# HG changeset patch # User mheinzl # Date 1524661157 14400 # Node ID 9736b9d04a0b07a9093b4b92b127ad4225d86904 planemo upload for repository https://github.com/monikaheinzl/galaxyProject/tree/master/tools/fsd commit f674213e798956531c935e7b9eb7f444286d0a5e-dirty diff -r 000000000000 -r 9736b9d04a0b fsd.py --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fsd.py Wed Apr 25 08:59:17 2018 -0400 @@ -0,0 +1,431 @@ +#!/usr/bin/env python + +# Family size distribution of SSCSs +# +# Author: Monika Heinzl, Johannes-Kepler University Linz (Austria) +# Contact: monika.heinzl@edumail.at +# +# Takes at least one TABULAR file with tags before the alignment to the SSCS, but up to 4 files can be provided, as input. +# The program produces a plot which shows the distribution of family sizes of the all SSCSs from the input files and +# a CSV file with the data of the plot, as well as a TXT file with all tags of the DCS and their family sizes. +# If only one file is provided, then a family size distribution, which is separated after SSCSs without a partner and DCSs, is produced. +# Whereas a family size distribution with multiple data in one plot is produced, when more than one file (up to 4) is given. + +# USAGE: python FSD_Galaxy_1.4_commandLine_FINAL.py filename --inputFile2 filename2 --inputFile3 filename3 --inputFile4 filename4 / +# --title_file outputFileName --sep "characterWhichSeparatesCSVFile" + +import numpy +import matplotlib.pyplot as plt +from matplotlib.backends.backend_pdf import PdfPages +import argparse +import sys +import os +import re +from Cheetah.Template import Template + +def readFileReferenceFree(file): + with open(file, 'r') as dest_f: + data_array = numpy.genfromtxt(dest_f, skip_header=0, delimiter='\t', comments='#', dtype='string') + return(data_array) + +def make_argparser(): + parser = argparse.ArgumentParser(description='Family Size Distribution of duplex sequencing data') + parser.add_argument('inputFile', + help='Tabular File with three columns: ab or ba, tag and family size.') + parser.add_argument('--inputName1') + parser.add_argument('--inputFile2',default=None, + help='Tabular File with three columns: ab or ba, tag and family size.') + parser.add_argument('--inputName2') + parser.add_argument('--inputFile3',default=None, + help='Tabular File with three columns: ab or ba, tag and family size.') + parser.add_argument('--inputName3') + parser.add_argument('--inputFile4',default=None, + help='Tabular File with three columns: ab or ba, tag and family size.') + parser.add_argument('--inputName4') + parser.add_argument('--sep', default=",", + help='Separator in the csv file.') + parser.add_argument('--output_csv', default="data.csv",type=str, + help='Name of the pdf and csv file.') + parser.add_argument('--output_pdf', default="data.pdf",type=str, + help='Name of the pdf and csv file.') + return parser + +def compare_read_families(argv): + parser = make_argparser() + args=parser.parse_args(argv[1:]) + + firstFile = args.inputFile + name1 = args.inputName1 + secondFile = args.inputFile2 + name2 = args.inputName2 + thirdFile = args.inputFile3 + name3 = args.inputName3 + fourthFile = args.inputFile4 + name4 = args.inputName4 + + title_file = args.output_csv + title_file2 = args.output_pdf + sep = args.sep + + if type(sep) is not str or len(sep)>1: + print("Error: --sep must be a single character.") + exit(4) + + plt.rc('figure', figsize=(11.69, 8.27)) # A4 format + plt.rcParams['patch.edgecolor'] = "black" + plt.rcParams['axes.facecolor'] = "E0E0E0" # grey background color + plt.rcParams['xtick.labelsize'] = 12 + plt.rcParams['ytick.labelsize'] = 12 + + list_to_plot = [] + label = [] + data_array_list = [] + + with open(title_file, "w") as output_file, PdfPages(title_file2) as pdf: + fig = plt.figure() + plt.subplots_adjust(bottom=0.25) + if firstFile != str(None): + file1 = readFileReferenceFree(firstFile) + integers = numpy.array(file1[:, 0]).astype(int) ## keep original family sizes + + # for plot: replace all big family sizes by 22 + data1 = numpy.array(file1[:, 0]).astype(int) + bigFamilies = numpy.where(data1 > 20)[0] + data1[bigFamilies] = 22 + + name1 = name1.split(".tabular")[0] + list_to_plot.append(data1) + label.append(name1) + data_array_list.append(file1) + + legend = "\n\n\n{}".format(name1) + plt.text(0.1, 0.11, legend, size=12, transform=plt.gcf().transFigure) + legend1 = "singletons:\nabsolute nr.\n{:,}".format(numpy.bincount(data1)[1]) + plt.text(0.4, 0.11, legend1, size=12, transform=plt.gcf().transFigure) + + legend3 = "rel. freq\n{:.3f}".format(float(numpy.bincount(data1)[1]) / len(data1)) + plt.text(0.5, 0.11, legend3, size=12, transform=plt.gcf().transFigure) + + legend4 = "family size > 20:\nabsolute nr.\n{:,}".format( + numpy.bincount(data1)[len(numpy.bincount(data1)) - 1].astype(int)) + plt.text(0.6, 0.11, legend4, size=12, transform=plt.gcf().transFigure) + + legend5 = "rel. freq\n{:.3f}".format(float(numpy.bincount(data1)[len(numpy.bincount(data1)) - 1]) / len(data1)) + plt.text(0.7, 0.11, legend5, size=12, transform=plt.gcf().transFigure) + + legend6 = "total length\n{:,}".format(len(data1)) + plt.text(0.8, 0.11, legend6, size=12, transform=plt.gcf().transFigure) + + if secondFile != str(None): + file2 = readFileReferenceFree(secondFile) + data2 = numpy.asarray(file2[:, 0]).astype(int) + bigFamilies2 = numpy.where(data2 > 20)[0] + data2[bigFamilies2] = 22 + + list_to_plot.append(data2) + name2 = name2.split(".tabular")[0] + label.append(name2) + data_array_list.append(file2) + + plt.text(0.1, 0.09, name2, size=12, transform=plt.gcf().transFigure) + + legend1 = "{:,}".format(numpy.bincount(data2)[1]) + plt.text(0.4, 0.09, legend1, size=12, transform=plt.gcf().transFigure) + + legend3 = "{:.3f}".format(float(numpy.bincount(data2)[1]) / len(data2)) + plt.text(0.5, 0.09, legend3, size=12, transform=plt.gcf().transFigure) + + legend4 = "{:,}".format(numpy.bincount(data2)[len(numpy.bincount(data2)) - 