# HG changeset patch
# User john-mccallum
# Date 1316059077 14400
# Node ID 3006582bfc7618b2e60600ef14811c8b8838bde1

Uploaded V1.0 MISA tools and helper scripts

diff -r 000000000000 -r 3006582bfc76 MISA/clean_fasta_header.sh
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/MISA/clean_fasta_header.sh	Wed Sep 14 23:57:57 2011 -0400
@@ -0,0 +1,5 @@
+#!/bin/sh
+## clean_fasta_header.sh 
+##Remove descriptions from header
+
+sed 's/\(>\w*\)\s*.*/\1/' 
\ No newline at end of file
diff -r 000000000000 -r 3006582bfc76 MISA/clean_fasta_header.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/MISA/clean_fasta_header.xml	Wed Sep 14 23:57:57 2011 -0400
@@ -0,0 +1,53 @@
+<?xml version="1.0"?>
+<tool id="clean_fasta_header_1" name="Clean fasta header">
+  <description>Removes fasta description fields in header </description>
+  <command>sed 's/\(>\w*\)\s*.*/\1/'  $inputFastaFile > $fasta_outputfile</command>
+  <inputs>
+    <param format="fasta" name="inputFastaFile" type="data" label="fasta File"/>
+  </inputs>
+  <outputs>
+     <data format="fasta"  name="fasta_outputfile" />
+  </outputs>
+<help>
+.. class:: infomark
+
+**TIP**
+
+This tool requires *fasta* format.
+
+It simply removes any additional definition strings from the header line prior to using tools that dont handle these.
+
+----
+
+**Example**
+
+--Query sequence
+
+::
+
+ &gt;contig00001  gene=isogroup00001  length=2159
+ tttAaGCATTTAACACTGCATATTGATTGATATAGTTGTTCAGTACAAGCCAATTACATT
+ GTAGACATAAAACAAAGCATTCGAAACAGTTGAAATTTTGATTCCTCTATACTGGATCAG
+ GCGGTAATCA
+ &gt;contig00003  gene=isogroup00001  length=2206  
+ ggTGGCTGCTTTCTCAAATCCACCCCTTCCCAAGGAAACCCTAAACTCGCAGATAAATTT
+
+
+
+--Output
+
+::
+
+ &gt;contig00001
+ ttAaGCATTTAACACTGCATATTGATTGATATAGTTGTTCAGTACAAGCCAATTACATT
+ GTAGACATAAAACAAAGCATTCGAAACAGTTGAAATTTTGATTCCTCTATACTGGATCAG
+ GCGGTAATCAGGGGAAGGAAACCATGGTGTAAGGCTGCATCCCATACTTTATCTATGTCA
+ >contig00003
+ ggTGGCTGCTTTCTCAAATCCACCCCTTCCCAAGGAAACCCTAAACTCGCAGATAAATTT
+ GTAGGGTTTCTATGTCGACCGAGCGCCGTCGGAAAGTGAGCCTTTTCGACGTAGTTGAC
+ GAGACCTCAGTCTCTG...
+
+
+</help>
+
+</tool>
diff -r 000000000000 -r 3006582bfc76 MISA/design_MISA.sh
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/MISA/design_MISA.sh	Wed Sep 14 23:57:57 2011 -0400
@@ -0,0 +1,17 @@
+#!/bin/sh
+#design primer sets from MISA output using Primer 3 and MISA helper scripts
+#USAGE sh design_MISA.sh <misa_file> <source_fasta_file> <output_file>
+
+#get directory
+SCRIPT=`readlink -f $0`
+SCRIPTPATH=`dirname $SCRIPT`
+
+perl $SCRIPTPATH/p3_in.pl  $1 $2  temp.p3in
+
+cat  temp.p3in | primer3_core  >  temp.p3out
+
+
+perl $SCRIPTPATH/p3_out.pl  temp.p3out $1  $3
+
+rm -f temp.*
+
diff -r 000000000000 -r 3006582bfc76 MISA/design_MISA.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/MISA/design_MISA.xml	Wed Sep 14 23:57:57 2011 -0400
@@ -0,0 +1,27 @@
+<tool id="design_MISA_1" name="MISA Primer Design">
+  <description>Design primer sets using MISA output </description>
+  <command interpreter="bash">design_MISA.sh  $inputMisaFile $inputFastaFile $outputfile</command>
+  <inputs>
+    <param format="misa" name="inputMisaFile" type="data" label="Misa Source file"/>
+    <param format="fasta" name="inputFastaFile" type="data" label="Fasta Source file"/>
+  </inputs>
+  <outputs>
+     <data format="tabular"  name="outputfile" />
+  </outputs>
+<help>
+
+.. class:: infomark
+
+Design SSR primer sets from MISA output using Primer3
+
+This tool uses helper scripts developed at IPK
+
+http://pgrc.ipk-gatersleben.de/misa/primer3.html
+
+
+
+
+</help>
+
+
+</tool>
diff -r 000000000000 -r 3006582bfc76 MISA/misa.ini
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/MISA/misa.ini	Wed Sep 14 23:57:57 2011 -0400
@@ -0,0 +1,2 @@
+definition(unit_size,min_repeats):                   1-10 2-6 3-5 4-5 5-5 6-5
+interruptions(max_difference_between_2_SSRs):        100
diff -r 000000000000 -r 3006582bfc76 MISA/misa.pl
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/MISA/misa.pl	Wed Sep 14 23:57:57 2011 -0400
@@ -0,0 +1,307 @@
+#!/usr/bin/perl -w
+# Author: Thomas Thiel
+# Program name: misa.pl
+
+###_______________________________________________________________________________
+###
+###Program name: misa.pl
+###Author:       Thomas Thiel
+###Release date: 14/12/01 (version 1.0)
+###
+###_______________________________________________________________________________
+###
+## _______________________________________________________________________________
+##
+## DESCRIPTION: Tool for the identification and localization of
+##              (I)  perfect microsatellites as well as
+##              (II) compound microsatellites (two individual microsatellites,
+##                   disrupted by a certain number of bases)
+##
+## SYNTAX:   misa.pl <FASTA file>
+##
+##    <FASTAfile>    Single file in FASTA format containing the sequence(s).
