# HG changeset patch # User leomrtns # Date 1557827835 14400 # Node ID ff1cc05e789a5a9ffb16ad3518d976bb493f651e planemo upload diff -r 000000000000 -r ff1cc05e789a nanofilt.xml --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/nanofilt.xml Tue May 14 05:57:15 2019 -0400 @@ -0,0 +1,107 @@ + + Filtering and trimming of long read sequencing data + + nanofilt + + "$output1" + ]]> + + +
+ + + +
+
+ + +
+ + + + + + + + + + + + + + + + + + + + + + + + + + + trimmed-reads.fastq.gz + + + ]]> + + + @misc{githubnanofilt, + title = {nanofilt}, + publisher = {GitHub}, + journal = {GitHub repository}, + url = {https://github.com/wdecoster/nanofilt} + } + @article{10.1093/bioinformatics/bty149, + author = {De Coster, Wouter and D’Hert, Svenn and Schultz, Darrin T and Cruts, Marc and Van Broeckhoven, Christine}, + title = "{NanoPack: visualizing and processing long-read sequencing data}", + journal = {Bioinformatics}, + volume = {34}, + number = {15}, + pages = {2666-2669}, + year = {2018}, + month = {03}, + abstract = "{Here we describe NanoPack, a set of tools developed for visualization and processing of long-read sequencing data from Oxford Nanopore Technologies and Pacific Biosciences.The NanoPack tools are written in Python3 and released under the GNU GPL3.0 License. The source code can be found at https://github.com/wdecoster/nanopack, together with links to separate scripts and their documentation. The scripts are compatible with Linux, Mac OS and the MS Windows 10 subsystem for Linux and are available as a graphical user interface, a web service at http://nanoplot.bioinf.be and command line tools.Supplementary data are available at Bioinformatics online.}", + issn = {1367-4803}, + doi = {10.1093/bioinformatics/bty149}, + url = {https://doi.org/10.1093/bioinformatics/bty149}, + eprint = {http://oup.prod.sis.lan/bioinformatics/article-pdf/34/15/2666/25230836/bty149.pdf}, + } + + + diff -r 000000000000 -r ff1cc05e789a test-data/input.fastq --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/input.fastq Tue May 14 05:57:15 2019 -0400 @@ -0,0 +1,73000 @@ +@NB501061:3:HF573AFXX:1:11101:3103:1113 1:N:0:CGTACTAG+NTAGAGAG +TTCCTATAACTGGTTGACTTGAACCAACAGTTGCTATTAAATTTGCTCGACCATCTGTAACTGTATCAATA ++ +AAAAAEEEEEAEEEEE6EEEEAAEEEEEEAEAEEEEEEEEAEEEEEEEEEEEEEEEAEEEEEEEEEEEAEE +@NB501061:3:HF573AFXX:1:11101:2518:1121 1:N:0:CGTACTAG+NTAGAGAG +GATTTACTTATGGACGATATGGATGGTGTAGAAGCAACTACTGAAATAAAAAAAGATTTACCTCAAATTAAAGTAGTCATGTTAACAAGCTTTATAGAGGATAAAGAAGTTTATCGTGCACTTGATTCTGGAGTAGATAGTTATATTTTAA ++ +AAAAAEEEEEEEEEEEEEEEEEEEEEEEEAA6EEEEEEEEEEEEAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAEAEEAEEEEEAEEEEEEE/EEAEEEEEEEA