1].astype(int)) + plt.text(0.6, 0.09, legend4, size=12, transform=plt.gcf().transFigure) + + legend5 = "{:.3f}".format(float(numpy.bincount(data2)[len(numpy.bincount(data2)) - 1]) / len(data2)) + plt.text(0.7, 0.09, legend5, size=12, transform=plt.gcf().transFigure) + + legend6 = "{:,}".format(len(data2)) + plt.text(0.8, 0.09, legend6, size=12, transform=plt.gcf().transFigure) + + if thirdFile != str(None): + file3 = readFileReferenceFree(thirdFile) + + data3 = numpy.asarray(file3[:, 0]).astype(int) + bigFamilies3 = numpy.where(data3 > 20)[0] + data3[bigFamilies3] = 22 + + list_to_plot.append(data3) + name3 = name3.split(".tabular")[0] + label.append(name3) + data_array_list.append(file3) + + plt.text(0.1, 0.07, name3, size=12, transform=plt.gcf().transFigure) + + legend1 = "{:,}".format(numpy.bincount(data3)[1]) + plt.text(0.4, 0.07, legend1, size=12, transform=plt.gcf().transFigure) + + legend3 = "{:.3f}".format(float(numpy.bincount(data3)[1]) / len(data3)) + plt.text(0.5, 0.07, legend3, size=12, transform=plt.gcf().transFigure) + + legend4 = "{:,}".format(numpy.bincount(data3)[len(numpy.bincount(data3)) - 1].astype(int)) + plt.text(0.6, 0.07, legend4, size=12, transform=plt.gcf().transFigure) + + legend5 = "{:.3f}".format(float(numpy.bincount(data3)[len(numpy.bincount(data3)) - 1]) / len(data3)) + plt.text(0.7, 0.07, legend5, size=12, transform=plt.gcf().transFigure) + + legend6 = "{:,}".format(len(data3)) + plt.text(0.8, 0.07, legend6, size=12, transform=plt.gcf().transFigure) + + if fourthFile != str(None): + file4 = readFileReferenceFree(fourthFile) + + data4 = numpy.asarray(file4[:, 0]).astype(int) + bigFamilies4 = numpy.where(data4 > 20)[0] + data4[bigFamilies4] = 22 + + list_to_plot.append(data4) + name4 = name4.split(".tabular")[0] + label.append(name4) + data_array_list.append(file4) + + plt.text(0.1, 0.05, name4, size=12, transform=plt.gcf().transFigure) + + legend1 = "{:,}".format(numpy.bincount(data4)[1]) + plt.text(0.4, 0.05, legend1, size=12, transform=plt.gcf().transFigure) + + legend4 = "{:.3f}".format(float(numpy.bincount(data4)[1]) / len(data4)) + plt.text(0.5, 0.05, legend4, size=12, transform=plt.gcf().transFigure) + + legend4 = "{:,}".format(numpy.bincount(data4)[len(numpy.bincount(data4)) - 1].astype(int)) + plt.text(0.6, 0.05, legend4, size=12, transform=plt.gcf().transFigure) + + legend5 = "{:.3f}".format(float(numpy.bincount(data4)[len(numpy.bincount(data4)) - 1]) / len(data4)) + plt.text(0.7, 0.05, legend5, size=12, transform=plt.gcf().transFigure) + + legend6 = "{:,}".format(len(data4)) + plt.text(0.8, 0.05, legend6, size=12, transform=plt.gcf().transFigure) + + maximumX = numpy.amax(numpy.concatenate(list_to_plot)) + minimumX = numpy.amin(numpy.concatenate(list_to_plot)) + + counts = plt.hist(list_to_plot, bins=range(minimumX, maximumX + 1), stacked=False, edgecolor="black", + linewidth=1, label=label, align="left", alpha=0.7, rwidth=0.8) + + ticks = numpy.arange(minimumX - 1, maximumX, 1) + ticks1 = map(str, ticks) + ticks1[len(ticks1) - 1] = ">20" + plt.xticks(numpy.array(ticks), ticks1) + + plt.legend(loc='upper right', fontsize=14, frameon=True, bbox_to_anchor=(0.9, 1)) + plt.title("Family Size Distribution", fontsize=14) + plt.xlabel("No. of Family Members", fontsize=14) + plt.ylabel("Absolute Frequency", fontsize=14) + plt.margins(0.01, None) + plt.grid(b=True, which="major", color="#424242", linestyle=":") + pdf.savefig(fig) + plt.close() + + # write data to CSV file + output_file.write("Values from family size distribution with all datasets\n") + output_file.write("\nFamily size") + for i in label: + output_file.write("{}{}".format(sep, i)) + output_file.write("{}sum".format(sep)) + output_file.write("\n") + j = 0 + for fs in counts[1][0:len(counts[1]) - 1]: + if fs == 21: + fs = ">20" + else: + fs = "={}".format(fs) + output_file.write("FS{}{}".format(fs, sep)) + values_of_fs = [] + if len(label) == 1: + output_file.write("{}{}".format(int(counts[0][j]), sep)) + values_of_fs.append(int(counts[0][j])) + else: + for n in range(len(label)): + output_file.write("{}{}".format(int(counts[0][n][j]), sep)) + values_of_fs.append(int(counts[0][n][j])) + output_file.write("{}\n".format(sum(values_of_fs))) + j += 1 + output_file.write("sum{}".format(sep)) + values_for_sum = [] + if len(label) == 1: + output_file.write("{}{}".format(int(sum(counts[0])), sep)) + values_for_sum.append(int(sum(counts[0]))) + else: + for i in counts[0]: + output_file.write("{}{}".format(int(sum(i)), sep)) + values_for_sum.append(int(sum(i))) + + output_file.write("{}\n".format(sum(values_for_sum))) + +### Family size distribution after DCS and SSCS + for dataset, data, name_file in zip(list_to_plot, data_array_list, label): + maximumX = numpy.amax(dataset) + minimumX = numpy.amin(dataset) + + tags = numpy.array(data[:, 2]) + seq = numpy.array(data[:, 1]) + data = numpy.array(dataset) + + # find all unique tags and get the indices for ALL tags, but only once + u, index_unique, c = numpy.unique(numpy.array(seq), return_counts=True, return_index=True) + d = u[c > 1] + + # get family sizes, tag for duplicates + duplTags_double = data[numpy.in1d(seq, d)] + duplTags = duplTags_double[0::2] # ab of DCS + duplTagsBA = duplTags_double[1::2] # ba of DCS + + duplTags_double_tag = tags[numpy.in1d(seq, d)] + duplTags_double_seq = seq[numpy.in1d(seq, d)] + + # get family sizes for SSCS with no partner + ab = numpy.where(tags == "ab")[0] + abSeq = seq[ab] + ab = data[ab] + ba = numpy.where(tags == "ba")[0] + baSeq = seq[ba] + ba = data[ba] + + dataAB = ab[numpy.in1d(abSeq, d, invert=True)] + dataBA = ba[numpy.in1d(baSeq, d, invert=True)] + + # write DCS tags to file + # with open("DCS information_{}.txt".format(firstFile), "w") as file: + # for t, s, f in zip(duplTags_double_tag, duplTags_double_seq, duplTags_double): + # file.write("{}\t{}\t{}\n".format(t, s, f)) + + list1 = [duplTags_double, dataAB, dataBA] # list for