+##
+##    In order to specify the search criteria, an additional file containing
+##    the microsatellite search parameters is required named "misa.ini", which
+##    has the following structure:
+##      (a) Following a text string beginning with 'def', pairs of numbers are
+##          expected, whereas the first number defines the unit size and the
+##          second number the lower threshold of repeats for that specific unit.
+##      (b) Following a text string beginning with 'int' a single number defines
+##          the maximal number of bases between two adjacent microsatellites in
+##          order to specify the compound microsatellite type.
+##    Example:
+##      definition(unit_size,min_repeats):          1-10 2-6 3-5 4-5 5-5 6-5
+##      interruptions(max_difference_for_2_SSRs):   100
+##
+## EXAMPLE: misa.pl seqs.fasta
+##
+## _______________________________________________________________________________
+##
+
+
+#§§§§§ DECLARATION §§§§§#
+
+# Check for arguments. If none display syntax #
+
+if (@ARGV == 0)
+  {
+  open (IN,"<$0");
+  while (<IN>) {if (/^\#\# (.*)/) {$message .= "$1\n"}};
+  close (IN);
+  die $message;
+  };
+
+# Check if help is required #
+
+if ($ARGV[0] =~ /-help/i)
+  {
+  open (IN,"<$0");
+  while (<IN>) {if (/^\#\#\#(.*)/) {$message .= "$1\n"}};
+  close (IN);
+  die $message;
+  };
+
+# Open FASTA file #
+
+open (IN,"<$ARGV[0]") || die ("\nError: FASTA file doesn't exist !\n\n");
+#open (OUT,">$ARGV[0].misa"); updated by Leshi chen for galaxy integration
+open (OUT,">$ARGV[1]");
+print OUT "ID\tSSR nr.\tSSR type\tSSR\tsize\tstart\tend\n";
+
+# Reading arguments updated by Leshi chen to get local path otherwise will create error #
+#use Cwd 'abs_path';
+#use Cwd 'getcwd';
+#print getcwd()&"misa.ini";
+#print OUT abs_path($0);
+open (SPECS,"\/root\/galaxy_dist\/tools\/pfr_2010\/"."misa.ini") || die ("\nError: Specifications file doesn't exist ! \n\n misa.ini not found ! \n\n");
+my %typrep;
+my $amb = 0;
+while (<SPECS>)
+   {
+   %typrep = $1 =~ /(\d+)/gi if (/^def\S*\s+(.*)/i);
+   if (/^int\S*\s+(\d+)/i) {$amb = $1}
+   };
+my @typ = sort { $a <=> $b } keys %typrep;
+
+
+#§§§§§ CORE §§§§§#
+
+$/ = ">";
+my $max_repeats = 1; #count repeats
+my $min_repeats = 1000; #count repeats
+my (%count_motif,%count_class); #count
+my ($number_sequences,$size_sequences,%ssr_containing_seqs); #stores number and size of all sequences examined
+my $ssr_in_compound = 0;
+my ($id,$seq);
+while (<IN>)
+  {
+  next unless (($id,$seq) = /(.*?)\n(.*)/s);
+  my ($nr,%start,@order,%end,%motif,%repeats); # store info of all SSRs from each sequence
+  $seq =~ s/[\d\s>]//g; #remove digits, spaces, line breaks,...
