphic Summary</h2> + + <div class=grey> + <h3 class=centered>Distribution of 56 Blast Hits on the Query Sequence</h3> + + <div class=defline id=defline18> + Mouse-over to show defline and scores, click to show alignments + </div> + + <div class=graphic> + <h4 class=darkHeader>Color key for alignment scores</h4> + <div class=legend><div class=graphicrow> + <div class=graphicitem style="background-color: black"><40</div> + <div class=graphicitem style="background-color: blue">40–50</div> + <div class=graphicitem style="background-color: green">50–80</div> + <div class=graphicitem style="background-color: magenta">80–200</div> + <div class=graphicitem style="background-color: red">200≤</div> + </div></div> + <div style="clear: left"></div> + + <div class=tablewrapper> + + <div class=scale> + <div>query:</div> + <div class=graphicrow> + <div> + <div class=graphicitem style="width: 10%"> + <div>2</div> + </div> + <div class=graphicitem style="width: 10%"> + <div>4</div> + </div> + <div class=graphicitem style="width: 10%"> + <div>6</div> + </div> + <div class=graphicitem style="width: 10%"> + <div>8</div> + </div> + <div class=graphicitem style="width: 10%"> + <div>10</div> + </div> + <div class=graphicitem style="width: 10%"> + <div>12</div> + </div> + <div class=graphicitem style="width: 10%"> + <div>14</div> + </div> + <div class=graphicitem style="width: 10%"> + <div>16</div> + </div> + <div class=graphicitem style="width: 10%"> + <div>18</div> + </div> + <div class=graphicitem style="width: 10%"> + <div>20</div> + </div> + </div> + </div> + <div style="clear: left"></div> + </div> + + <a class=matchresult + href="#hit18-1" + onmouseover='document.getElementById("defline18").innerHTML="AJ308515.1|GenBank|insert_GTS-40-3-2|Synthetic_construct_for_NOS_3\u0027UTR/plant_junction_region.|-9105899556052450000"' + onmouseout='document.getElementById("defline18").innerHTML="Mouse-over to show defline and scores, click to show alignments"' + title="AJ308515.1|GenBank|insert_GTS-40-3-2|Synthetic_construct_for_NOS_3'UTR/plant_junction_region.|-9105899556052450000"> + <div class="matchrow graphicrow"> + <div class="matchitem graphicitem" + style="background-color: transparent; width: 15%"></div> + <div class="matchitem graphicitem" + style="background-color: black; width: 85%"></div> + </div> + </a> + + </div> + </div> + </div> + </section> + + + + <section class=descriptions> + <h2>Descriptions</h2> + + <div class=grey><div class=white> + <h4 class=darkHeader>Sequences producing significant alignments:</h4> + + <table class=descriptiontable> + <col/><col/><col/><col/><col/><col/><col/> + <tr> + <th>Description</th> + <th>Max score</th> + <th>Total score</th> + <th>Query cover</th> + <th>E value</th> + <th>Ident</th> + <th>Accession</th> + </tr> + <tr> + <td><div><a href="#hit18-1" + title="AJ308515.1|GenBank|insert_GTS-40-3-2|Synthetic_construct_for_NOS_3'UTR/plant_junction_region.|-9105899556052450000" + id="description18-1"> + AJ308515.1|GenBank|insert_GTS-40-3-2|Synthetic_construct_for_NOS_3'UTR/plant_junction_region.|-9105899556052450000 + </a></div></td> + <td>31.9</td> + <td>31.9</td> + <td>85%</td> + <td>2.981e-06</td> + <td>100%</td> + <td><a href="http://example.com/example-genebank?id=Subject_2">Subject_2</a></td> + </tr> + </table> + + </div></div> + </section> + + + + <section class=alignments> + <h2>Alignments</h2> + + <div class=grey><div class=white> + <div class=alignment id=hit18-1> + + <div class=linkheader> + <div class=right><a href="#description18-1">Descriptions</a></div> + <a class="linkheader" href="http://example.com/example-genebank?id=Subject_2">Gene Bank</a> + </div> + + <div class=title> + <p class=hittitle>AJ308515.1|GenBank|insert_GTS-40-3-2|Synthetic_construct_for_NOS_3'UTR/plant_junction_region.|-9105899556052450000</p> + <p class=titleinfo> + <span class=b>Sequence ID:</span> <a href="http://example.com/example-genebank?id=Subject_2">Subject_2</a> + <span class=b>Length:</span> 1045 + <span class=b>Number of Matches:</span> 1 + </p> + </div> + + + <div class=hotspot id=hotspot18-1-1> + <p class=range> + <span class=range>Range 1: 2 to 18</span> + </p> + + <table class=hotspotstable> + <tr> + <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> + </tr> + <tr> + <td>31.9 bits(34)</td> + <td>0.0</td> + <td>17/17(100%)</td> + <td>0/17(0%)</td> + <td>Plus/Plus</td> + </tr> + </table> + + <pre class=alignmentgraphic>Query 4 GCGCGGTGTCATCTATG 20 + ||||||||||||||||| +Subject 2 GCGCGGTGTCATCTATG 18</pre> + </div> + + </div> + + </div></div> + </section> + </section> + + <section class=match id=match19> + + <h1>Nucleotide Sequence (20 letters)</h1> + + <section class=header> + + <table class=headerdata> + <tr><td class=param>Query ID:</td><td>Query_1</td></tr> + <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> + <tr><td class=param>Query length:</td><td>20</td></tr> + <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> + <tr><td class=param>Database:</td><td></td></tr> + </table> + + </section> + + + <section class=graphics> + <h2>Graphic Summary</h2> + + <div class=grey> + <h3 class=centered>Distribution of 56 Blast Hits on the Query Sequence</h3> + + <div class=defline id=defline19> + Mouse-over to show defline and scores, click to show alignments + </div> + + <div class=graphic> + <h4 class=darkHeader>Color key for alignment scores</h4> + <div class=legend><div class=graphicrow> + <div class=graphicitem style="background-color: black"><40</div> + <div class=graphicitem style="background-color: blue">40–50</div> + <div class=graphicitem style="background-color: green">50–80</div> + <div class=graphicitem style="background-color: magenta">80–200</div> + <div class=graphicitem style="background-color: red">200≤</div> + </div></div> + <div style="clear: left"></div> + + <div class=tablewrapper> + + <div class=scale> + <div>query:</div> + <div class=graphicrow> + <div> + <div class=graphicitem style="width: 10%"> + <div>2</div> + </div> + <div class=graphicitem style="width: 10%"> + <div>4</div> + </div> + <div class=graphicitem style="width: 10%"> + <div>6</div> + </div> + <div class=graphicitem style="width: 10%"> + <div>8</div> + </div> + <div class=graphicitem style="width: 10%"> + <div>10</div> + </div> + <div class=graphicitem style="width: 10%"> + <div>12</div> + </div> + <div class=graphicitem style="width: 10%"> + <div>14</div> + </div> + <div class=graphicitem style="width: 10%"> + <div>16</div> + </div> + <div class=graphicitem style="width: 10%"> + <div>18</div> + </div> + <div class=graphicitem style="width: 10%"> + <div>20</div> + </div> + </div> + </div> + <div style="clear: left"></div> + </div> + + <a class=matchresult + href="#hit19-1" + onmouseover='document.getElementById("defline19").innerHTML="DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000"' + onmouseout='document.getElementById("defline19").innerHTML="Mouse-over to show defline and scores, click to show alignments"' + title="DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000"> + <div class="matchrow graphicrow"> + <div class="matchitem graphicitem" + style="background-color: black; width: 100%"></div> + </div> + </a> + + </div> + </div> + </div> + </section> + + + + <section class=descriptions> + <h2>Descriptions</h2> + + <div class=grey><div class=white> + <h4 class=darkHeader>Sequences producing significant alignments:</h4> + + <table class=descriptiontable> + <col/><col/><col/><col/><col/><col/><col/> + <tr> + <th>Description</th> + <th>Max score</th> + <th>Total score</th> + <th>Query cover</th> + <th>E value</th> + <th>Ident</th> + <th>Accession</th> + </tr> + <tr> + <td><div><a href="#hit19-1" + title="DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000" + id="description19-1"> + DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000 + </a></div></td> + <td>37.4</td> + <td>37.4</td> + <td>100%</td> + <td>7.011e-08</td> + <td>100%</td> + <td><a href="http://example.com/example-genebank?id=Subject_3">Subject_3</a></td> + </tr> + </table> + + </div></div> + </section> + + + + <section class=alignments> + <h2>Alignments</h2> + + <div class=grey><div class=white> + <div class=alignment id=hit19-1> + + <div class=linkheader> + <div class=right><a href="#description19-1">Descriptions</a></div> + <a class="linkheader" href="http://example.com/example-genebank?id=Subject_3">Gene Bank</a> + </div> + + <div class=title> + <p class=hittitle>DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000</p> + <p class=titleinfo> + <span class=b>Sequence ID:</span> <a href="http://example.com/example-genebank?id=Subject_3">Subject_3</a> + <span class=b>Length:</span> 323 + <span class=b>Number of Matches:</span> 1 + </p> + </div> + + + <div class=hotspot id=hotspot19-1-1> + <p class=range> + <span class=range>Range 1: 224 to 243</span> + </p> + + <table class=hotspotstable> + <tr> + <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> + </tr> + <tr> + <td>37.4 bits(40)</td> + <td>0.0</td> + <td>20/20(100%)</td> + <td>0/20(0%)</td> + <td>Plus/Plus</td> + </tr> + </table> + + <pre class=alignmentgraphic>Query 1 CGCGCGCGGTGTCATCTATG 20 + |||||||||||||||||||| +Subject 224 CGCGCGCGGTGTCATCTATG 243</pre> + </div> + + </div> + + </div></div> + </section> + </section> + + <section class=match id=match20> + + <h1>Nucleotide Sequence (20 letters)</h1> + + <section class=header> + + <table class=headerdata> + <tr><td class=param>Query ID:</td><td>Query_1</td></tr> + <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> + <tr><td class=param>Query length:</td><td>20</td></tr> + <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> + <tr><td class=param>Database:</td><td></td></tr> + </table> + + </section> + + <section> + <h2>No Hits</h2> + <div class=grey> + <table class=headerdata> + <tr><td class=param>Message:</td><td>No hits found</td></tr> + </table> + </div> + </section> + </section> + + <section class=match id=match21> + + <h1>Nucleotide Sequence (20 letters)</h1> + + <section class=header> + + <table class=headerdata> + <tr><td class=param>Query ID:</td><td>Query_1</td></tr> + <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> + <tr><td class=param>Query length:</td><td>20</td></tr> + <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> + <tr><td class=param>Database:</td><td></td></tr> + </table> + + </section> + + <section> + <h2>No Hits</h2> + <div class=grey> + <table class=headerdata> + <tr><td class=param>Message:</td><td>No hits found</td></tr> + </table> + </div> + </section> + </section> + + <section class=match id=match22> + + <h1>Nucleotide Sequence (20 letters)</h1> + + <section class=header> + + <table class=headerdata> + <tr><td class=param>Query ID:</td><td>Query_1</td></tr> + <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> + <tr><td class=param>Query length:</td><td>20</td></tr> + <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> + <tr><td class=param>Database:</td><td></td></tr> + </table> + + </section> + + + <section class=graphics> + <h2>Graphic Summary</h2> + + <div class=grey> + <h3 class=centered>Distribution of 56 Blast Hits on the Query Sequence</h3> + + <div class=defline id=defline22> + Mouse-over to show defline and scores, click to show alignments + </div> + + <div class=graphic> + <h4 class=darkHeader>Color key for alignment scores</h4> + <div class=legend><div class=graphicrow> + <div class=graphicitem style="background-color: black"><40</div> + <div class=graphicitem style="background-color: blue">40–50</div> + <div class=graphicitem style="background-color: green">50–80</div> + <div class=graphicitem style="background-color: magenta">80–200</div> + <div class=graphicitem