Mercurial > repos > jjohnson > regex_find_replace
changeset 0:9ea374bb0350 draft default tip
Uploaded
| author | jjohnson |
|---|---|
| date | Sat, 29 Mar 2014 13:41:51 -0400 (2014-03-29) |
| parents | |
| children | |
| files | regex.py regex.xml regex_tabular.xml test-data/find1.txt test-data/find_tabular_1.txt test-data/replace1.txt test-data/replace2.txt test-data/replace_tabular_1.txt |
| diffstat | 8 files changed, 280 insertions(+), 0 deletions(-) [+] |
line wrap: on
line diff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/regex.py Sat Mar 29 13:41:51 2014 -0400 @@ -0,0 +1,48 @@ +import sys +import os +import re +import string +import commands +from optparse import OptionParser +from tempfile import NamedTemporaryFile + +def main(): + parser = OptionParser() + parser.add_option("--input", dest="input") + parser.add_option("--output", dest="output") + parser.add_option("--pattern", dest="patterns", action="append", + help="regex pattern for replacement") + parser.add_option("--replacement", dest="replacements", action="append", + help="replacement for regex match") + parser.add_option("--column", dest="column", default=None) + (options, args) = parser.parse_args() + + mapped_chars = { '\'' :'__sq__', '\\' : '__backslash__' } + + column = None + if options.column is not None: + column = int(options.column) - 1 # galaxy tabular is 1-based, python array are zero-based + + with open(options.input, 'r') as input: + with open(options.output, 'w') as output: + while True: + line = input.readline() + if line == "": + break + for (pattern, replacement) in zip(options.patterns, options.replacements): + for key, value in mapped_chars.items(): + pattern = pattern.replace(value, key) + replacement = replacement.replace(value, key) + if column is None: + line = re.sub(pattern, replacement, line) + else: + cells = line.split("\t") + if cells and len(cells) > column: + cell = cells[column] + cell = re.sub(pattern, replacement, cell) + cells[column] = cell + line = "\t".join(cells) + output.write(line) + +if __name__ == "__main__": + main()
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/regex.xml Sat Mar 29 13:41:51 2014 -0400 @@ -0,0 +1,107 @@ +<tool id="regex1" name="Regex Find And Replace" version="0.1.0"> + <description></description> + <command interpreter="python">regex.py --input $input --output $out_file1 + #for $check in $checks: + --pattern='$check.pattern' --replacement='$check.replacement' + #end for + </command> + <inputs> + <param format="txt" name="input" type="data" label="Select lines from"/> + <repeat name="checks" title="Check"> + <param name="pattern" size="40" type="text" value="chr([0-9A-Za-z])+" label="Find Regex" help="here you can enter text or regular expression (for syntax check lower part of this frame)"> + <sanitizer> + <valid> + <add preset="string.printable"/> + <remove value="\" /> + <remove value="'" /> + </valid> + <mapping initial="none"> + <add source="\" target="__backslash__" /> + <add source="'" target="__sq__"/> + </mapping> + </sanitizer> + </param> + <param name="replacement" size="40" type="text" value="newchr\1" label="Replacement"> + <sanitizer> + <valid> + <add preset="string.printable"/> + <remove value="\" /> + <remove value="'" /> + </valid> + <mapping initial="none"> + <add source="\" target="__backslash__" /> + <add source="'" target="__sq__"/> + </mapping> + </sanitizer> + </param> + </repeat> + </inputs> + <outputs> + <data format="input" name="out_file1" metadata_source="input"/> + </outputs> + <tests> + <test> + <param name="input" value="find1.txt"/> + <param name="pattern" value="(T\w+)"/> + <param name="replacement" value="\1 \1" /> + <output name="out_file1" file="replace1.txt"/> + </test> + <test> + <param name="input" value="find1.txt"/> + <param name="pattern" value="f"/> + <param name="replacement" value="'"" /> + <output name="out_file1" file="replace2.txt"/> + </test> + </tests> + <help> +This tool goes line by line through the specified input file and +replaces text which matches the specified regular expression patterns +with its corresponding specified replacement. + +This tool uses Python regular expressions. More information about +Python regular expressions can be found here: +http://docs.python.org/library/re.html. + +To convert an Ilumina FATSQ sequence id from the CAVASA 8 format:: + + @EAS139:136:FC706VJ:2:2104:15343:197393 1:Y:18:ATCACG + GGGTGATGGCCGCTGCCGATGGCGTCAAATCCCACC + +EAS139:136:FC706VJ:2:2104:15343:197393 1:Y:18:ATCACG + IIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IG9IC + +To the CASAVA 7 format:: + + @EAS139_FC706VJ:2:2104:15343:197393#0/1 + GGGTGATGGCCGCTGCCGATGGCGTCAAATCCCACC + +EAS139_FC706VJ:2:2104:15343:197393#0/1 + IIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IG9IC + +Use Settings:: + + Find Regex: ^([@+][A-Z0-9]+):\d+:(\S+)\s(\d).*$ + Replacement: \1_\2#0/\3 + +Note that the parentheses **()** capture patterns in the text that can be used in the replacement text by using a backslash-number reference: **\\1** + +The regex **^([@+][A-Z0-9]+):\d+:(\S+) (\d).*$** means:: + + ^ - start the match at the beginning of the line of text + ( - start a group (1), that is a string of matched text, that can be back-referenced in the replacement as \1 + [@+] - matches either a @ or + character + [A-Z0-9]+ - matches an uppercase letter or a digit, the plus sign means to match 1 or more such characters + ) - end a group (1), that is a string of matched text, that can be back-referenced in the replacement as \1 + :\d+: - matches a colon followed by one or more digits followed by a colon character + (\S+) - matches one or more non-whitespace charcters, the enclosing parentheses make this a group (2) that can back-referenced in the replacement text as \2 + \s - matches a whitespace character + (\d) - matches a single digit character, the enclosing parentheses make this a group (3) that can back-referenced in the replacement text as \3 + .