+  $id =~ s/^\s*//g; $id =~ s/\s*$//g;$id =~ s/\s/_/g; #replace whitespace with "_"
+  $number_sequences++;
+  $size_sequences += length $seq;
+  for ($i=0; $i < scalar(@typ); $i++) #check each motif class
+    {
+    my $motiflen = $typ[$i];
+    my $minreps = $typrep{$typ[$i]} - 1;
+    if ($min_repeats > $typrep{$typ[$i]}) {$min_repeats = $typrep{$typ[$i]}}; #count repeats
+    my $search = "(([acgt]{$motiflen})\\2{$minreps,})";
+    while ( $seq =~ /$search/ig ) #scan whole sequence for that class
+      {
+      my $motif = uc $2;
+      my $redundant; #reject false type motifs [e.g. (TT)6 or (ACAC)5]
+      for ($j = $motiflen - 1; $j > 0; $j--)
+        {
+        my $redmotif = "([ACGT]{$j})\\1{".($motiflen/$j-1)."}";
+        $redundant = 1 if ( $motif =~ /$redmotif/ )
+        };
+      next if $redundant;
+      $motif{++$nr} = $motif;
+      my $ssr = uc $1;
+      $repeats{$nr} = length($ssr) / $motiflen;
+      $end{$nr} = pos($seq);
+      $start{$nr} = $end{$nr} - length($ssr) + 1;
+      # count repeats
+      $count_motifs{$motif{$nr}}++; #counts occurrence of individual motifs
+      $motif{$nr}->{$repeats{$nr}}++; #counts occurrence of specific SSR in its appearing repeat
+      $count_class{$typ[$i]}++; #counts occurrence in each motif class
+      if ($max_repeats < $repeats{$nr}) {$max_repeats = $repeats{$nr}};
+      };
+    };
+  next if (!$nr); #no SSRs
+  $ssr_containing_seqs{$nr}++;
+  @order = sort { $start{$a} <=> $start{$b} } keys %start; #put SSRs in right order
+  $i = 0;
+  my $count_seq; #counts
+  my ($start,$end,$ssrseq,$ssrtype,$size);
+  while ($i < $nr)
+    {
+    my $space = $amb + 1;
+    if (!$order[$i+1]) #last or only SSR
+      {
+      $count_seq++;
+      my $motiflen = length ($motif{$order[$i]});
+      $ssrtype = "p".$motiflen;
+      $ssrseq = "($motif{$order[$i]})$repeats{$order[$i]}";
+      $start = $start{$order[$i]}; $end = $end{$order[$i++]};
+      next
+      };
+    if (($start{$order[$i+1]} - $end{$order[$i]}) > $space)
+      {
+      $count_seq++;
+      my $motiflen = length ($motif{$order[$i]});
+      $ssrtype = "p".$motiflen;
+      $ssrseq = "($motif{$order[$i]})$repeats{$order[$i]}";
+      $start = $start{$order[$i]}; $end = $end{$order[$i++]};
+      next
+      };
+    my ($interssr);
+    if (($start{$order[$i+1]} - $end{$order[$i]}) < 1)
+      {
+      $count_seq++; $ssr_in_compound++;
+      $ssrtype = 'c*';
+      $ssrseq = "($motif{$order[$i]})$repeats{$order[$i]}($motif{$order[$i+1]})$repeats{$order[$i+1]}*";
+      $start = $start{$order[$i]}; $end = $end{$order[$i+1]}
+      }
+    else
+      {
+      $count_seq++; $ssr_in_compound++;
+      $interssr = lc substr($seq,$end{$order[$i]},($start{$order[$i+1]} - $end{$order[$i]}) - 1);
+      $ssrtype = 'c';
+      $ssrseq = "($motif{$order[$i]})$repeats{$order[$i]}$interssr($motif{$order[$i+1]})$repeats{$order[$i+1]}";
+      $start = $start{$order[$i]};  $end = $end{$order[$i+1]};
+      #$space -= length $interssr
+      };
+    while ($order[++$i + 1] and (($start{$order[$i+1]} - $end{$order[$i]}) <= $space))
+      {
+      if (($start{$order[$i+1]} - $end{$order[$i]}) < 1)
+        {
+        $ssr_in_compound++;
+        $ssrseq .= "($motif{$order[$i+1]})$repeats{$order[$i+1]}*";
+        $ssrtype = 'c*';
+        $end = $end{$order[$i+1]}
+        }
+      else
+        {
+        $ssr_in_compound++;
+        $interssr = lc substr($seq,$end{$order[$i]},($start{$order[$i+1]} - $end{$order[$i]}) - 1);
+        $ssrseq .= "$interssr($motif{$order[$i+1]})$repeats{$order[$i+1]}";
+        $end = $end{$order[$i+1]};
+        #$space -= length $interssr
+        }
+      };
+    $i++;
+    }
+  continue
+    {
+    print OUT "$id\t$count_seq\t$ssrtype\t$ssrseq\t",($end - $start + 1),"\t$start\t$end\n"
+    };
+  };
+
+close (OUT);
+#open (OUT,">$ARGV[0].statistics"); updated by Leshi chen for galaxy integration
+open (OUT,">$ARGV[2]");
+
+#§§§§§ INFO §§§§§#
+
+#§§§ Specifications §§§#
+print OUT "Specifications\n==============\n\nSequence source file: \"$ARGV[0]\"\n\nDefinement of microsatellites (unit size / minimum number of repeats):\n";
+for ($i = 0; $i < scalar (@typ); $i++) {print OUT "($typ[$i]/$typrep{$typ[$i]}) "};print OUT "\n";
+if ($amb > 0) {print OUT "\nMaximal number of bases interrupting 2 SSRs in a compound microsatellite:  $amb\n"};
+print OUT "\n\n\n";
+
+#§§§ OCCURRENCE OF SSRs §§§#
+
+#small calculations
+my @ssr_containing_seqs = values %ssr_containing_seqs;
+my $ssr_containing_seqs = 0;
+for ($i = 0; $i < scalar (@ssr_containing_seqs); $i++) {$ssr_containing_seqs += $ssr_containing_seqs[$i]};
+my @count_motifs = sort {length ($a) <=> length ($b) || $a cmp $b } keys %count_motifs;
+my @count_class = sort { $a <=> $b } keys %count_class;