style="background-color: red">200≤</div> + </div></div> + <div style="clear: left"></div> + + <div class=tablewrapper> + + <div class=scale> + <div>query:</div> + <div class=graphicrow> + <div> + <div class=graphicitem style="width: 10%"> + <div>2</div> + </div> + <div class=graphicitem style="width: 10%"> + <div>4</div> + </div> + <div class=graphicitem style="width: 10%"> + <div>6</div> + </div> + <div class=graphicitem style="width: 10%"> + <div>8</div> + </div> + <div class=graphicitem style="width: 10%"> + <div>10</div> + </div> + <div class=graphicitem style="width: 10%"> + <div>12</div> + </div> + <div class=graphicitem style="width: 10%"> + <div>14</div> + </div> + <div class=graphicitem style="width: 10%"> + <div>16</div> + </div> + <div class=graphicitem style="width: 10%"> + <div>18</div> + </div> + <div class=graphicitem style="width: 10%"> + <div>20</div> + </div> + </div> + </div> + <div style="clear: left"></div> + </div> + + <a class=matchresult + href="#hit22-1" + onmouseover='document.getElementById("defline22").innerHTML="AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000"' + onmouseout='document.getElementById("defline22").innerHTML="Mouse-over to show defline and scores, click to show alignments"' + title="AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000"> + <div class="matchrow graphicrow"> + <div class="matchitem graphicitem" + style="background-color: black; width: 100%"></div> + </div> + </a> + + </div> + </div> + </div> + </section> + + + + <section class=descriptions> + <h2>Descriptions</h2> + + <div class=grey><div class=white> + <h4 class=darkHeader>Sequences producing significant alignments:</h4> + + <table class=descriptiontable> + <col/><col/><col/><col/><col/><col/><col/> + <tr> + <th>Description</th> + <th>Max score</th> + <th>Total score</th> + <th>Query cover</th> + <th>E value</th> + <th>Ident</th> + <th>Accession</th> + </tr> + <tr> + <td><div><a href="#hit22-1" + title="AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000" + id="description22-1"> + AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000 + </a></div></td> + <td>37.4</td> + <td>37.4</td> + <td>100%</td> + <td>7.011e-08</td> + <td>100%</td> + <td><a href="http://example.com/example-genebank?id=Subject_6">Subject_6</a></td> + </tr> + </table> + + </div></div> + </section> + + + + <section class=alignments> + <h2>Alignments</h2> + + <div class=grey><div class=white> + <div class=alignment id=hit22-1> + + <div class=linkheader> + <div class=right><a href="#description22-1">Descriptions</a></div> + <a class="linkheader" href="http://example.com/example-genebank?id=Subject_6">Gene Bank</a> + </div> + + <div class=title> + <p class=hittitle>AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000</p> + <p class=titleinfo> + <span class=b>Sequence ID:</span> <a href="http://example.com/example-genebank?id=Subject_6">Subject_6</a> + <span class=b>Length:</span> 2457 + <span class=b>Number of Matches:</span> 1 + </p> + </div> + + + <div class=hotspot id=hotspot22-1-1> + <p class=range> + <span class=range>Range 1: 2143 to 2162</span> + </p> + + <table class=hotspotstable> + <tr> + <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> + </tr> + <tr> + <td>37.4 bits(40)</td> + <td>0.0</td> + <td>20/20(100%)</td> + <td>0/20(0%)</td> + <td>Plus/Plus</td> + </tr> + </table> + + <pre class=alignmentgraphic>Query 1 CGCGCGCGGTGTCATCTATG 20 + |||||||||||||||||||| +Subject 2143 CGCGCGCGGTGTCATCTATG 2162</pre> + </div> + + </div> + + </div></div> + </section> + </section> + + <section class=match id=match23> + + <h1>Nucleotide Sequence (20 letters)</h1> + + <section class=header> + + <table class=headerdata> + <tr><td class=param>Query ID:</td><td>Query_1</td></tr> + <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> + <tr><td class=param>Query length:</td><td>20</td></tr> + <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> + <tr><td class=param>Database:</td><td></td></tr> + </table> + + </section> + + <section> + <h2>No Hits</h2> + <div class=grey> + <table class=headerdata> + <tr><td class=param>Message:</td><td>No hits found</td></tr> + </table> + </div> + </section> + </section> + + <section class=match id=match24> + + <h1>Nucleotide Sequence (20 letters)</h1> + + <section class=header> + + <table class=headerdata> + <tr><td class=param>Query ID:</td><td>Query_1</td></tr> + <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> + <tr><td class=param>Query length:</td><td>20</td></tr> + <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> + <tr><td class=param>Database:</td><td></td></tr> + </table> + + </section> + + <section> + <h2>No Hits</h2> + <div class=grey> + <table class=headerdata> + <tr><td class=param>Message:</td><td>No hits found</td></tr> + </table> + </div> + </section> + </section> + + <section class=match id=match25> + + <h1>Nucleotide Sequence (24 letters)</h1> + + <section class=header> + + <table class=headerdata> + <tr><td class=param>Query ID:</td><td>Query_1</td></tr> + <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> + <tr><td class=param>Query length:</td><td>20</td></tr> + <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> + <tr><td class=param>Database:</td><td></td></tr> + </table> + + </section> + + <section> + <h2>No Hits</h2> + <div class=grey> + <table class=headerdata> + <tr><td class=param>Message:</td><td>No hits found</td></tr> + </table> + </div> + </section> + </section> + + <section class=match id=match26> + + <h1>Nucleotide Sequence (24 letters)</h1> + + <section class=header> + + <table class=headerdata> + <tr><td class=param>Query ID:</td><td>Query_1</td></tr> + <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> + <tr><td class=param>Query length:</td><td>20</td></tr> + <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> + <tr><td class=param>Database:</td><td></td></tr> + </table> + + </section> + + <section> + <h2>No Hits</h2> + <div class=grey> + <table class=headerdata> + <tr><td class=param>Message:</td><td>No hits found</td></tr> + </table> + </div> + </section> + </section> + + <section class=match id=match27> + + <h1>Nucleotide Sequence (24 letters)</h1> + + <section class=header> + + <table class=headerdata> + <tr><td class=param>Query ID:</td><td>Query_1</td></tr> + <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> + <tr><td class=param>Query length:</td><td>20</td></tr> + <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> + <tr><td class=param>Database:</td><td></td></tr> + </table> + + </section> + + <section> + <h2>No Hits</h2> + <div class=grey> + <table class=headerdata> + <tr><td class=param>Message:</td><td>No hits found</td></tr> + </table> + </div> + </section> + </section> + + <section class=match id=match28> + + <h1>Nucleotide Sequence (24 letters)</h1> + + <section class=header> + + <table class=headerdata> + <tr><td class=param>Query ID:</td><td>Query_1</td></tr> + <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> + <tr><td class=param>Query length:</td><td>20</td></tr> + <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> + <tr><td class=param>Database:</td><td></td></tr> + </table> + + </section> + + <section> + <h2>No Hits</h2> + <div class=grey> + <table class=headerdata> + <tr><td class=param>Message:</td><td>No hits found</td></tr> + </table> + </div> + </section> + </section> + + <section class=match id=match29> + + <h1>Nucleotide Sequence (24 letters)</h1> + + <section class=header> + + <table class=headerdata> + <tr><td class=param>Query ID:</td><td>Query_1</td></tr> + <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> + <tr><td class=param>Query length:</td><td>20</td></tr> + <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> + <tr><td class=param>Database:</td><td></td></tr> + </table> + + </section> + + <section> + <h2>No Hits</h2> + <div class=grey> + <table class=headerdata> + <tr><td class=param>Message:</td><td>No hits found</td></tr> + </table> + </div> + </section> + </section> + + <section class=match id=match30> + + <h1>Nucleotide Sequence (24 letters)</h1> + + <section class=header> + + <table class=headerdata> + <tr><td class=param>Query ID:</td><td>Query_1</td></tr> + <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> + <tr><td class=param>Query length:</td><td>20</td></tr> + <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> + <tr><td class=param>Database:</td><td></td></tr> + </table> + + </section> + + <section> + <h2>No Hits</h2> + <div class=grey> + <table class=headerdata> + <tr><td class=param>Message:</td><td>No hits found</td></tr> + </table> + </div> + </section> + </section> + + <section class=match id=match31> + + <h1>Nucleotide Sequence (24 letters)</h1> + + <section class=header> + + <table class=headerdata> + <tr><td class=param>Query ID:</td><td>Query_1</td></tr> + <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> + <tr><td class=param>Query length:</td><td>20</td></tr> + <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> + <tr><td class=param>Database:</td><td></td></tr> + </table> + + </section> + + <section> + <h2>No Hits</h2> + <div class=grey> + <table class=headerdata> + <tr><td class=param>Message:</td><td>No hits found</td></tr> + </table> + </div> + </section> + </section> + + <section class=match id=match32> + + <h1>Nucleotide Sequence (24 letters)</h1> + + <section class=header> + + <table class=headerdata> + <tr><td class=param>Query ID:</td><td>Query_1</td></tr> + <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> + <tr><td class=param>Query length:</td><td>20</td></tr> + <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> + <tr><td class=param>Database:</td><td></td></tr> + </table> + + </section> + + <section> + <h2>No Hits</h2> + <div class=grey> + <table class=headerdata> + <tr><td class=param>Message:</td><td>No hits found</td></tr> + </table> + </div> + </section> + </section> + + <section class=match id=match33> + + <h1>Nucleotide Sequence (20 letters)</h1> + + <section class=header> + + <table class=headerdata> + <tr><td class=param>Query ID:</td><td>Query_1</td></tr> + <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> + <tr><td class=param>Query length:</td><td>20</td></tr> + <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> + <tr><td class=param>Database:</td><td></td></tr> + </table> + + </section> + + <section> + <h2>No Hits</h2> + <div class=grey> + <table class=headerdata> + <tr><td class=param>Message:</td><td>No hits found</td></tr> + </table> + </div> + </section> + </section> + + <section class=match id=match34> + + <h1>Nucleotide Sequence (20 letters)</h1> + + <section class=header> + + <table class=headerdata> + <tr><td class=param>Query ID:</td><td>Query_1</td></tr> + <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> + <tr><td class=param>Query length:</td><td>20</td></tr> + <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> + <tr><td class=param>Database:</td><td></td></tr> + </table> + + </section> + + <section> + <h2>No Hits</h2> + <div class=grey> + <table class=headerdata> + <tr><td class=param>Message:</td><td>No hits found</td></tr> + </table> + </div> + </section> + </section> + + <section class=match id=match35> + + <h1>Nucleotide Sequence (20 letters)</h1> + + <section class=header> + + <table class=headerdata> + <tr><td class=param>Query ID:</td><td>Query_1</td></tr> + <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> + <tr><td class=param>Query length:</td><td>20</td></tr> + <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> + <tr><td class=param>Database:</td><td></td></tr> + </table> + + </section> + + <section> + <h2>No Hits</h2> + <div class=grey> + <table