* - dot means match any character, asterisk means zero more more matches + $ - the regex must match to the end of the line of text + + + +Galaxy aggressively escapes input supplied to tools, so if something +is not working please let us know and we can look into whether this is +the cause. Also if you would like help constructing regular +expressions for your inputs, please let us know at help@msi.umn.edu. +</help> +</tool>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/regex_tabular.xml Sat Mar 29 13:41:51 2014 -0400 @@ -0,0 +1,112 @@ +<tool id="regexColumn1" name="Column Regex Find And Replace" version="0.1.0"> + <description></description> + <command interpreter="python">regex.py --input $input --output $out_file1 --column $field + #for $check in $checks: + --pattern='$check.pattern' --replacement='$check.replacement' + #end for + </command> + <inputs> + <param format="tabular" name="input" type="data" label="Select cells from"/> + <param name="field" label="using column" type="data_column" data_ref="input" /> + <repeat name="checks" title="Check"> + <param name="pattern" size="40" type="text" value="chr([0-9A-Za-z])+" label="Find Regex" help="here you can enter text or regular expression (for syntax check lower part of this frame)"> + <sanitizer> + <valid> + <add preset="string.printable"/> + <remove value="\" /> + <remove value="'" /> + </valid> + <mapping initial="none"> + <add source="\" target="__backslash__" /> + <add source="'" target="__sq__"/> + </mapping> + </sanitizer> + </param> + <param name="replacement" size="40" type="text" value="newchr\1" label="Replacement"> + <sanitizer> + <valid> + <add preset="string.printable"/> + <remove value="\" /> + <remove value="'" /> + </valid> + <mapping initial="none"> + <add source="\" target="__backslash__" /> + <add source="'" target="__sq__"/> + </mapping> + </sanitizer> + </param> + </repeat> + </inputs> + <outputs> + <data format="input" name="out_file1" metadata_source="input" /> + </outputs> + <tests> + <test> + <param name="input" value="find_tabular_1.txt" ftype="tabular" /> + <param name="field" value="1" /> + <param name="pattern" value="moo"/> + <param name="replacement" value="cow" /> + <output name="out_file1" file="replace_tabular_1.txt"/> + </test> + </tests> + <help> + +.. class:: warningmark + +**This tool will attempt to reuse the metadata from your first input.** To change metadata assignments click on the "edit attributes" link of the history item generated by this tool. + +.. class:: infomark + +**TIP:** If your data is not TAB delimited, use *Text Manipulation->Convert* + +----- + +This tool goes line by line through the specified input file and +if the text in the selected column matches a specified regular expression pattern +replaces the text with the corresponding specified replacement. + +This tool can be used to change between the chromosome naming conventions of UCSC and Ensembl. + +For example to remove the **chr** part of the reference sequence name in the first column of this GFF file:: + + ##gff-version 2 + ##Date: Thu Mar 23 11:21:17 2006 + ##bed2gff.pl $Rev: 601 $ + ##Input file: ./database/files/61c6c604e0ef50b280e2fd9f1aa7da61.dat + chr1 bed2gff CCDS1000.1_cds_0_0_chr1_148325916_f 148325916 148325975 . + . score "0"; + chr21 bed2gff CCDS13614.1_cds_0_0_chr21_32707033_f 32707033 32707192 . + . score "0"; + chrX bed2gff CCDS14606.1_cds_0_0_chrX_122745048_f 122745048 122745924 . + . score "0"; + +Setting:: + + using column: c1 + Find Regex: chr([0-9]+|X|Y|M[Tt]?) + Replacement: \1 + +produces:: + + ##gff-version 2 + ##Date: Thu Mar 23 11:21:17 2006 + ##bed2gff.pl $Rev: 601 $ + ##Input file: ./database/files/61c6c604e0ef50b280e2fd9f1aa7da61.dat + 1 bed2gff CCDS1000.1_cds_0_0_chr1_148325916_f 148325916 148325975 . + . score "0"; + 21 bed2gff CCDS13614.1_cds_0_0_chr21_32707033_f 32707033 32707192 . + . score "0"; + X bed2gff CCDS14606.1_cds_0_0_chrX_122745048_f 122745048 122745924 . + . score "0"; + + +This tool uses Python regular expressions with the **re.sub()** function. +More information about Python regular expressions can be found here: +http://docs.python.org/library/re.html. + +The regex **chr([0-9]+|X|Y|M)** means start with text **chr** followed by either: one or more digits, or the letter X, or the letter Y, or the letter M (optionally followed by a single letter T or t). +Note that the parentheses **()** capture patterns in the text that can be used in the replacement text by using a backslash-number reference: **\\1** + + + +Galaxy aggressively escapes input supplied to tools, so if something +is not working please let us know and we can look into whether this is +the cause. Also if you would like help constructing regular +expressions for your inputs, please let us know at help@msi.umn.edu. + +</help> +</tool>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/find1.txt Sat Mar 29 13:41:51 2014 -0400 @@ -0,0 +1,3 @@ +This is a test file. + +There is nothing to see here.
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/find_tabular_1.txt Sat Mar 29 13:41:51 2014 -0400 @@ -0,0 +1,2 @@ +this test +moo amooa
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/replace1.txt Sat Mar 29 13:41:51 2014 -0400 @@ -0,0 +1,3 @@ +This This is a test file. + +There There is nothing to see here.