+for ($i = 0; $i < scalar (@count_class); $i++) {$total += $count_class{$count_class[$i]}};
+
+#§§§ Overview §§§#
+print OUT "RESULTS OF MICROSATELLITE SEARCH\n================================\n\n";
+print OUT "Total number of sequences examined:              $number_sequences\n";
+print OUT "Total size of examined sequences (bp):           $size_sequences\n";
+print OUT "Total number of identified SSRs:                 $total\n";
+print OUT "Number of SSR containing sequences:              $ssr_containing_seqs\n";
+print OUT "Number of sequences containing more than 1 SSR:  ",$ssr_containing_seqs - ($ssr_containing_seqs{1} || 0),"\n";
+print OUT "Number of SSRs present in compound formation:    $ssr_in_compound\n\n\n";
+
+#§§§ Frequency of SSR classes §§§#
+print OUT "Distribution to different repeat type classes\n---------------------------------------------\n\n";
+print OUT "Unit size\tNumber of SSRs\n";
+my $total = undef;
+for ($i = 0; $i < scalar (@count_class); $i++) {print OUT "$count_class[$i]\t$count_class{$count_class[$i]}\n"};
+print OUT "\n";
+
+#§§§ Frequency of SSRs: per motif and number of repeats §§§#
+print OUT "Frequency of identified SSR motifs\n----------------------------------\n\nRepeats";
+for ($i = $min_repeats;$i <= $max_repeats; $i++) {print OUT "\t$i"};
+print OUT "\ttotal\n";
+for ($i = 0; $i < scalar (@count_motifs); $i++)
+  {
+  my $typ = length ($count_motifs[$i]);
+  print OUT $count_motifs[$i];
+  for ($j = $min_repeats; $j <= $max_repeats; $j++)
+    {
+    if ($j < $typrep{$typ}) {print OUT "\t-";next};
+    if ($count_motifs[$i]->{$j}) {print OUT "\t$count_motifs[$i]->{$j}"} else {print OUT "\t"};
+    };
+  print OUT "\t$count_motifs{$count_motifs[$i]}\n";
+  };
+print OUT "\n";
+
+#§§§ Frequency of SSRs: summarizing redundant and reverse motifs §§§#
+# Eliminates %count_motifs !
+print OUT "Frequency of classified repeat types (considering sequence complementary)\n-------------------------------------------------------------------------\n\nRepeats";
+my (%red_rev,@red_rev); # groups
+for ($i = 0; $i < scalar (@count_motifs); $i++)
+  {
+  next if ($count_motifs{$count_motifs[$i]} eq 'X');
+  my (%group,@group,$red_rev); # store redundant/reverse motifs
+  my $reverse_motif = $actual_motif = $actual_motif_a = $count_motifs[$i];
+  $reverse_motif =~ tr/ACGT/TGCA/;
+  $reverse_motif = reverse $reverse_motif;
+  my $reverse_motif_a = $reverse_motif;
+  for ($j = 0; $j < length ($count_motifs[$i]); $j++)
+    {
+    if ($count_motifs{$actual_motif}) {$group{$actual_motif} = "1"; $count_motifs{$actual_motif}='X'};
+    if ($count_motifs{$reverse_motif}) {$group{$reverse_motif} = "1"; $count_motifs{$reverse_motif}='X'};
+    $actual_motif =~ s/(.)(.*)/$2$1/;
+    $reverse_motif =~ s/(.)(.*)/$2$1/;
+    $actual_motif_a = $actual_motif if ($actual_motif lt $actual_motif_a);
+    $reverse_motif_a = $reverse_motif if ($reverse_motif lt $reverse_motif_a)
+    };
+  if ($actual_motif_a lt $reverse_motif_a) {$red_rev = "$actual_motif_a/$reverse_motif_a"}
+  else {$red_rev = "$reverse_motif_a/$actual_motif_a"}; # group name
+  $red_rev{$red_rev}++;
+  @group = keys %group;
+  for ($j = 0; $j < scalar (@group); $j++)
+    {
+    for ($k = $min_repeats; $k <= $max_repeats; $k++)
+      {
+      if ($group[$j]->{$k}) {$red_rev->{"total"} += $group[$j]->{$k};$red_rev->{$k} += $group[$j]->{$k}}
+      }
+    }
+  };
+for ($i = $min_repeats; $i <= $max_repeats; $i++) {print OUT "\t$i"};
+print OUT "\ttotal\n";
+@red_rev = sort {length ($a) <=> length ($b) || $a cmp $b } keys %red_rev;
+for ($i = 0; $i < scalar (@red_rev); $i++)
+  {
+  my $typ = (length ($red_rev[$i])-1)/2;
+  print OUT $red_rev[$i];
+  for ($j = $min_repeats; $j <= $max_repeats; $j++)
+    {
+    if ($j < $typrep{$typ}) {print OUT "\t-";next};
+    if ($red_rev[$i]->{$j}) {print OUT "\t",$red_rev[$i]->{$j}}
+    else {print OUT "\t"}
+    };
+  print OUT "\t",$red_rev[$i]->{"total"},"\n";
+  };
+#add by Leshi to close the Out
+close (OUT);
diff -r 000000000000 -r 3006582bfc76 MISA/p3_in.pl
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/MISA/p3_in.pl	Wed Sep 14 23:57:57 2011 -0400
@@ -0,0 +1,34 @@
+#!/usr/bin/perl -w
+# Author: Thomas Thiel
+# Program name: primer3_in.pl
+# Description: creates a PRIMER3 input file based on SSR search results
+
+open (IN,"<$ARGV[0]") || die ("\nError: Couldn't open misa.pl results file (*.misa) !\n\n");
+
+#my $filename = $ARGV[0];
+#$filename =~ s/\.misa//;
+open (SRC,"<$ARGV[1]") || die ("\nError: Couldn't open source file containing original FASTA sequences !\n\n");
+open (OUT,">$ARGV[2]");
+
+undef $/;
+$in = <IN>;
+study $in;
+
+$/= ">";
+
+#my $count;
+while (<SRC>)
+  {
+  next unless (my ($id,$seq) = /(.*?)\n(.*)/s);
+  $seq =~ s/[\d\s>]//g;#remove digits, spaces, line breaks,...