class=headerdata> + <tr><td class=param>Message:</td><td>No hits found</td></tr> + </table> + </div> + </section> + </section> + + <section class=match id=match36> + + <h1>Nucleotide Sequence (20 letters)</h1> + + <section class=header> + + <table class=headerdata> + <tr><td class=param>Query ID:</td><td>Query_1</td></tr> + <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> + <tr><td class=param>Query length:</td><td>20</td></tr> + <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> + <tr><td class=param>Database:</td><td></td></tr> + </table> + + </section> + + <section> + <h2>No Hits</h2> + <div class=grey> + <table class=headerdata> + <tr><td class=param>Message:</td><td>No hits found</td></tr> + </table> + </div> + </section> + </section> + + <section class=match id=match37> + + <h1>Nucleotide Sequence (20 letters)</h1> + + <section class=header> + + <table class=headerdata> + <tr><td class=param>Query ID:</td><td>Query_1</td></tr> + <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> + <tr><td class=param>Query length:</td><td>20</td></tr> + <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> + <tr><td class=param>Database:</td><td></td></tr> + </table> + + </section> + + <section> + <h2>No Hits</h2> + <div class=grey> + <table class=headerdata> + <tr><td class=param>Message:</td><td>No hits found</td></tr> + </table> + </div> + </section> + </section> + + <section class=match id=match38> + + <h1>Nucleotide Sequence (20 letters)</h1> + + <section class=header> + + <table class=headerdata> + <tr><td class=param>Query ID:</td><td>Query_1</td></tr> + <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> + <tr><td class=param>Query length:</td><td>20</td></tr> + <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> + <tr><td class=param>Database:</td><td></td></tr> + </table> + + </section> + + <section> + <h2>No Hits</h2> + <div class=grey> + <table class=headerdata> + <tr><td class=param>Message:</td><td>No hits found</td></tr> + </table> + </div> + </section> + </section> + + <section class=match id=match39> + + <h1>Nucleotide Sequence (20 letters)</h1> + + <section class=header> + + <table class=headerdata> + <tr><td class=param>Query ID:</td><td>Query_1</td></tr> + <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> + <tr><td class=param>Query length:</td><td>20</td></tr> + <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> + <tr><td class=param>Database:</td><td></td></tr> + </table> + + </section> + + <section> + <h2>No Hits</h2> + <div class=grey> + <table class=headerdata> + <tr><td class=param>Message:</td><td>No hits found</td></tr> + </table> + </div> + </section> + </section> + + <section class=match id=match40> + + <h1>Nucleotide Sequence (20 letters)</h1> + + <section class=header> + + <table class=headerdata> + <tr><td class=param>Query ID:</td><td>Query_1</td></tr> + <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> + <tr><td class=param>Query length:</td><td>20</td></tr> + <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> + <tr><td class=param>Database:</td><td></td></tr> + </table> + + </section> + + <section> + <h2>No Hits</h2> + <div class=grey> + <table class=headerdata> + <tr><td class=param>Message:</td><td>No hits found</td></tr> + </table> + </div> + </section> + </section> + + <section class=match id=match41> + + <h1>Nucleotide Sequence (25 letters)</h1> + + <section class=header> + + <table class=headerdata> + <tr><td class=param>Query ID:</td><td>Query_1</td></tr> + <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> + <tr><td class=param>Query length:</td><td>20</td></tr> + <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> + <tr><td class=param>Database:</td><td></td></tr> + </table> + + </section> + + <section> + <h2>No Hits</h2> + <div class=grey> + <table class=headerdata> + <tr><td class=param>Message:</td><td>No hits found</td></tr> + </table> + </div> + </section> + </section> + + <section class=match id=match42> + + <h1>Nucleotide Sequence (25 letters)</h1> + + <section class=header> + + <table class=headerdata> + <tr><td class=param>Query ID:</td><td>Query_1</td></tr> + <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> + <tr><td class=param>Query length:</td><td>20</td></tr> + <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> + <tr><td class=param>Database:</td><td></td></tr> + </table> + + </section> + + <section> + <h2>No Hits</h2> + <div class=grey> + <table class=headerdata> + <tr><td class=param>Message:</td><td>No hits found</td></tr> + </table> + </div> + </section> + </section> + + <section class=match id=match43> + + <h1>Nucleotide Sequence (25 letters)</h1> + + <section class=header> + + <table class=headerdata> + <tr><td class=param>Query ID:</td><td>Query_1</td></tr> + <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> + <tr><td class=param>Query length:</td><td>20</td></tr> + <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> + <tr><td class=param>Database:</td><td></td></tr> + </table> + + </section> + + <section> + <h2>No Hits</h2> + <div class=grey> + <table class=headerdata> + <tr><td class=param>Message:</td><td>No hits found</td></tr> + </table> + </div> + </section> + </section> + + <section class=match id=match44> + + <h1>Nucleotide Sequence (25 letters)</h1> + + <section class=header> + + <table class=headerdata> + <tr><td class=param>Query ID:</td><td>Query_1</td></tr> + <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> + <tr><td class=param>Query length:</td><td>20</td></tr> + <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> + <tr><td class=param>Database:</td><td></td></tr> + </table> + + </section> + + <section> + <h2>No Hits</h2> + <div class=grey> + <table class=headerdata> + <tr><td class=param>Message:</td><td>No hits found</td></tr> + </table> + </div> + </section> + </section> + + <section class=match id=match45> + + <h1>Nucleotide Sequence (25 letters)</h1> + + <section class=header> + + <table class=headerdata> + <tr><td class=param>Query ID:</td><td>Query_1</td></tr> + <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> + <tr><td class=param>Query length:</td><td>20</td></tr> + <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> + <tr><td class=param>Database:</td><td></td></tr> + </table> + + </section> + + <section> + <h2>No Hits</h2> + <div class=grey> + <table class=headerdata> + <tr><td class=param>Message:</td><td>No hits found</td></tr> + </table> + </div> + </section> + </section> + + <section class=match id=match46> + + <h1>Nucleotide Sequence (25 letters)</h1> + + <section class=header> + + <table class=headerdata> + <tr><td class=param>Query ID:</td><td>Query_1</td></tr> + <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> + <tr><td class=param>Query length:</td><td>20</td></tr> + <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> + <tr><td class=param>Database:</td><td></td></tr> + </table> + + </section> + + <section> + <h2>No Hits</h2> + <div class=grey> + <table class=headerdata> + <tr><td class=param>Message:</td><td>No hits found</td></tr> + </table> + </div> + </section> + </section> + + <section class=match id=match47> + + <h1>Nucleotide Sequence (25 letters)</h1> + + <section class=header> + + <table class=headerdata> + <tr><td class=param>Query ID:</td><td>Query_1</td></tr> + <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> + <tr><td class=param>Query length:</td><td>20</td></tr> + <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> + <tr><td class=param>Database:</td><td></td></tr> + </table> + + </section> + + + <section class=graphics> + <h2>Graphic Summary</h2> + + <div class=grey> + <h3 class=centered>Distribution of 56 Blast Hits on the Query Sequence</h3> + + <div class=defline id=defline47> + Mouse-over to show defline and scores, click to show alignments + </div> + + <div class=graphic> + <h4 class=darkHeader>Color key for alignment scores</h4> + <div class=legend><div class=graphicrow> + <div class=graphicitem style="background-color: black"><40</div> + <div class=graphicitem style="background-color: blue">40–50</div> + <div class=graphicitem style="background-color: green">50–80</div> + <div class=graphicitem style="background-color: magenta">80–200</div> + <div class=graphicitem style="background-color: red">200≤</div> + </div></div> + <div style="clear: left"></div> + + <div class=tablewrapper> + + <div class=scale> + <div>query:</div> + <div class=graphicrow> + <div> + <div class=graphicitem style="width: 12%"> + <div>3</div> + </div> + <div class=graphicitem style="width: 12%"> + <div>6</div> + </div> + <div class=graphicitem style="width: 12%"> + <div>9</div> + </div> + <div class=graphicitem style="width: 12%"> + <div>12</div> + </div> + <div class=graphicitem style="width: 12%"> + <div>15</div> + </div> + <div class=graphicitem style="width: 12%"> + <div>18</div> + </div> + <div class=graphicitem style="width: 12%"> + <div>21</div> + </div> + <div class=graphicitem style="width: 12%"> + <div>24</div> + </div> + <div class=graphicitem style="width: 4%"> + <div>25</div> + </div> + </div> + </div> + <div style="clear: left"></div> + </div> + + <a class=matchresult + href="#hit47-1" + onmouseover='document.getElementById("defline47").innerHTML="AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000"' + onmouseout='document.getElementById("defline47").innerHTML="Mouse-over to show defline and scores, click to show alignments"' + title="AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000"> + <div class="matchrow graphicrow"> + <div class="matchitem graphicitem" + style="background-color: black; width: 100%"></div> + </div> + </a> + + </div> + </div> + </div> + </section> + + + + <section class=descriptions> + <h2>Descriptions</h2> + + <div class=grey><div class=white> + <h4 class=darkHeader>Sequences producing significant alignments:</h4> + + <table class=descriptiontable> + <col/><col/><col/><col/><col/><col/><col/> + <tr> + <th>Description</th> + <th>Max score</th> + <th>Total score</th> + <th>Query cover</th> + <th>E value</th> + <th>Ident</th> + <th>Accession</th> + </tr> + <tr> + <td><div><a href="#hit47-1" + title="AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000" + id="description47-1"> + AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000 + </a></div></td> + <td>37.4</td> + <td>37.4</td> + <td>100%</td> + <td>9.338e-08</td> + <td>92%</td> + <td><a href="http://example.com/example-genebank?id=Subject_7">Subject_7</a></td> + </tr> + </table> + + </div></div> + </section> + + + + <section class=alignments> + <h2>Alignments</h2> + + <div class=grey><div class=white> + <div class=alignment id=hit47-1> + + <div class=linkheader> + <div class=right><a href="#description47-1">Descriptions</a></div> + <a class="linkheader" href="http://example.com/example-genebank?id=Subject_7">Gene Bank</a> + </div> + + <div class=title> + <p class=hittitle>AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000</p> + <p class=titleinfo> + <span class=b>Sequence ID:</span> <a href="http://example.com/example-genebank?id=Subject_7">Subject_7</a> + <span class=b>Length:</span> 4180 + <span class=b>Number of Matches:</span> 1 + </p> + </div> + + + <div class=hotspot id=hotspot47-1-1> + <p class=range> + <span class=range>Range 1: 1541 to 1565</span> + </p> + + <table class=hotspotstable> + <tr> + <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> + </tr> + <tr> + <td>37.4 bits(40)</td> + <td>0.0</td> + <td>23/25(92%)</td> + <td>0/25(0%)</td> + <td>Plus/Plus</td> + </tr> + </table> + + <pre class=alignmentgraphic>Query 1 ACATGAACAGCGCCTTGACCACAGC 25 + |||||||||||||| ||||||| || +Subject 1541 ACATGAACAGCGCCCTGACCACCGC 