plotting + + ## information for family size >= 3 + dataAB_FS3 = dataAB[dataAB >= 3] + dataBA_FS3 = dataBA[dataBA >= 3] + ab_FS3 = ab[ab >= 3] + ba_FS3 = ba[ba >= 3] + + duplTags_FS3 = duplTags[(duplTags >= 3) & (duplTagsBA >= 3)] # ab+ba with FS>=3 + duplTags_FS3_BA = duplTagsBA[(duplTags >= 3) & (duplTagsBA >= 3)] # ba+ab with FS>=3 + duplTags_double_FS3 = len(duplTags_FS3)+len(duplTags_FS3_BA) # both ab and ba strands with FS>=3 + + fig = plt.figure() + + plt.subplots_adjust(bottom=0.3) + counts = plt.hist(list1, bins=range(minimumX, maximumX + 1), stacked=True, + label=["duplex", "ab", "ba"], edgecolor="black", linewidth=1, + align="left", color=["#FF0000", "#5FB404", "#FFBF00"]) + # tick labels of x axis + ticks = numpy.arange(minimumX - 1, maximumX, 1) + ticks1 = map(str, ticks) + ticks1[len(ticks1) - 1] = ">20" + plt.xticks(numpy.array(ticks), ticks1) + singl = counts[0][2][0] # singletons + last = counts[0][2][len(counts[0][0]) - 1] # large families + + plt.legend(loc='upper right', fontsize=14, bbox_to_anchor=(0.9, 1), frameon=True) + plt.title(name1, fontsize=14) + plt.xlabel("No. of Family Members", fontsize=14) + plt.ylabel("Absolute Frequency", fontsize=14) + plt.margins(0.01, None) + plt.grid(b=True, which="major", color="#424242", linestyle=":") + + ## extra information beneath the plot + legend = "SSCS ab= \nSSCS ba= \nDCS (total)= \nlength of dataset=" + plt.text(0.1, 0.09, legend, size=12, transform=plt.gcf().transFigure) + + legend = "absolute numbers\n\n{:,}\n{:,}\n{:,} ({:,})\n{:,}" \ + .format(len(dataAB), len(dataBA), len(duplTags), len(duplTags_double), + (len(dataAB) + len(dataBA) + len(duplTags))) + plt.text(0.35, 0.09, legend, size=12, transform=plt.gcf().transFigure) + + legend = "relative frequencies\nunique\n{:.3f}\n{:.3f}\n{:.3f}\n{:,}" \ + .format(float(len(dataAB)) / (len(dataAB) + len(dataBA) + len(duplTags)), + float(len(dataBA)) / (len(dataAB) + len(dataBA) + len(duplTags)), + float(len(duplTags)) / (len(dataAB) + len(dataBA) + len(duplTags)), + (len(dataAB) + len(dataBA) + len(duplTags))) + plt.text(0.54, 0.09, legend, size=12, transform=plt.gcf().transFigure) + + legend = "total\n{:.3f}\n{:.3f}\n{:.3f} ({:.3f})\n{:,}" \ + .format(float(len(dataAB)) / (len(ab) + len(ba)), float(len(dataBA)) / (len(ab) + len(ba)), + float(len(duplTags)) / (len(ab) + len(ba)), + float(len(duplTags_double)) / (len(ab) + len(ba)), (len(ab) + len(ba))) + plt.text(0.64, 0.09, legend, size=12, transform=plt.gcf().transFigure) + + legend1 = "\nsingletons:\nfamily size > 20:" + plt.text(0.1, 0.03, legend1, size=12, transform=plt.gcf().transFigure) + + legend4 = "{:,}\n{:,}".format(singl.astype(int), last.astype(int)) + plt.text(0.35, 0.03, legend4, size=12, transform=plt.gcf().transFigure) + + legend3 = "{:.3f}\n{:.3f}".format(singl / len(data),last / len(data)) + plt.text(0.54, 0.03, legend3, size=12, transform=plt.gcf().transFigure) + + pdf.savefig(fig) + plt.close() + + # write same information to a csv