+  while ($in =~ /$id\t(\d+)\t\S+\t\S+\t(\d+)\t(\d+)/g)
+    {
+    my ($ssr_nr,$size,$start) = ($1,$2,$3);
+    #$count++;
+    print OUT "PRIMER_SEQUENCE_ID=$id"."_$ssr_nr\nSEQUENCE=$seq\n";
+    print OUT "PRIMER_PRODUCT_SIZE_RANGE=100-280\n";
+    print OUT "TARGET=",$start-3,",",$size+6,"\n";
+    print OUT "PRIMER_MAX_END_STABILITY=250\n=\n"
+    };
+  };
+#print "\n$count records created.\n";
diff -r 000000000000 -r 3006582bfc76 MISA/p3_misa_parameter.pl
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/MISA/p3_misa_parameter.pl	Wed Sep 14 23:57:57 2011 -0400
@@ -0,0 +1,223 @@
+#!/usr/bin/perl -w
+# Author: Thomas Thiel
+# Program name: misa.pl
+
+###_______________________________________________________________________________
+###
+###Program name:p3_ misa_parameter.pl
+###Author:       Thomas Thiel
+###Release date: 14/12/01 (version 1.0)
+###
+###_______________________________________________________________________________
+###
+## _______________________________________________________________________________
+##
+## DESCRIPTION: Tool for the identification and localization of
+##              (I)  perfect microsatellites as well as
+##              (II) compound microsatellites (two individual microsatellites,
+##                   disrupted by a certain number of bases)
+##
+## SYNTAX:   misa.pl <FASTA file>
+##
+##    <FASTAfile>    Single file in FASTA format containing the sequence(s).
+##
+##    In order to specify the search criteria, an additional file containing
+##    the microsatellite search parameters is required named "misa.ini", which
+##    has the following structure:
+##      (a) Following a text string beginning with 'def', pairs of numbers are
+##          expected, whereas the first number defines the unit size and the
+##          second number the lower threshold of repeats for that specific unit.
+##      (b) Following a text string beginning with 'int' a single number defines
+##          the maximal number of bases between two adjacent microsatellites in
+##          order to specify the compound microsatellite type.