1565</pre> + </div> + + </div> + + </div></div> + </section> + </section> + + <section class=match id=match48> + + <h1>Nucleotide Sequence (25 letters)</h1> + + <section class=header> + + <table class=headerdata> + <tr><td class=param>Query ID:</td><td>Query_1</td></tr> + <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> + <tr><td class=param>Query length:</td><td>20</td></tr> + <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> + <tr><td class=param>Database:</td><td></td></tr> + </table> + + </section> + + + <section class=graphics> + <h2>Graphic Summary</h2> + + <div class=grey> + <h3 class=centered>Distribution of 56 Blast Hits on the Query Sequence</h3> + + <div class=defline id=defline48> + Mouse-over to show defline and scores, click to show alignments + </div> + + <div class=graphic> + <h4 class=darkHeader>Color key for alignment scores</h4> + <div class=legend><div class=graphicrow> + <div class=graphicitem style="background-color: black"><40</div> + <div class=graphicitem style="background-color: blue">40–50</div> + <div class=graphicitem style="background-color: green">50–80</div> + <div class=graphicitem style="background-color: magenta">80–200</div> + <div class=graphicitem style="background-color: red">200≤</div> + </div></div> + <div style="clear: left"></div> + + <div class=tablewrapper> + + <div class=scale> + <div>query:</div> + <div class=graphicrow> + <div> + <div class=graphicitem style="width: 12%"> + <div>3</div> + </div> + <div class=graphicitem style="width: 12%"> + <div>6</div> + </div> + <div class=graphicitem style="width: 12%"> + <div>9</div> + </div> + <div class=graphicitem style="width: 12%"> + <div>12</div> + </div> + <div class=graphicitem style="width: 12%"> + <div>15</div> + </div> + <div class=graphicitem style="width: 12%"> + <div>18</div> + </div> + <div class=graphicitem style="width: 12%"> + <div>21</div> + </div> + <div class=graphicitem style="width: 12%"> + <div>24</div> + </div> + <div class=graphicitem style="width: 4%"> + <div>25</div> + </div> + </div> + </div> + <div style="clear: left"></div> + </div> + + <a class=matchresult + href="#hit48-1" + onmouseover='document.getElementById("defline48").innerHTML="EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000"' + onmouseout='document.getElementById("defline48").innerHTML="Mouse-over to show defline and scores, click to show alignments"' + title="EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000"> + <div class="matchrow graphicrow"> + <div class="matchitem graphicitem" + style="background-color: black; width: 100%"></div> + </div> + </a> + + </div> + </div> + </div> + </section> + + + + <section class=descriptions> + <h2>Descriptions</h2> + + <div class=grey><div class=white> + <h4 class=darkHeader>Sequences producing significant alignments:</h4> + + <table class=descriptiontable> + <col/><col/><col/><col/><col/><col/><col/> + <tr> + <th>Description</th> + <th>Max score</th> + <th>Total score</th> + <th>Query cover</th> + <th>E value</th> + <th>Ident</th> + <th>Accession</th> + </tr> + <tr> + <td><div><a href="#hit48-1" + title="EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000" + id="description48-1"> + EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000 + </a></div></td> + <td>37.4</td> + <td>37.4</td> + <td>100%</td> + <td>9.338e-08</td> + <td>92%</td> + <td><a href="http://example.com/example-genebank?id=Subject_8">Subject_8</a></td> + </tr> + </table> + + </div></div> + </section> + + + + <section class=alignments> + <h2>Alignments</h2> + + <div class=grey><div class=white> + <div class=alignment id=hit48-1> + + <div class=linkheader> + <div class=right><a href="#description48-1">Descriptions</a></div> + <a class="linkheader" href="http://example.com/example-genebank?id=Subject_8">Gene Bank</a> + </div> + + <div class=title> + <p class=hittitle>EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000</p> + <p class=titleinfo> + <span class=b>Sequence ID:</span> <a href="http://example.com/example-genebank?id=Subject_8">Subject_8</a> + <span class=b>Length:</span> 4983 + <span class=b>Number of Matches:</span> 1 + </p> + </div> + + + <div class=hotspot id=hotspot48-1-1> + <p class=range> + <span class=range>Range 1: 2344 to 2368</span> + </p> + + <table class=hotspotstable> + <tr> + <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> + </tr> + <tr> + <td>37.4 bits(40)</td> + <td>0.0</td> + <td>23/25(92%)</td> + <td>0/25(0%)</td> + <td>Plus/Plus</td> + </tr> + </table> + + <pre class=alignmentgraphic>Query 1 ACATGAACAGCGCCTTGACCACAGC 25 + |||||||||||||| ||||||| || +Subject 2344 ACATGAACAGCGCCCTGACCACCGC 2368</pre> + </div> + + </div> + + </div></div> + </section> + </section> + + <section class=match id=match49> + + <h1>Nucleotide Sequence (74 letters)</h1> + + <section class=header> + + <table class=headerdata> + <tr><td class=param>Query ID:</td><td>Query_1</td></tr> + <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> + <tr><td class=param>Query length:</td><td>20</td></tr> + <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> + <tr><td class=param>Database:</td><td></td></tr> + </table> + + </section> + + <section> + <h2>No Hits</h2> + <div class=grey> + <table class=headerdata> + <tr><td class=param>Message:</td><td>No hits found</td></tr> + </table> + </div> + </section> + </section> + + <section class=match id=match50> + + <h1>Nucleotide Sequence (74 letters)</h1> + + <section class=header> + + <table class=headerdata> + <tr><td class=param>Query ID:</td><td>Query_1</td></tr> + <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> + <tr><td class=param>Query length:</td><td>20</td></tr> + <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> + <tr><td class=param>Database:</td><td></td></tr> + </table> + + </section> + + <section> + <h2>No Hits</h2> + <div class=grey> + <table class=headerdata> + <tr><td class=param>Message:</td><td>No hits found</td></tr> + </table> + </div> + </section> + </section> + + <section class=match id=match51> + + <h1>Nucleotide Sequence (74 letters)</h1> + + <section class=header> + + <table class=headerdata> + <tr><td class=param>Query ID:</td><td>Query_1</td></tr> + <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> + <tr><td class=param>Query length:</td><td>20</td></tr> + <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> + <tr><td class=param>Database:</td><td></td></tr> + </table> + + </section> + + <section> + <h2>No Hits</h2> + <div class=grey> + <table class=headerdata> + <tr><td class=param>Message:</td><td>No hits found</td></tr> + </table> + </div> + </section> + </section> + + <section class=match id=match52> + + <h1>Nucleotide Sequence (74 letters)</h1> + + <section class=header> + + <table class=headerdata> + <tr><td class=param>Query ID:</td><td>Query_1</td></tr> + <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> + <tr><td class=param>Query length:</td><td>20</td></tr> + <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> + <tr><td class=param>Database:</td><td></td></tr> + </table> + + </section> + + <section> + <h2>No Hits</h2> + <div class=grey> + <table class=headerdata> + <tr><td class=param>Message:</td><td>No hits found</td></tr> + </table> + </div> + </section> + </section> + + <section class=match id=match53> + + <h1>Nucleotide Sequence (74 letters)</h1> + + <section class=header> + + <table class=headerdata> + <tr><td class=param>Query ID:</td><td>Query_1</td></tr> + <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> + <tr><td class=param>Query length:</td><td>20</td></tr> + <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> + <tr><td class=param>Database:</td><td></td></tr> + </table> + + </section> + + <section> + <h2>No Hits</h2> + <div class=grey> + <table class=headerdata> + <tr><td class=param>Message:</td><td>No hits found</td></tr> + </table> + </div> + </section> + </section> + + <section class=match id=match54> + + <h1>Nucleotide Sequence (74 letters)</h1> + + <section class=header> + + <table class=headerdata> + <tr><td class=param>Query ID:</td><td>Query_1</td></tr> + <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> + <tr><td class=param>Query length:</td><td>20</td></tr> + <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> + <tr><td class=param>Database:</td><td></td></tr> + </table> + + </section> + + <section> + <h2>No Hits</h2> + <div class=grey> + <table class=headerdata> + <tr><td class=param>Message:</td><td>No hits found</td></tr> + </table> + </div> + </section> + </section> + + <section class=match id=match55> + + <h1>Nucleotide Sequence (74 letters)</h1> + + <section class=header> + + <table class=headerdata> + <tr><td class=param>Query ID:</td><td>Query_1</td></tr> + <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> + <tr><td class=param>Query length:</td><td>20</td></tr> + <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> + <tr><td class=param>Database:</td><td></td></tr> + </table> + + </section> + + + <section class=graphics> + <h2>Graphic Summary</h2> + + <div class=grey> + <h3 class=centered>Distribution of 56 Blast Hits on the Query Sequence</h3> + + <div class=defline id=defline55> + Mouse-over to show defline and scores, click to show alignments + </div> + + <div class=graphic> + <h4 class=darkHeader>Color key for alignment scores</h4> + <div class=legend><div class=graphicrow> + <div class=graphicitem style="background-color: black"><40</div> + <div class=graphicitem style="background-color: blue">40–50</div> + <div class=graphicitem style="background-color: green">50–80</div> + <div class=graphicitem style="background-color: magenta">80–200</div> + <div class=graphicitem style="background-color: red">200≤</div> + </div></div> + <div style="clear: left"></div> + + <div class=tablewrapper> + + <div class=scale> + <div>query:</div> + <div class=graphicrow> + <div> + <div class=graphicitem style="width: 10.8108108108%"> + <div>8</div> + </div> + <div class=graphicitem style="width: 10.8108108108%"> + <div>16</div> + </div> + <div class=graphicitem style="width: 10.8108108108%"> + <div>24</div> + </div> + <div class=graphicitem style="width: 10.8108108108%"> + <div>32</div> + </div> + <div class=graphicitem style="width: 10.8108108108%"> + <div>40</div> + </div> + <div class=graphicitem style="width: 10.8108108108%"> + <div>48</div> + </div> + <div class=graphicitem style="width: 10.8108108108%"> + <div>56</div> + </div> + <div class=graphicitem style="width: 10.8108108108%"> + <div>64</div> + </div> + <div class=graphicitem style="width: 10.8108108108%"> + <div>72</div> + </div> + <div class=graphicitem style="width: 2.7027027027%"> + <div> </div> + <div class=lastlabel>74</div> + </div> + </div> + </div> + <div style="clear: left"></div> + </div> + + <a class=matchresult + href="#hit55-1" + onmouseover='document.getElementById("defline55").innerHTML="AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000"' + onmouseout='document.getElementById("defline55").innerHTML="Mouse-over to show defline and scores, click to show alignments"' + title="AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000"> + <div class="matchrow graphicrow"> + <div class="matchitem graphicitem" + style="background-color: green; width: 100%"></div> + </div> + </a> + + </div> + </div> + </div> + </section> + + + + <section class=descriptions> + <h2>Descriptions</h2> + + <div class=grey><div class=white> + <h4 class=darkHeader>Sequences producing significant alignments:</h4> + + <table class=descriptiontable> + <col/><col/><col/><col/><col/><col/><col/> + <tr> + <th>Description</th> + <th>Max score</th> + <th>Total score</th> + <th>Query cover</th> + <th>E