file + count = numpy.bincount(integers) # original counts of family sizes + output_file.write("\nDataset:{}{}\n".format(sep, name_file)) + output_file.write("max. family size:{}{}\n".format(sep, max(integers))) + output_file.write("absolute frequency:{}{}\n".format(sep, count[len(count) - 1])) + output_file.write("relative frequency:{}{:.3f}\n\n".format(sep, float(count[len(count) - 1]) / sum(count))) + + output_file.write("{}singletons:{}{}family size > 20:\n".format(sep, sep, sep)) + output_file.write( + "{}absolute nr.{}rel. freq{}absolute nr.{}rel. freq{}total length\n".format(sep, sep, sep, sep, sep)) + output_file.write("{}{}{}{}{:.3f}{}{}{}{:.3f}{}{}\n\n".format(name_file, sep, singl.astype(int), sep, + singl / len(data), sep,last.astype(int), sep, + last / len(data), sep, len(data))) + + ## information for FS >= 1 + output_file.write( + "The unique frequencies were calculated from the dataset where the tags occured only once (=ab without DCS, ba without DCS)\n" \ + "Whereas the total frequencies were calculated from the whole dataset (=including the DCS).\n\n") + output_file.write("FS >= 1{}{}unique:{}total:\n".format(sep, sep, sep)) + output_file.write("nr./rel. freq of ab={}{}{}{:.3f}{}{:.3f}\n".format(sep, len(dataAB), sep, + float(len(dataAB)) / (len(dataAB) + len(dataBA) + len( duplTags)), sep, + float(len(dataAB)) / (len(ab) + len(ba)))) + output_file.write("nr./rel. freq of ba={}{}{}{:.3f}{}{:.3f}\n".format(sep, len(dataBA), sep, + float(len(dataBA)) / (len(dataBA) + len(dataBA) + len(duplTags)), sep, + float(len(dataBA)) / (len(ba) + len(ba)))) + output_file.write( + "nr./rel. freq of DCS (total)={}{} ({}){}{:.3f}{}{:.3f} ({:.3f})\n".format(sep, len(duplTags), len(duplTags_double), sep, + float(len(duplTags)) / ( len(dataAB) + len( dataBA) + len(duplTags)), + sep, float(len(duplTags)) / ( len(ab) + len(ba)), + float( len(duplTags_double)) / (len(ab) + len(ba)))) + output_file.write( + "length of dataset={}{}{}{}{}{}\n".format(sep, (len(dataAB) + len(dataBA) + len(duplTags)), sep, + (len(dataAB) + len(dataBA) + len(duplTags)), sep,(len(ab) + len(ba)))) + ## information for FS >= 3 + output_file.write("FS >= 3{}{}unique:{}total:\n".format(sep, sep, sep)) + output_file.write("nr./rel. freq of ab={}{}{}{:.3f}{}{:.3f}\n".format(sep, len(dataAB_FS3), sep, + float(len(dataAB_FS3)) / (len(dataAB_FS3) + len(dataBA_FS3) + len(duplTags_FS3)), + sep, float(len(dataAB_FS3)) / ( len(ab_FS3) + len(ba_FS3)))) + output_file.write("nr./rel. freq of ba={}{}{}{:.3f}{}{:.3f}\n".format(sep, len(dataBA_FS3), sep, + float(len(dataBA_FS3)) / ( len(dataBA_FS3) + len(dataBA_FS3) + len(duplTags_FS3)), + sep,float(len(dataBA_FS3)) / (len(ba_FS3) + len(ba_FS3)))) + output_file.write( + "nr./rel. freq of DCS (total)={}{} ({}){}{:.3f}{}{:.3f} ({:.3f})\n".format(sep, len(duplTags_FS3),duplTags_double_FS3, + sep, float(len( duplTags_FS3)) / (len(dataBA_FS3) + len(duplTags_FS3)), + sep, float(len(duplTags_FS3)) / (len(ab_FS3) + len(ba_FS3)), + float(duplTags_double_FS3) / (len(ab_FS3) + len(ba_FS3)))) + output_file.write( + "length