+##    Example:
+##      definition(unit_size,min_repeats):          1-10 2-6 3-5 4-5 5-5 6-5
+##      interruptions(max_difference_for_2_SSRs):   100
+##
+## EXAMPLE: misa.pl seqs.fasta
+## Modified by Leshi Chen for primer design
+## _______________________________________________________________________________
+##
+
+
+#§§§§§ DECLARATION §§§§§#
+
+# Check for arguments. If none display syntax #
+
+
+if (@ARGV == 0)
+  {
+  open (IN,"<$0");
+  while (<IN>) {if (/^\#\# (.*)/) {$message .= "$1\n"}};
+  close (IN);
+  die $message;
+  };
+
+# Check if help is required #
+
+if ($ARGV[0] =~ /-help/i)
+  {
+  open (IN,"<$0");
+  while (<IN>) {if (/^\#\#\#(.*)/) {$message .= "$1\n"}};
+  close (IN);
+  die $message;
+  };
+
+# Open FASTA file #
+
+open (IN,"<$ARGV[0]") || die ("\nError: FASTA file doesn't exist !\n\n");
+#open (OUT,">$ARGV[0].misa"); updated by Leshi chen for galaxy integration
+open (OUT,">$ARGV[1]");
+print OUT "ID\tSSR nr.\tSSR type\tSSR\tsize\tstart\tend\n";
+
+# Reading arguments updated by Leshi chen to get local path otherwise will create error #
+#use Cwd 'abs_path';
+#use Cwd 'getcwd';
+#print getcwd()&"misa.ini";
+#print OUT abs_path($0);
+#open (SPECS,"\/root\/galaxy_dist\/tools\/pfr_2010\/"."misa.ini") || die ("\nError: Specifications file doesn't exist ! \n\n misa.ini not found ! \n\n");
+my $arg_def= $ARGV[2]||'';
+my $arg_interuption= $ARGV[3]||'';
+#my $tmb = '';
+#my $_ = '';
+my %typrep;
+my $amb = 0;
+
+%typrep =  $arg_def  =~/(\d+)-(\d+)/gi;
+#print "1:" , $arg_def , "\n";
+#print "hh: ",  %typrep , "\n";
+#print $arg_def , "\n";
+#print $arg_interuption ,"\n";
+#print  $arg_def  =~/(\d+)/gi , "\n";
+#%typrep =  $arg_def  =~/(\d+)/gi;
+print %typrep , "\n";
+$amb = $arg_interuption;
+print $amb , "\n";
+#while (<SPECS>)#
+  # {#
+  # %typrep = $1 =~ /(\d+)/gi if (/^def\S*\s+(.*)/i);#
+  # if (/^int\S*\s+(\d+)/i) {$amb = $1}#
+  # };#
+my @typ = sort { $a <=> $b } keys %typrep;
+print @typ . "\n";
+#die (%typrep , "--" , @typ , "--" , $amb);
+#§§§§§ CORE §§§§§#
+
+$/ = ">";
+my $max_repeats = 1; #count repeats
+my $min_repeats = 1000; #count repeats
+my (%count_motif,%count_class); #count
+my ($number_sequences,$size_sequences,%ssr_containing_seqs); #stores number and size of all sequences examined
+my $ssr_in_compound = 0;
+my ($id,$seq);
+while (<IN>)
+  {
+  next unless (($id,$seq) = /(.*?)\n(.*)/s);
+  my ($nr,%start,@order,%end,%motif,%repeats); # store info of all SSRs from each sequence
+  $seq =~ s/[\d\s>]//g; #remove digits, spaces, line breaks,...
+  $id =~ s/^\s*//g; $id =~ s/\s*$//g;$id =~ s/\s/_/g; #replace whitespace with "_"
+  $number_sequences++;
+  $size_sequences += length $seq;
+  for ($i=0; $i < scalar(@typ); $i++) #check each motif class
+    {
+    my $motiflen = $typ[$i];
+    my $minreps = $typrep{$typ[$i]} - 1;
+    if ($min_repeats > $typrep{$typ[$i]}) {$min_repeats = $typrep{$typ[$i]}}; #count repeats
+    my $search = "(([acgt]{$motiflen})\\2{$minreps,})";
+    while ( $seq =~ /$search/ig ) #scan whole sequence for that class
+      {
+      my $motif = uc $2;
+      my $redundant; #reject false type motifs [e.g. (TT)6 or (ACAC)5]
+      for ($j = $motiflen - 1; $j > 0; $j--)
+        {
+        my $redmotif = "([ACGT]{$j})\\1{".($motiflen/$j-1)."}";
+        $redundant = 1 if ( $motif =~ /$redmotif/ )
+        };
+      next if $redundant;
+      $motif{++$nr} = $motif;
+      my $ssr = uc $1;
+      $repeats{$nr} = length($ssr) / $motiflen;
+      $end{$nr} = pos($seq);
+      $start{$nr} = $end{$nr} - length($ssr) + 1;
+      # count repeats
+      # count_motifs doesn't required as statistic has been removed - modified by leshi
+      #$count_motifs{$motif{$nr}}++; #counts occurrence of individual motifs
+      $motif{$nr}->{$repeats{$nr}}++; #counts occurrence of specific SSR in its appearing repeat
+      $count_class{$typ[$i]}++; #counts occurrence in each motif class
+      if ($max_repeats < $repeats{$nr}) {$max_repeats = $repeats{$nr}};
+      };
+    };
+  next if (!$nr); #no SSRs
+  $ssr_containing_seqs{$nr}++;
+  @order = sort { $start{$a} <=> $start{$b} } keys %start; #put SSRs in right order
+  $i = 0;
+  my $count_seq; #counts
+  my ($start,$end,$ssrseq,$ssrtype,$size);
+  while ($i < $nr)
+    {
+    my $space = $amb + 1;