value</th> + <th>Ident</th> + <th>Accession</th> + </tr> + <tr> + <td><div><a href="#hit55-1" + title="AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000" + id="description55-1"> + AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000 + </a></div></td> + <td>89.7</td> + <td>89.7</td> + <td>100%</td> + <td>6.629e-23</td> + <td>86%</td> + <td><a href="http://example.com/example-genebank?id=Subject_7">Subject_7</a></td> + </tr> + </table> + + </div></div> + </section> + + + + <section class=alignments> + <h2>Alignments</h2> + + <div class=grey><div class=white> + <div class=alignment id=hit55-1> + + <div class=linkheader> + <div class=right><a href="#description55-1">Descriptions</a></div> + <a class="linkheader" href="http://example.com/example-genebank?id=Subject_7">Gene Bank</a> + </div> + + <div class=title> + <p class=hittitle>AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000</p> + <p class=titleinfo> + <span class=b>Sequence ID:</span> <a href="http://example.com/example-genebank?id=Subject_7">Subject_7</a> + <span class=b>Length:</span> 4180 + <span class=b>Number of Matches:</span> 1 + </p> + </div> + + + <div class=hotspot id=hotspot55-1-1> + <p class=range> + <span class=range>Range 1: 1516 to 1589</span> + </p> + + <table class=hotspotstable> + <tr> + <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> + </tr> + <tr> + <td>89.7 bits(98)</td> + <td>0.0</td> + <td>64/74(86%)</td> + <td>0/74(0%)</td> + <td>Plus/Plus</td> + </tr> + </table> + + <pre class=alignmentgraphic>Query 1 GAGGAAATGCGTATTCAATTCAACGACATGAACAGCGCCTTGACCACAGCTATCCCATTG 60 + ||||| ||||| || || ||||||||||||||||||||| ||||||| || |||||| | +Subject 1516 GAGGAGATGCGCATCCAGTTCAACGACATGAACAGCGCCCTGACCACCGCCATCCCACTC 1575</pre> + <pre class=alignmentgraphic>Query 61 TTCGCAGTCCAGAA 74 + ||||| |||||||| +Subject 1576 TTCGCCGTCCAGAA 1589</pre> + </div> + + </div> + + </div></div> + </section> + </section> + + <section class=match id=match56> + + <h1>Nucleotide Sequence (74 letters)</h1> + + <section class=header> + + <table class=headerdata> + <tr><td class=param>Query ID:</td><td>Query_1</td></tr> + <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> + <tr><td class=param>Query length:</td><td>20</td></tr> + <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> + <tr><td class=param>Database:</td><td></td></tr> + </table> + + </section> + + + <section class=graphics> + <h2>Graphic Summary</h2> + + <div class=grey> + <h3 class=centered>Distribution of 56 Blast Hits on the Query Sequence</h3> + + <div class=defline id=defline56> + Mouse-over to show defline and scores, click to show alignments + </div> + + <div class=graphic> + <h4 class=darkHeader>Color key for alignment scores</h4> + <div class=legend><div class=graphicrow> + <div class=graphicitem style="background-color: black"><40</div> + <div class=graphicitem style="background-color: blue">40–50</div> + <div class=graphicitem style="background-color: green">50–80</div> + <div class=graphicitem style="background-color: magenta">80–200</div> + <div class=graphicitem style="background-color: red">200≤</div> + </div></div> + <div style="clear: left"></div> + + <div class=tablewrapper> + + <div class=scale> + <div>query:</div> + <div class=graphicrow> + <div> + <div class=graphicitem style="width: 10.8108108108%"> + <div>8</div> + </div> + <div class=graphicitem style="width: 10.8108108108%"> + <div>16</div> + </div> + <div class=graphicitem style="width: 10.8108108108%"> + <div>24</div> + </div> + <div class=graphicitem style="width: 10.8108108108%"> + <div>32</div> + </div> + <div class=graphicitem style="width: 10.8108108108%"> + <div>40</div> + </div> + <div class=graphicitem style="width: 10.8108108108%"> + <div>48</div> + </div> + <div class=graphicitem style="width: 10.8108108108%"> + <div>56</div> + </div> + <div class=graphicitem style="width: 10.8108108108%"> + <div>64</div> + </div> + <div class=graphicitem style="width: 10.8108108108%"> + <div>72</div> + </div> + <div class=graphicitem style="width: 2.7027027027%"> + <div> </div> + <div class=lastlabel>74</div> + </div> + </div> + </div> + <div style="clear: left"></div> + </div> + + <a class=matchresult + href="#hit56-1" + onmouseover='document.getElementById("defline56").innerHTML="EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000"' + onmouseout='document.getElementById("defline56").innerHTML="Mouse-over to show defline and scores, click to show alignments"' + title="EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000"> + <div class="matchrow graphicrow"> + <div class="matchitem graphicitem" + style="background-color: green; width: 100%"></div> + </div> + </a> + + </div> + </div> + </div> + </section> + + + + <section class=descriptions> + <h2>Descriptions</h2> + + <div class=grey><div class=white> + <h4 class=darkHeader>Sequences producing significant alignments:</h4> + + <table class=descriptiontable> + <col/><col/><col/><col/><col/><col/><col/> + <tr> + <th>Description</th> + <th>Max score</th> + <th>Total score</th> + <th>Query cover</th> + <th>E value</th> + <th>Ident</th> + <th>Accession</th> + </tr> + <tr> + <td><div><a href="#hit56-1" + title="EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000" + id="description56-1"> + EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000 + </a></div></td> + <td>89.7</td> + <td>89.7</td> + <td>100%</td> + <td>6.629e-23</td> + <td>86%</td> + <td><a href="http://example.com/example-genebank?id=Subject_8">Subject_8</a></td> + </tr> + </table> + + </div></div> + </section> + + + + <section class=alignments> + <h2>Alignments</h2> + + <div class=grey><div class=white> + <div class=alignment id=hit56-1> + + <div class=linkheader> + <div class=right><a href="#description56-1">Descriptions</a></div> + <a class="linkheader" href="http://example.com/example-genebank?id=Subject_8">Gene Bank</a> + </div> + + <div class=title> + <p class=hittitle>EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000</p> + <p class=titleinfo> + <span class=b>Sequence ID:</span> <a href="http://example.com/example-genebank?id=Subject_8">Subject_8</a> + <span class=b>Length:</span> 4983 + <span class=b>Number of Matches:</span> 1 + </p> + </div> + + + <div class=hotspot id=hotspot56-1-1> + <p class=range> + <span class=range>Range 1: 2319 to 2392</span> + </p> + + <table class=hotspotstable> + <tr> + <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> + </tr> + <tr> + <td>89.7 bits(98)</td> + <td>0.0</td> + <td>64/74(86%)</td> + <td>0/74(0%)</td> + <td>Plus/Plus</td> + </tr> + </table> + + <pre class=alignmentgraphic>Query 1 GAGGAAATGCGTATTCAATTCAACGACATGAACAGCGCCTTGACCACAGCTATCCCATTG 60 + ||||| ||||| || || ||||||||||||||||||||| ||||||| || |||||| | +Subject 2319 GAGGAGATGCGCATCCAGTTCAACGACATGAACAGCGCCCTGACCACCGCCATCCCACTC 2378</pre> + <pre class=alignmentgraphic>Query 61 TTCGCAGTCCAGAA 74 + ||||| |||||||| +Subject 2379 TTCGCCGTCCAGAA 2392</pre> + </div> + + </div> + + </div></div> + </section> + </section> + + </div> + + <footer> + This page was generated by <a href="https://github.com/thehyve/blast2html/">blast2html</a>. + </footer> + </body> +</html> +
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/blast xml example4b.html Mon Jul 07 11:50:50 2014 +0200 @@ -0,0 +1,1585 @@ +<!DOCTYPE html> +<html> + <head> + <meta charset="UTF-8"> + <meta name=generator content="blast2html; see https://github.com/thehyve/blast2html/"> + + <title>Blast output</title> + + <style> + body { + color: #333333; + font-family: Arial,Sans-Serif; + } + + :link { + color: #336699; + } + + .right { + float: right; + } + + /* Galaxy with html sanitization enabled strips the header of this html page. If so, show the user a warning.*/ + #strip_html_warning { + display: none; + } + + #content { + margin: 0 2em; + padding: 0.5em; + border: 1px solid #888888; + background-color: #d3dff5; + } + + h1, h2, h3, h4, h5, h6 { + color: #2A6979; + font-family: arial,verdana,sans-serif; + letter-spacing: -1px; + margin: 1.2em 0 0.3em; + } + + h1 { + border-bottom: 1px solid #CCCCCC; + font-size: 150%; + padding-bottom: 0.1em; + } + + h2 { + font-size: 120%; + font-weight: bold; + } + + h4.darkHeader { + color: #4D4D4D; + letter-spacing: 0; + font-weight: bold; + } + + #nodata { + font-weight: bold; + } + + .index { + margin-bottom: 3em; + } + .index div.indexentry { + margin: 1.2em 1.6em; + font-weight: bold; + font-size: 100%; + } + + .headerdata { + font-size: 90%; + } + .headerdata .param { + font-weight: bold; + text-align: right; + padding: 0 1em; + } + + .grey { + background-color: #eeeeee; + border: 1px solid #cccccc; + padding: 1em; + } + + .white { + background-color: white; + border: 1px solid #cccccc; + padding: 1.5em 2%; + } + + .graphicrow { + clear: left; + width: 100%; + } + + .graphicitem { + float: left; + } + + + + .graphics .grey { + text-align: center; + } + + .graphic { + background-color: white; + border: 2px solid black; + padding: 1.5em; + margin: auto; + } + + .centered, .defline, div.legend, div.tablewrapper { + margin-left: auto; + margin-right: auto; + } + + .defline { + background-color: white; + border: 1px solid black; + margin: .5em auto; + padding-left: .2em; + padding-right: .2em; + max-width: 50em; + text-align: left; + height: 2.8em; + overflow: hidden; + } + + div.legend { + max-width: 40em; + } + div.legend div { + width: 100%; + color: white; + font-weight: bold; + border-spacing: 0; + } + div.legend div .graphicitem { + width: 20%; + padding: 0; + margin: 0; + border: none; + } + + div.tablewrapper { + width: 50%; + min-width: 60em; + } + + /* For small widths we give the graphic 100% */ + @media (max-width: 72.5em) { + div.tablewrapper { + width: 100%; + min-width: 0px; + } + } + + .scale { + width: 100%; + margin: .5em 0; + font-weight: bold; + } + .scale div { + color: red; + text-align: left; + } + .scale .graphicrow { + margin: .5em 0 .5em 0; + color: white; + } + .scale .graphicitem { + position: relative; + } + .scale .graphicitem div { + margin: 0 1px; + padding: 0 2px; + text-align: right; + background-color: red; + color: white; + } + .scale .graphicitem:first-child div { + margin-left: 0px; + } + .scale .graphicitem:last-child div { + margin-right: 0px; + } + .scale .graphicitem .lastlabel { + position: absolute; + top: 0px; + left: 100%; + background-color: transparent; + color: red; + } + + a.matchresult { + display: block; + margin: 0; + padding: 0; + } + div.matchrow { + margin-top: 4px; + } + div.matchrow, div.matchitem { + height: 4px; + } + + + table.descriptiontable { + font-size: 85%; + border: 1px solid #97b0c8; + border-spacing: 0; + color: #222222; + line-height: 1.3em; + background-color: white; + } + table.descriptiontable col:first-child { + width: 100%; + } + table.descriptiontable tr:hover { + background-color: #D5DEE3; + } + table.descriptiontable th { + color: #14376C; + font-weight: normal; + background-color: #F0F0F0; + background: linear-gradient(#FFFFFF, #F0F0F0); + border-bottom: 1px solid #D4DFE9; + border-right: 1px solid #CFCFCF; + border-left: 0px solid black; + border-top: 0px solid black; + } + table.descriptiontable td { + overflow: hidden; + text-align: center; + padding: .4em .8em; + } + table.descriptiontable td div { + width: 1em; + overflow: visible; + white-space: nowrap; + text-align: left; + } + + + + .alignments .white { + padding: 1.5em 1em; + } + + .alignment { + border-top: 1px solid black; + padding-left: 1em; + padding-right: 1em; + } + + div.linkheader { + padding-top: .2em; + font-size: 85%; + color: #14376C; + } + div.linkheader a.linkheader { + margin-right: 1em; + } + div.linkheader .right a { + text-decoration: none; + } + + .title .hittitle { + color: #222222; + margin-bottom: .3em; + } + .title .titleinfo { + font-size: 80%; + margin-top: 0; + margin-bottom: .3em; + } + .title .titleinfo .b { + color: #606060; + font-weight: bold; + font-size: 90%; + } + + .moretitles { + margin: 1.2em; + } + .moretitles .titleinfo { + margin: 0; + padding: 0; + } + .moretitles .hittitle { + margin: .4em 0 .2em 0; + padding: 0; + } + + a.showmoretitles { + font-size: 75%; + color: #336699; + font-weight: bold; + margin-top: 0; + } + a.showmoretitles:hover { + } + + .hotspot { + color: #606060; + font-family: verdana, arial, sans-serif; + margin-bottom: 2.5em; + } + + .hotspot p.range { + font-size: 70%; + margin-top: 0; + margin-top: 1em; + margin-bottom: .2em; + } + .hotspot p.range span.range { + font-weight: bold; + } + .hotspot p.range a.range { + margin-left: .5em; + } + + table.hotspotstable { + border-top: 1px solid; + border-bottom: 1px solid; + text-align: left; + border-collapse: collapse; + } + table.hotspotstable th, table.hotspotstable td { + padding: .1em 1em; + } + table.hotspotstable th { + font-size: 70%; + } + table.hotspotstable td { + min-width: 7em; + color: #222222; + font-size: 80%; + } + + pre.alignmentgraphic { + color: #222222; + } + + footer { + text-align: center; + color: #cccccc; + font-size: 70%; + margin-top: 1em; + } + footer :link { + color: #5588cc; + } + + </style> + + <script type="text/javascript"> + function toggle_visibility(id) { + var e = document.getElementById(id); + if(e.style.display != 'block') + e.style.display = 'block'; + else + e.style.display = 'none'; + } + </script> + + </head> + + + <body> + + <div id="strip_html_warning"> + <!