+    if (!$order[$i+1]) #last or only SSR
+      {
+      $count_seq++;
+      my $motiflen = length ($motif{$order[$i]});
+      $ssrtype = "p".$motiflen;
+      $ssrseq = "($motif{$order[$i]})$repeats{$order[$i]}";
+      $start = $start{$order[$i]}; $end = $end{$order[$i++]};
+      next
+      };
+    if (($start{$order[$i+1]} - $end{$order[$i]}) > $space)
+      {
+      $count_seq++;
+      my $motiflen = length ($motif{$order[$i]});
+      $ssrtype = "p".$motiflen;
+      $ssrseq = "($motif{$order[$i]})$repeats{$order[$i]}";
+      $start = $start{$order[$i]}; $end = $end{$order[$i++]};
+      next
+      };
+    my ($interssr);
+    if (($start{$order[$i+1]} - $end{$order[$i]}) < 1)
+      {
+      $count_seq++; $ssr_in_compound++;
+      $ssrtype = 'c*';
+      $ssrseq = "($motif{$order[$i]})$repeats{$order[$i]}($motif{$order[$i+1]})$repeats{$order[$i+1]}*";
+      $start = $start{$order[$i]}; $end = $end{$order[$i+1]}
+      }
+    else
+      {
+      $count_seq++; $ssr_in_compound++;
+      $interssr = lc substr($seq,$end{$order[$i]},($start{$order[$i+1]} - $end{$order[$i]}) - 1);
+      $ssrtype = 'c';
+      $ssrseq = "($motif{$order[$i]})$repeats{$order[$i]}$interssr($motif{$order[$i+1]})$repeats{$order[$i+1]}";
+      $start = $start{$order[$i]};  $end = $end{$order[$i+1]};
+      #$space -= length $interssr
+      };
+    while ($order[++$i + 1] and (($start{$order[$i+1]} - $end{$order[$i]}) <= $space))
+      {
+      if (($start{$order[$i+1]} - $end{$order[$i]}) < 1)
+        {
+        $ssr_in_compound++;
+        $ssrseq .= "($motif{$order[$i+1]})$repeats{$order[$i+1]}*";
+        $ssrtype = 'c*';
+        $end = $end{$order[$i+1]}
+        }
+      else
+        {
+        $ssr_in_compound++;
+        $interssr = lc substr($seq,$end{$order[$i]},($start{$order[$i+1]} - $end{$order[$i]}) - 1);
+        $ssrseq .= "$interssr($motif{$order[$i+1]})$repeats{$order[$i+1]}";
+        $end = $end{$order[$i+1]};
+        #$space -= length $interssr
+        }
+      };
+    $i++;
+    }
+  continue
+    {
+    print OUT "$id\t$count_seq\t$ssrtype\t$ssrseq\t",($end - $start + 1),"\t$start\t$end\n"
+    };
+  };
+
+close (OUT);
+#open (OUT,">$ARGV[0].statistics"); updated by Leshi chen for galaxy integration
+# the statistics part has been removed as we only need misa for primer
+
diff -r 000000000000 -r 3006582bfc76 MISA/p3_misa_parameter.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/MISA/p3_misa_parameter.xml	Wed Sep 14 23:57:57 2011 -0400
@@ -0,0 +1,46 @@
+<?xml version="1.0"?>
+<tool id="p3_misa_1_parameter" name="Detect SSRs using MISA">
+  <description>Detect simple sequence repeats using MISA</description>
+  <command interpreter="perl">p3_misa_parameter.pl $inputfastaFile $misa_outputfile "1-$definition_1 2-$definition_2 3-$definition_3 4-$definition_4 5-$definition_5 6-$definition_6" "$interruptions" </command>
+  <inputs>
+    <param format="fasta" name="inputfastaFile" type="data" label="fasta Source file"/>
+     <param name="definition_1" size="20" type="text" value="10" label="Min Repeats for Unit Size 1"> </param>
+     <param name="definition_2" size="20" type="text" value="6" label="Min Repeats for Unit Size 2"> </param>
+     <param name="definition_3" size="20" type="text" value="5" label="Min Repeats for Unit Size 3"> </param>
+     <param name="definition_4" size="20" type="text" value="5" label="Min Repeats for Unit Size 4"> </param>
+     <param name="definition_5" size="20" type="text" value="5" label="Min Repeats for Unit Size 5"> </param>
+     <param name="definition_6" size="20" type="text" value="5" label="Min Repeats for Unit Size 6"> </param>
+     <param name="interruptions" type="text" area="false" size="5" label="Interruptions:max_difference_between_2_SSRs" value="100" />
+  </inputs>
+  <outputs>
+     <data format="tabular"  name="misa_outputfile" />
+  </outputs>
+<help>
+
+.. class:: infomark
+
+Detect simple sequence repeats using **MISA**  - MIcroSAtellite identification tool
+
+The MISA  script was developed at IPK by Thomas Thiel
+
+http://pgrc.ipk-gatersleben.de/misa/
+
+CITATION
+---------
+
+Exploiting EST databases for the development and characterization of gene-derived SSR-markers in barley (Hordeum vulgare L.)