-- This div should be hidden by the header css block. Galaxy + strips all css, breaking this page but making this warning + visible. This warning contains some ugly old skool tabular html + layout that is not stripped. --> + <table bgcolor="#FFE5C9"><tr><td><font color="red"><b> + <font size=5><center>This html page seems to have been stripped by Galaxy.</center></font> + Disable Galaxy's html sanitization feature to view the full page (see <font face=monospace>sanitize_all_html</font> in your galaxy's universe_wsgi.ini), or download this page instead of viewing it in Galaxy. + </b></font></td></tr></table> + </div> + + <div id=content> + + + <section class=index> + <h1>Queries</h1> + + <div class=indexentry><a href="#match1"> + Query_1: Forward_Primer|NOST-Spec_(Genetic_ID) + (20 letters, 2 hits) + </a></div> + <div class=indexentry><a href="#match2"> + Query_2: Reverse_Primer|NOST-Spec_(Genetic_ID) + (20 letters, 0 hits) + </a></div> + <div class=indexentry><a href="#match3"> + Query_3: Probe|NOST-Spec_(Genetic_ID) + (20 letters, 3 hits) + </a></div> + <div class=indexentry><a href="#match4"> + Query_4: Forward_Primer|QL-ELE-Bt-F1(mod)/Bt-R + (24 letters, 0 hits) + </a></div> + <div class=indexentry><a href="#match5"> + Query_5: Reverse_Primer|QL-ELE-Bt-F1(mod)/Bt-R + (20 letters, 0 hits) + </a></div> + <div class=indexentry><a href="#match6"> + Query_6: Probe|QL-ELE-Bt-F1(mod)/Bt-R + (25 letters, 2 hits) + </a></div> + <div class=indexentry><a href="#match7"> + Query_7: Amplicon|QL-ELE-Bt-F1(mod)/Bt-R + (74 letters, 2 hits) + </a></div> + + </section> + + + <section class=match id=match1> + + <h1>Nucleotide Sequence (20 letters)</h1> + + <section class=header> + + <table class=headerdata> + <tr><td class=param>Query ID:</td><td>Query_1</td></tr> + <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> + <tr><td class=param>Query length:</td><td>20</td></tr> + <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> + <tr><td class=param>Database:</td><td>/opt/galaxy/blastdbs/EUginius_plasmid_insert</td></tr> + </table> + + </section> + + + <section class=graphics> + <h2>Graphic Summary</h2> + + <div class=grey> + <h3 class=centered>Distribution of 7 Blast Hits on the Query Sequence</h3> + + <div class=defline id=defline1> + Mouse-over to show defline and scores, click to show alignments + </div> + + <div class=graphic> + <h4 class=darkHeader>Color key for alignment scores</h4> + <div class=legend><div class=graphicrow> + <div class=graphicitem style="background-color: black"><40</div> + <div class=graphicitem style="background-color: blue">40–50</div> + <div class=graphicitem style="background-color: green">50–80</div> + <div class=graphicitem style="background-color: magenta">80–200</div> + <div class=graphicitem style="background-color: red">200≤</div> + </div></div> + <div style="clear: left"></div> + + <div class=tablewrapper> + + <div class=scale> + <div>query:</div> + <div class=graphicrow> + <div> + <div class=graphicitem style="width: 10%"> + <div>2</div> + </div> + <div class=graphicitem style="width: 10%"> + <div>4</div> + </div> + <div class=graphicitem style="width: 10%"> + <div>6</div> + </div> + <div class=graphicitem style="width: 10%"> + <div>8</div> + </div> + <div class=graphicitem style="width: 10%"> + <div>10</div> + </div> + <div class=graphicitem style="width: 10%"> + <div>12</div> + </div> + <div class=graphicitem style="width: 10%"> + <div>14</div> + </div> + <div class=graphicitem style="width: 10%"> + <div>16</div> + </div> + <div class=graphicitem style="width: 10%"> + <div>18</div> + </div> + <div class=graphicitem style="width: 10%"> + <div>20</div> + </div> + </div> + </div> + <div style="clear: left"></div> + </div> + + <a class=matchresult + href="#hit1-1" + onmouseover='document.getElementById("defline1").innerHTML="AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000"' + onmouseout='document.getElementById("defline1").innerHTML="Mouse-over to show defline and scores, click to show alignments"' + title="AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000"> + <div class="matchrow graphicrow"> + <div class="matchitem graphicitem" + style="background-color: black; width: 100%"></div> + </div> + </a> + + <a class=matchresult + href="#hit1-2" + onmouseover='document.getElementById("defline1").innerHTML="DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000"' + onmouseout='document.getElementById("defline1").innerHTML="Mouse-over to show defline and scores, click to show alignments"' + title="DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000"> + <div class="matchrow graphicrow"> + <div class="matchitem graphicitem" + style="background-color: black; width: 100%"></div> + </div> + </a> + + </div> + </div> + </div> + </section> + + + + <section class=descriptions> + <h2>Descriptions</h2> + + <div class=grey><div class=white> + <h4 class=darkHeader>Sequences producing significant alignments:</h4> + + <table class=descriptiontable> + <col/><col/><col/><col/><col/><col/><col/> + <tr> + <th>Description</th> + <th>Max score</th> + <th>Total score</th> + <th>Query cover</th> + <th>E value</th> + <th>Ident</th> + <th>Accession</th> + </tr> + <tr> + <td><div><a href="#hit1-1" + title="AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000" + id="description1-1"> + AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000 + </a></div></td> + <td>40.1</td> + <td>40.1</td> + <td>100%</td> + <td>1.513e-07</td> + <td>100%</td> + <td><a href="http://example.com/example-genebank/AB209952.1/">5</a></td> + </tr> + <tr> + <td><div><a href="#hit1-2" + title="DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000" + id="description1-2"> + DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000 + </a></div></td> + <td>40.1</td> + <td>40.1</td> + <td>100%</td> + <td>1.513e-07</td> + <td>100%</td> + <td><a href="http://example.com/example-genebank/DJ437711/">2</a></td> + </tr> + </table> + + </div></div> + </section> + + + + <section class=alignments> + <h2>Alignments</h2> + + <div class=grey><div class=white> + <div class=alignment id=hit1-1> + + <div class=linkheader> + <div class=right><a href="#description1-1">Descriptions</a></div> + <a class="linkheader" href="http://example.com/example-genebank/AB209952.1/">Gene Bank</a> + </div> + + <div class=title> + <p class=hittitle>AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000</p> + <p class=titleinfo> + <span class=b>Sequence ID:</span> <a href="http://example.com/example-genebank/AB209952.1/">gnl|BL_ORD_ID|5</a> + <span class=b>Length:</span> 2457 + <span class=b>Number of Matches:</span> 1 + </p> + </div> + + + <div class=hotspot id=hotspot1-1-1> + <p class=range> + <span class=range>Range 1: 2119 to 2138</span> + </p> + + <table class=hotspotstable> + <tr> + <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> + </tr> + <tr> + <td>40.1 bits(20)</td> + <td>0.0</td> + <td>20/20(100%)</td> + <td>0/20(0%)</td> + <td>Plus/Plus</td> + </tr> + </table> + + <pre class=alignmentgraphic>Query 1 AGCGCGCAAACTAGGATAAA 20 + |||||||||||||||||||| +Subject 2119 AGCGCGCAAACTAGGATAAA 2138</pre> + </div> + + </div> + + <div class=alignment id=hit1-2> + + <div class=linkheader> + <div class=right><a href="#description1-2">Descriptions</a></div> + <a class="linkheader" href="http://example.com/example-genebank/DJ437711/">Gene Bank</a> + </div> + + <div class=title> + <p class=hittitle>DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000</p> + <p class=titleinfo> + <span class=b>Sequence ID:</span> <a href="http://example.com/example-genebank/DJ437711/">gnl|BL_ORD_ID|2</a> + <span class=b>Length:</span> 323 + <span class=b>Number of Matches:</span> 1 + </p> + </div> + + + <div class=hotspot id=hotspot1-2-1> + <p class=range> + <span class=range>Range 1: 200 to 219</span> + </p> + + <table class=hotspotstable> + <tr> + <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> + </tr> + <tr> + <td>40.1 bits(20)</td> + <td>0.0</td> + <td>20/20(100%)</td> + <td>0/20(0%)</td> + <td>Plus/Plus</td> + </tr> + </table> + + <pre class=alignmentgraphic>Query 1 AGCGCGCAAACTAGGATAAA 20 + |||||||||||||||||||| +Subject 200 AGCGCGCAAACTAGGATAAA 219</pre> + </div> + + </div> + + </div></div> + </section> + </section> + + <section class=match id=match2> + + <h1>Nucleotide Sequence (20 letters)</h1> + + <section class=header> + + <table class=headerdata> + <tr><td class=param>Query ID:</td><td>Query_1</td></tr> + <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> + <tr><td class=param>Query length:</td><td>20</td></tr> + <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> + <tr><td class=param>Database:</td><td>/opt/galaxy/blastdbs/EUginius_plasmid_insert</td></tr> + </table> + + </section> + + <section> + <h2>No Hits</h2> + <div class=grey> + <table class=headerdata> + <tr><td class=param>Message:</td><td>No hits found</td></tr> + </table> + </div> + </section> + </section> + + <section class=match id=match3> + + <h1>Nucleotide Sequence (20 letters)</h1> + + <section class=header> + + <table class=headerdata> + <tr><td class=param>Query ID:</td><td>Query_1</td></tr> + <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> + <tr><td class=param>Query length:</td><td>20</td></tr> + <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> + <tr><td class=param>Database:</td><td>/opt/galaxy/blastdbs/EUginius_plasmid_insert</td></tr> + </table> + + </section> + + + <section class=graphics> + <h2>Graphic Summary</h2> + + <div class=grey> + <h3 class=centered>Distribution of 7 Blast Hits on the Query Sequence</h3> + + <div class=defline id=defline3> + Mouse-over to show defline and scores, click to show alignments + </div> + + <div class=graphic> + <h4 class=darkHeader>Color key for alignment scores</h4> + <div class=legend><div class=graphicrow> + <div class=graphicitem style="background-color: black"><40</div> + <div class=graphicitem style="background-color: blue">40–50</div> + <div class=graphicitem style="background-color: green">50–80</div> + <div class=graphicitem style="background-color: magenta">80–200</div> + <div class=graphicitem style="background-color: red">200≤</div> + </div></div> + <div style="clear: left"></div> + + <div class=tablewrapper> + + <div class=scale> + <div>query:</div> + <div class=graphicrow> + <div> + <div class=graphicitem style="width: 10%"> + <div>2</div> + </div> + <div class=graphicitem style="width: 10%"> + <div>4</div> + </div> + <div class=graphicitem style="width: 10%"> + <div>6</div> + </div> + <div class=graphicitem style="width: 10%"> + <div>8</div> + </div> + <div class=graphicitem style="width: 10%"> + <div>10</div> + </div> + <div class=graphicitem style="width: 10%"> + <div>12</div> + </div> + <div class=graphicitem style="width: 10%"> + <div>14</div> + </div> + <div class=graphicitem style="width: 10%"> + <div>16</div> + </div> + <div class=graphicitem style="width: 10%"> + <div>18</div> + </div> + <div class=graphicitem style="width: 10%"> + <div>20</div> + </div> + </div> + </div> + <div style="clear: left"></div> + </div> + + <a class=matchresult + href="#hit3-1" + onmouseover='document.getElementById("defline3").innerHTML="AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000"' + onmouseout='document.getElementById("defline3").innerHTML="Mouse-over to show defline and scores, click to show alignments"' + title="AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000"> + <div class="matchrow graphicrow"> + <div class="matchitem graphicitem" + style="background-color: black; width: 100%"></div> + </div> + </a> + + <a class=matchresult + href="#hit3-2" + onmouseover='document.getElementById("defline3").innerHTML="DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000"' + onmouseout='document.getElementById("defline3").innerHTML="Mouse-over to show defline and scores, click to show alignments"' + title="DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000"> + <div class="matchrow graphicrow"> + <div class="matchitem graphicitem" + style="background-color: black; width: 100%"></div> + </div> + </a> + + <a class=matchresult + href="#hit3-3" + onmouseover='document.getElementById("defline3").innerHTML="AJ308515.1|GenBank|insert_GTS-40-3-2|Synthetic_construct_for_NOS_3\u0027UTR/plant_junction_region.|-9105899556052450000"' + onmouseout='document.getElementById("defline3").innerHTML="Mouse-over to show defline and scores, click to show alignments"' + title="AJ308515.1|GenBank|insert_GTS-40-3-2|Synthetic_construct_for_NOS_3'UTR/plant_junction_region.|-9105899556052450000"> + <div class="matchrow graphicrow"> + <div class="matchitem graphicitem" + style="background-color: transparent; width: 15%"></div> + <div class="matchitem graphicitem" + style="background-color: black; width: 85%"></div> + </div> + </a> + + </div> + </div> + </div> + </section> + + + + <section class=descriptions> + <h2>Descriptions</h2> + + <div class=grey><div class=white> + <h4 class=darkHeader>Sequences producing significant alignments:</h4> + + <table class=descriptiontable> + <col/><col/><col/><col/><col/><col/><col/> + <tr> + <th>Description</th> + <th>Max score</th> + <th>Total score</th> + <th>Query cover</th> + <th>E value</th> + <th>Ident</th> + <th>Accession</th> + </tr> + <tr> + <td><div><a href="#hit3-1" + title="AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000" + id="description3-1"> + AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000 + </a></div></td> + <td>40.1</td> + <td>40.1</td> + <td>100%</td> + <td>1.513e-07</td> + <td>100%</td> + <td><a href="http://example.com/example-genebank/AB209952.1/">5</a></td> + </tr> + <tr> + <td><div><a href="#hit3-2" + title="DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000" + id="description3-2"> + DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000 + </a></div></td> + <td>40.1</td> + <td>40.1</td> + <td>100%</td> + <td>1.513e-07</td> + <td>100%</td> + <td><a href="http://example.com/example-genebank/DJ437711/">2</a></td> + </tr> + <tr> + <td><div><a href="#hit3-3" + title="AJ308515.1|GenBank|insert_GTS-40-3-2|Synthetic_construct_for_NOS_3'UTR/plant_junction_region.|-9105899556052450000" + id="description3-3"> + AJ308515.1|GenBank|insert_GTS-40-3-2|Synthetic_construct_for_NOS_3'UTR/plant_junction_region.|-9105899556052450000 + </a></div></td> + <td>34.2</td> + <td>34.2</td> + <td>85%</td> + <td>9.334e-06</td> + <td>100%</td> + <td><a href="http://example.com/example-genebank/AJ308515.1/">1</a></td> + </tr> + </table> + + </div></div> + </section> + + + + <section class=alignments> + <h2>Alignments</h2> + + <div class=grey><div class=white> + <div class=alignment id=hit3-1> + + <div class=linkheader> + <div class=right><a href="#description3-1">Descriptions</a></div> + <a class="linkheader" href="http://example.com/example-genebank/AB209952.1/">Gene Bank</a> + </div> + + <div class=title> + <p class=hittitle>AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000</p> + <p class=titleinfo> + <span class=b>Sequence ID:</span> <a href="http://example.com/example-genebank/AB209952.1/">gnl|BL_ORD_ID|5</a> + <span class=b>Length:</span> 2457 + <span class=b>Number of Matches:</span> 1 + </p> + </div> + + + <div class=hotspot id=hotspot3-1-1> + <p class=range> + <span class=range>Range 1: 2143 to 2162</span> + </p> + + <table class=hotspotstable> + <tr> + <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> + </tr> + <tr> + <td>40.1 bits(20)</td> + <td>0.0</td> + <td>20/20(100%)</td> + <td>0/20(0%)</td> + <td>Plus/Plus</td> + </tr> + </table> + + <pre class=alignmentgraphic>Query 1 CGCGCGCGGTGTCATCTATG 20 + |||||||||||||||||||| +Subject 2143 CGCGCGCGGTGTCATCTATG 2162</pre> + </div> + + </div> + + <div class=alignment id=hit3-2> + + <div class=linkheader> + <div class=right><a href="#description3-2">Descriptions</a></div> + <a class="linkheader" href="http://example.com/example-genebank/DJ437711/">Gene Bank</a> + </div> + + <div class=title> + <p class=hittitle>DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000</p> + <p class=titleinfo> + <span class=b>Sequence ID:</span> <a href="http://example.com/example-genebank/DJ437711/">gnl|BL_ORD_ID|2</a> + <span class=b>Length:</span> 323 + <span class=b>Number of Matches:</span> 1 + </p> + </div> + + + <div class=hotspot id=hotspot3-2-1> + <p class=range> + <span class=range>Range 1: 224 to 243</span> + </p> + + <table class=hotspotstable> + <tr> + <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> + </tr> + <tr> + <td>40.1 bits(20)</td> + <td>0.0</td> + <td>20/20(100%)</td> + <td>0/20(0%)</td> + <td>Plus/Plus</td> + </tr> + </table> + + <pre class=alignmentgraphic>Query 1 CGCGCGCGGTGTCATCTATG 20 + |||||||||||||||||||| +Subject 224 CGCGCGCGGTGTCATCTATG 243</pre> + </div> + + </div> + + <div class=alignment id=hit3-3> + + <div class=linkheader> + <div class=right><a href="#description3-3">Descriptions</a></div> + <a class="linkheader" href="http://example.com/example-genebank/AJ308515.1/">Gene Bank</a> + </div> + + <div class=title> + <p class=hittitle>AJ308515.1|GenBank|insert_GTS-40-3-2|Synthetic_construct_for_NOS_3'UTR/plant_junction_region.|-9105899556052450000</p> + <p class=titleinfo> + <span class=b>Sequence ID:</span> <a href="http://example.com/example-genebank/AJ308515.1/">gnl|BL_ORD_ID|1</a> + <span class=b>Length:</span> 1045 + <span class=b>Number of Matches:</span> 1 + </p> + </div> + + + <div class=hotspot id=hotspot3-3-1> + <p class=range> + <span class=range>Range 1: 2 to 18</span> + </p> + + <table class=hotspotstable> + <tr> + <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> + </tr> + <tr> + <td>34.2 bits(17)</td> + <td>0.0</td> + <td>17/17(100%)</td> + <td>0/17(0%)</td> + <td>Plus/Plus</td> + </tr> + </table> + + <pre class=alignmentgraphic>Query 4 GCGCGGTGTCATCTATG 20 + ||||||||||||||||| +Subject 2 GCGCGGTGTCATCTATG 18</pre> + </div> + + </div> + + </div></div> + </section> + </section> + + <section class=match id=match4> + + <h1>Nucleotide Sequence (24 letters)</h1> + + <section class=header> + + <table class=headerdata> + <tr><td class=param>Query ID:</td><td>Query_1</td></tr> + <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> + <tr><td class=param>Query length:</td><td>20</td></tr> + <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> + <tr><td class=param>Database:</td><td>/opt/galaxy/blastdbs/EUginius_plasmid_insert</td></tr> + </table> + + </section> + + <section> + <h2>No Hits</h2> + <div class=grey> + <table class=headerdata> + <tr><td class=param>Message:</td><td>No hits found</td></tr> + </table> + </div> + </section> + </section> + + <section class=match id=match5> + + <h1>Nucleotide Sequence (20 letters)</h1> + + <section class=header> + + <table class=headerdata> + <tr><td class=param>Query ID:</td><td>Query_1</td></tr> + <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> + <tr><td class=param>Query length:</td><td>20</td></tr> + <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> + <tr><td class=param>Database:</td><td>/opt/galaxy/blastdbs/EUginius_plasmid_insert</td></tr> + </table> + + </section> + + <section> + <h2>No Hits</h2> + <div class=grey> + <table class=headerdata> + <tr><td class=param>Message:</td><td>No hits found</td></tr> + </table> + </div> + </section> + </section> + + <section class=match id=match6> + + <h1>Nucleotide Sequence (25 letters)</h1> + + <section class=header> + + <table class=headerdata> + <tr><td class=param>Query ID:</td><td>Query_1</td></tr> + <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> + <tr><td class=param>Query length:</td><td>20</td></tr> + <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> + <tr><td class=param>Database:</td><td>/opt/galaxy/blastdbs/EUginius_plasmid_insert</td></tr> + </table> + + </section> + + + <section class=graphics> + <h2>Graphic Summary</h2> + + <div class=grey> + <h3 class=centered>Distribution of 7 Blast Hits on the Query Sequence</h3> + + <div class=defline id=defline6> + Mouse-over to show defline and scores, click to show alignments + </div> + + <div class=graphic> + <h4 class=darkHeader>Color key for alignment scores</h4> + <div class=legend><div class=graphicrow> + <div class=graphicitem style="background-color: black"><40</div> + <div class=graphicitem style="background-color: blue">40–50</div> + <div class=graphicitem style="background-color: green">50–80</div> + <div class=graphicitem style="background-color: magenta">80–200</div> + <div class=graphicitem style="background-color: red">200≤</div> + </div></div> + <div style="clear: left"></div> + + <div class=tablewrapper> + + <div class=scale> + <div>query:</div> + <div class=graphicrow> + <div> + <div class=graphicitem style="width: 12%"> + <div>3</div> + </div> + <div class=graphicitem style="width: 12%"> + <div>6</div> + </div> + <div class=graphicitem style="width: 12%"> + <div>9</div> + </div> + <div class=graphicitem style="width: 12%"> + <div>12</div> + </div> + <div class=graphicitem style="width: 12%"> + <div>15</div> + </div> + <div class=graphicitem style="width: 12%"> + <div>18</div> + </div> + <div class=graphicitem style="width: 12%"> + <div>21</div> + </div> + <div class=graphicitem style="width: 12%"> + <div>24</div> + </div> + <div class=graphicitem style="width: 4%"> + <div>25</div> + </div> + </div> + </div> + <div style="clear: left"></div> + </div> + + <a class=matchresult + href="#hit6-1" + onmouseover='document.getElementById("defline6").innerHTML="EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000"' + onmouseout='document.getElementById("defline6").innerHTML="Mouse-over to show defline and scores, click to show alignments"' + title="EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000"> + <div class="matchrow graphicrow"> + <div class="matchitem graphicitem" + style="background-color: black; width: 88%"></div> + <div class="matchitem graphicitem" + style="background-color: transparent; width: 12%"></div> + </div> + </a> + + <a class=matchresult + href="#hit6-2" + onmouseover='document.getElementById("defline6").innerHTML="AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000"' + onmouseout='document.getElementById("defline6").innerHTML="Mouse-over to show defline and scores, click to show alignments"' + title="AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000"> + <div class="matchrow graphicrow"> + <div class="matchitem graphicitem" + style="background-color: black; width: 88%"></div> + <div class="matchitem graphicitem" + style="background-color: transparent; width: 12%"></div> + </div> + </a> + + </div> + </div> + </div> + </section> + + + + <section class=descriptions> + <h2>Descriptions</h2> + + <div class=grey><div class=white> + <h4 class=darkHeader>Sequences producing significant alignments:</h4> + + <table class=descriptiontable> + <col/><col/><col/><col/><col/><col/><col/> + <tr> + <th>Description</th> + <th>Max score</th> + <th>Total score</th> + <th>Query cover</th> + <th>E value</th> + <th>Ident</th> + <th>Accession</th> + </tr> + <tr> + <td><div><a href="#hit6-1" + title="EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000" + id="description6-1"> + EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000 + </a></div></td> + <td>36.2</td> + <td>36.2</td> + <td>88%</td> + <td>3.148e-06</td> + <td>95%</td> + <td><a href="http://example.com/example-genebank/EUG/">7</a></td> + </tr> + <tr> + <td><div><a href="#hit6-2" + title="AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000" + id="description6-2"> + AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000 + </a></div></td> + <td>36.2</td> + <td>36.2</td> + <td>88%</td> + <td>3.148e-06</td> + <td>95%</td> + <td><a href="http://example.com/example-genebank/AY326434/">6</a></td> + </tr> + </table> + + </div></div> + </section> + + + + <section class=alignments> + <h2>Alignments</h2> + + <div class=grey><div class=white> + <div class=alignment id=hit6-1> + + <div class=linkheader> + <div class=right><a href="#description6-1">Descriptions</a></div> + <a class="linkheader" href="http://example.com/example-genebank/EUG/">Gene Bank</a> + </div> + + <div class=title> + <p class=hittitle>EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000</p> + <p class=titleinfo> + <span class=b>Sequence ID:</span> <a href="http://example.com/example-genebank/EUG/">gnl|BL_ORD_ID|7</a> + <span class=b>Length:</span> 4983 + <span class=b>Number of Matches:</span> 1 + </p> + </div> + + + <div class=hotspot id=hotspot6-1-1> + <p class=range> + <span class=range>Range 1: 2344 to 2365</span> + </p> + + <table class=hotspotstable> + <tr> + <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> + </tr> + <tr> + <td>36.2 bits(18)</td> + <td>0.0</td> + <td>21/22(95%)</td> + <td>0/22(0%)</td> + <td>Plus/Plus</td> + </tr> + </table> + + <pre class=alignmentgraphic>Query 1 ACATGAACAGCGCCTTGACCAC 22 + |||||||||||||| ||||||| +Subject 2344 ACATGAACAGCGCCCTGACCAC 2365</pre> + </div> + + </div> + + <div class=alignment id=hit6-2> + + <div class=linkheader> + <div class=right><a href="#description6-2">Descriptions</a></div> + <a class="linkheader" href="http://example.com/example-genebank/AY326434/">Gene Bank</a> + </div> + + <div class=title> + <p class=hittitle>AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000</p> + <p class=titleinfo> + <span class=b>Sequence ID:</span> <a href="http://example.com/example-genebank/AY326434/">gnl|BL_ORD_ID|6</a> + <span class=b>Length:</span> 4180 + <span class=b>Number of Matches:</span> 1 + </p> + </div> + + + <div class=hotspot id=hotspot6-2-1> + <p class=range> + <span class=range>Range 1: 1541 to 1562</span> + </p> + + <table class=hotspotstable> + <tr> + <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> + </tr> + <tr> + <td>36.2 bits(18)</td> + <td>0.0</td> + <td>21/22(95%)</td> + <td>0/22(0%)</td> + <td>Plus/Plus</td> + </tr> + </table> + + <pre class=alignmentgraphic>Query 1 ACATGAACAGCGCCTTGACCAC 22 + |||||||||||||| ||||||| +Subject 1541 ACATGAACAGCGCCCTGACCAC 1562</pre> + </div> + + </div> + + </div></div> + </section> + </section> + + <section class=match id=match7> + + <h1>Nucleotide Sequence (74 letters)</h1> + + <section class=header> + + <table class=headerdata> + <tr><td class=param>Query ID:</td><td>Query_1</td></tr> + <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> + <tr><td class=param>Query length:</td><td>20</td></tr> + <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> + <tr><td class=param>Database:</td><td>/opt/galaxy/blastdbs/EUginius_plasmid_insert</td></tr> + </table> + + </section> + + + <section class=graphics> + <h2>Graphic Summary</h2> + + <div class=grey> + <h3 class=centered>Distribution of 7 Blast Hits on the Query Sequence</h3> + + <div class=defline id=defline7> + Mouse-over to show defline and scores, click to show alignments + </div> + + <div class=graphic> + <h4 class=darkHeader>Color key for alignment scores</h4> + <div class=legend><div class=graphicrow> + <div class=graphicitem style="background-color: black"><40</div> + <div class=graphicitem style="background-color: blue">40–50</div> + <div class=graphicitem style="background-color: green">50–80</div> + <div class=graphicitem style="background-color: magenta">80–200</div> + <div class=graphicitem style="background-color: red">200≤</div> + </div></div> + <div style="clear: left"></div> + + <div class=tablewrapper> + + <div class=scale> + <div>query:</div> + <div class=graphicrow> + <div> + <div class=graphicitem style="width: 10.8108108108%"> + <div>8</div> + </div> + <div class=graphicitem style="width: 10.8108108108%"> + <div>16</div> + </div> + <div class=graphicitem style="width: 10.8108108108%"> + <div>24</div> + </div> + <div class=graphicitem style="width: 10.8108108108%"> + <div>32</div> + </div> + <div class=graphicitem style="width: 10.8108108108%"> + <div>40</div> + </div> + <div class=graphicitem style="width: 10.8108108108%"> + <div>48</div> + </div> + <div class=graphicitem style="width: 10.8108108108%"> + <div>56</div> + </div> + <div class=graphicitem style="width: 10.8108108108%"> + <div>64</div> + </div> + <div class=graphicitem style="width: 10.8108108108%"> + <div>72</div> + </div> + <div class=graphicitem style="width: 2.7027027027%"> + <div> </div> + <div class=lastlabel>74</div> + </div> + </div> + </div> + <div style="clear: left"></div> + </div> + + <a class=matchresult + href="#hit7-1" + onmouseover='document.getElementById("defline7").innerHTML="EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000"' + onmouseout='document.getElementById("defline7").innerHTML="Mouse-over to show defline and scores, click to show alignments"' + title="EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000"> + <div class="matchrow graphicrow"> + <div class="matchitem graphicitem" + style="background-color: green; width: 100%"></div> + </div> + </a> + + <a class=matchresult + href="#hit7-2" + onmouseover='document.getElementById("defline7").innerHTML="AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000"' + onmouseout='document.getElementById("defline7").innerHTML="Mouse-over to show defline and scores, click to show alignments"' + title="AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000"> + <div class="matchrow graphicrow"> + <div class="matchitem graphicitem" + style="background-color: green; width: 100%"></div> + </div> + </a> + + </div> + </div> + </div> + </section> + + + + <section class=descriptions> + <h2>Descriptions</h2> + + <div class=grey><div class=white> + <h4 class=darkHeader>Sequences producing significant alignments:</h4> + + <table class=descriptiontable> + <col/><col/><col/><col/><col/><col/><col/> + <tr> + <th>Description</th> + <th>Max score</th> + <th>Total score</th> + <th>Query cover</th> + <th>E value</th> + <th>Ident</th> + <th>Accession</th> + </tr> + <tr> + <td><div><a href="#hit7-1" + title="EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000" + id="description7-1"> + EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000 + </a></div></td> + <td>67.9</td> + <td>67.9</td> + <td>100%</td> + <td>3.564e-15</td> + <td>86%</td> + <td><a href="http://example.com/example-genebank/EUG/">7</a></td> + </tr> + <tr> + <td><div><a href="#hit7-2" + title="AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000" + id="description7-2"> + AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000 + </a></div></td> + <td>67.9</td> + <td>67.9</td> + <td>100%</td> + <td>3.564e-15</td> + <td>86%</td> + <td><a href="http://example.com/example-genebank/AY326434/">6</a></td> + </tr> + </table> + + </div></div> + </section> + + + + <section class=alignments> + <h2>Alignments</h2> + + <div class=grey><div class=white> + <div class=alignment id=hit7-1> + + <div class=linkheader> + <div class=right><a href="#description7-1">Descriptions</a></div> + <a class="linkheader" href="http://example.com/example-genebank/EUG/">Gene Bank</a> + </div> + + <div class=title> + <p class=hittitle>EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000</p> + <p class=titleinfo> + <span class=b>Sequence ID:</span> <a href="http://example.com/example-genebank/EUG/">gnl|BL_ORD_ID|7</a> + <span class=b>Length:</span> 4983 + <span class=b>Number of Matches:</span> 1 + </p> + </div> + + + <div class=hotspot id=hotspot7-1-1> + <p class=range> + <span class=range>Range 1: 2319 to 2392</span> + </p> + + <table class=hotspotstable> + <tr> + <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> + </tr> + <tr> + <td>67.9 bits(34)</td> + <td>0.0</td> + <td>64/74(86%)</td> + <td>0/74(0%)</td> + <td>Plus/Plus</td> + </tr> + </table> + + <pre class=alignmentgraphic>Query 1 GAGGAAATGCGTATTCAATTCAACGACATGAACAGCGCCTTGACCACAGCTATCCCATTG 60 + ||||| ||||| || || ||||||||||||||||||||| ||||||| || |||||| | +Subject 2319 GAGGAGATGCGCATCCAGTTCAACGACATGAACAGCGCCCTGACCACCGCCATCCCACTC 2378</pre> + <pre class=alignmentgraphic>Query 61 TTCGCAGTCCAGAA 74 + ||||| |||||||| +Subject 2379 TTCGCCGTCCAGAA 2392</pre> + </div> + + </div> + + <div class=alignment id=hit7-2> + + <div class=linkheader> + <div class=right><a href="#description7-2">Descriptions</a></div> + <a class="linkheader" href="http://example.com/example-genebank/AY326434/">Gene Bank</a> + </div> + + <div class=title> + <p class=hittitle>AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000</p> + <p class=titleinfo> + <span class=b>Sequence ID:</span> <a href="http://example.com/example-genebank/AY326434/">gnl|BL_ORD_ID|6</a> + <span class=b>Length:</span> 4180 + <span class=b>Number of Matches:</span> 1 + </p> + </div> + + + <div class=hotspot id=hotspot7-2-1> + <p class=range> + <span class=range>Range 1: 1589 to 1516</span> + </p> + + <table class=hotspotstable> + <tr> + <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> + </tr> + <tr> + <td>67.9 bits(34)</td> + <td>0.0</td> + <td>64/74(86%)</td> + <td>0/74(0%)</td> + <td>Plus/Minus</td> + </tr> + </table> + + <pre class=alignmentgraphic>Query 1 GAGGAAATGCGTATTCAATTCAACGACATGAACAGCGCCTTGACCACAGCTATCCCATTG 60 + ||||| ||||| || || ||||||||||||||||||||| ||||||| || |||||| | +Subject 1589 GAGGAGATGCGCATCCAGTTCAACGACATGAACAGCGCCCTGACCACCGCCATCCCACTC 1530</pre> + <pre class=alignmentgraphic>Query 61 TTCGCAGTCCAGAA 74 + ||||| |||||||| +Subject 1529 TTCGCCGTCCAGAA 1516</pre> + </div> + + </div> + + </div></div> + </section> + </section> + + </div> + + <footer> + This page was generated by <a href="https://github.com/thehyve/blast2html/">blast2html</a>. + </footer> + </body> +</html> +