+
+T. Thiel, W. Michalek, R. Varshney and A. Graner
+
+THEORETICAL AND APPLIED GENETICS Volume 106, Number 3, 411-422
+
+DOI: 10.1007/s00122-002-1031-0
+
+**TIP**
+The primer design tool will work more predictably if fasta header lines are simplied to only include the sequence ID
+
+
+
+</help>
+
+</tool>
diff -r 000000000000 -r 3006582bfc76 MISA/p3_out.pl
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/MISA/p3_out.pl	Wed Sep 14 23:57:57 2011 -0400
@@ -0,0 +1,76 @@
+#!/usr/bin/perl -w
+# Author: Thomas Thiel
+# Program name: prim_output.pl
+# Description: converts the Primer3 output into an table
+
+open (SRC,"<$ARGV[0]") || die ("\nError: Couldn't open Primer3 results file (*.p3out) !\n\n");
+my $filename = $ARGV[0];
+$filename =~ s/\.p3out//;
+open (IN,"<$ARGV[1]") || die ("\nError: Couldn't open source file containing MISA (*.misa) results !\n\n");
+open (OUT,">$ARGV[2]") || die ("nError: Couldn't create file !\n\n");
+
+my ($seq_names_failed,$count_failed,$count);
+print OUT "ID\tSSR nr.\tSSR type\tSSR\tsize\tstart\tend\t";
+print OUT "FORWARD PRIMER1 (5'-3')\tTm(°C)\tsize\tREVERSE PRIMER1 (5'-3')\tTm(°C)\tsize\tPRODUCT1 size (bp)\tstart (bp)\tend (bp)\t";
+print OUT "FORWARD PRIMER2 (5'-3')\tTm(°C)\tsize\tREVERSE PRIMER2 (5'-3')\tTm(°C)\tsize\tPRODUCT2 size (bp)\tstart (bp)\tend (bp)\t";
+print OUT "FORWARD PRIMER3 (5'-3')\tTm(°C)\tsize\tREVERSE PRIMER3 (5'-3')\tTm(°C)\tsize\tPRODUCT3 size (bp)\tstart (bp)\tend (bp)\n";
+
+undef $/;
+my $in = <IN>;
+study $in;
+
+$/ = "=\n";
+
+while (<SRC>)
+  {
+  my ($id,$ssr_nr) = (/PRIMER_SEQUENCE_ID=(\S+)_(\d+)/);
+  
+  $in =~ /($id\t$ssr_nr\t.*)\n/;
+  my $misa = $1;
+  
+  /PRIMER_LEFT_SEQUENCE=(.*)/ || do {$count_failed++;print OUT "$misa\n"; next};
+  my $info = "$1\t";
+  
+  /PRIMER_LEFT_TM=(.*)/; $info .= "$1\t";
+  /PRIMER_LEFT=\d+,(\d+)/; $info .= "$1\t";
+  
+  /PRIMER_RIGHT_SEQUENCE=(.*)/;  $info .= "$1\t";
+  /PRIMER_RIGHT_TM=(.*)/; $info .= "$1\t";
+  /PRIMER_RIGHT=\d+,(\d+)/; $info .= "$1\t";
+  
+  /PRIMER_PRODUCT_SIZE=(.*)/; $info .= "$1\t";
+  /PRIMER_LEFT=(\d+),\d+/; $info .= "$1\t";
+  /PRIMER_RIGHT=(\d+),\d+/; $info .= "$1\t";
+  
+  
+  /PRIMER_LEFT_1_SEQUENCE=(.*)/; $info .= "$1\t";
+  /PRIMER_LEFT_1_TM=(.*)/; $info .= "$1\t";
+  /PRIMER_LEFT_1=\d+,(\d+)/; $info .= "$1\t";
+    
+  /PRIMER_RIGHT_1_SEQUENCE=(.*)/;  $info .= "$1\t";
+  /PRIMER_RIGHT_1_TM=(.*)/; $info .= "$1\t";
+  /PRIMER_RIGHT_1=\d+,(\d+)/; $info .= "$1\t";
+  
+  /PRIMER_PRODUCT_SIZE_1=(.*)/; $info .= "$1\t";
+  /PRIMER_LEFT_1=(\d+),\d+/; $info .= "$1\t";
+  /PRIMER_RIGHT_1=(\d+),\d+/; $info .= "$1\t";
+  
+  
+  /PRIMER_LEFT_2_SEQUENCE=(.*)/; $info .= "$1\t";
+  /PRIMER_LEFT_2_TM=(.*)/; $info .= "$1\t";
+  /PRIMER_LEFT_2=\d+,(\d+)/; $info .= "$1\t";
+    
+  /PRIMER_RIGHT_2_SEQUENCE=(.*)/;  $info .= "$1\t";
+  /PRIMER_RIGHT_2_TM=(.*)/; $info .= "$1\t";
+  /PRIMER_RIGHT_2=\d+,(\d+)/; $info .= "$1\t";
+  
+  /PRIMER_PRODUCT_SIZE_2=(.*)/; $info .= "$1\t";
+  /PRIMER_LEFT_2=(\d+),\d+/; $info .= "$1\t";
+  /PRIMER_RIGHT_2=(\d+),\d+/; $info .= "$1";
+  
+  $count++;
+  print OUT "$misa\t$info\n"
+  };
+
+#print "\nPrimer modelling was successful for $count sequences.\n";
+#print "Primer modelling failed for $count_failed sequences.\n";
diff -r 000000000000 -r 3006582bfc76 MISA/tool_conf_entry_MISA.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/MISA/tool_conf_entry_MISA.xml	Wed Sep 14 23:57:57 2011 -0400
@@ -0,0 +1,5 @@
+<section name="SSR Marker  Design" id="ssr_marker">
+    <tool file="tools/MISA/p3_misa_parameter.xml" />
+    <tool file="tools/MISA/clean_fasta_header.xml" />
+    <tool file="tools/MISA/design_MISA.xml" />
+  </section>