of dataset={}{}{}{}{}{}\n".format(sep, (len(dataAB_FS3) + len(dataBA_FS3) + len(duplTags_FS3)), sep, + (len(dataAB_FS3) + len(dataBA_FS3) + len(duplTags_FS3)), sep, + (len(ab_FS3) + len(ba_FS3)))) + + output_file.write("\nValues from family size distribution\n") + output_file.write("{}duplex{}ab{}ba{}sum\n".format(sep, sep, sep, sep)) + for dx, ab, ba, fs in zip(counts[0][0], counts[0][1], counts[0][2], counts[1]): + if fs == 21: + fs = ">20" + else: + fs = "={}".format(fs) + ab1 = ab - dx + ba1 = ba - ab + output_file.write( + "FS{}{}{}{}{}{}{}{}{}\n".format(fs, sep, int(dx), sep, int(ab1), sep, int(ba1), sep, int(ba))) + + print("Files successfully created!") + +if __name__ == '__main__': + sys.exit(compare_read_families(sys.argv)) diff -r 000000000000 -r 9736b9d04a0b fsd.xml --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fsd.xml Wed Apr 25 08:59:17 2018 -0400 @@ -0,0 +1,83 @@ + + + Family size distribution of tags + + matplotlib + + + + python FSD.py $file1 --inputName1 $file1.name --inputFile2 $file2 --inputName2 $file2.name --inputFile3 $file3 --inputName3 $file3.name --inputFile4 $file4 --inputName4 $file4.name --sep $separator --output_csv $output_csv --output_pdf $output_pdf + + + + + + + + + + + + + + + + + + + @misc{duplex, + author = {Heinzl, Monika}, + year = {2018}, + title = {Duplex analysis} + } + + + diff -r 000000000000 -r 9736b9d04a0b test-data/Test_data.tabular --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/Test_data.tabular Wed Apr 25 08:59:17 2018 -0400 @@ -0,0 +1,112 @@ +1 AAAAAAAAAAAAAACCAAAACTTC ba +1 AAAAAAAAAAAAACCAGGCGTCGA ba +1 AAAAAAAAAAAAAGCTCCACGTTG ba +1 AAAAAAAAAAAAATCGTGGTTTGT ba +1 AAAAAAAAAAAAATTCACCCTTGT ba +7 AAAAAAAAAAAACACACTTAACTT ba +1 AAAAAAAAAAAACAGTGTTGAGAC ba +4 AAAAAAAAAAAACCGCTCCTCACA ba +1 AAAAAAAAAAAAGGCAACACAGAA ab +2 AAAAAAAAAAAATCTTTCTTTGAG ab +1 AAAAAAAAAAAATTGGGTTCCTTA ab +1 AAAAAAAAAAAGAGTCGCACCCAG ba +4 AAAAAAAAAAAGATCGTGGTTTGT ba +1 AAAAAAAAAAAGCGCAACACAGAA ab +3 AAAAAAAAAAAGGGCAACACAGAA ab +1 AAAAAAAAAAAGTAGCCCTAAACG ab +1 AAAAAAAAAAAGTCTTTCTTTGAG ab +1 AAAAAAAAAAATATCATAGACTCT ab +6 AAAAAAAAAAATATTCACCCTTGT ba +1 AAAAAAAAAAATATTCGAAAGTTA ba +3 AAAAAAAAAAATCACACTTAACTT ba +1 AAAAAAAAAAATCCGCTCCTCACA ba +1 AAAAAAAAAAATTAACTAAACTTA ab +1 AAAAAAAAAACAAATTCTATTATT ab +1 AAAAAAAAAACTCCCAGATTTTTT ab +1 AAAAAAAAAACTTCTGCTTGGCGG ba +11 AAAAAAAAAAGAATCGTGGTTTGT ba +5 AAAAAAAAAAGATAGCCCTAAACG ab +1 AAAAAAAAAAGCAATAATGCCAGT ab +2 AAAAAAAAAAGTACCGCACTCTCA ba +1 AAAAAAAAAAGTTCTTTCTTTGAG ab +1 AAAAAAAAAATAACTTCAATAATG ba +2 AAAAAAAAAATAATCATAGACTCT ab +1 AAAAAAAAAATAGTCTCACATTTA ab +1 AAAAAAAAAATATAACCTTTGGCG ab +3 AAAAAAAAACAAAATTCTATTATT ab +1 AAAAAAAAACAAGTACGCGGCATT ab +1 AAAAAAAAACAAGTACGCGGTATT ab +1 AAAAAAAAACAATATCGAATTAAC ab +3 AAAAAAAAACACGGTGAGACAAGG ba +1 AAAAAAAAACACGTTTCTCCCCTT ba +1 AAAAAAAAACATATCGTCCCGAGC ba +1 AAAAAAAAACCTACCTGAGGCCCC ab +3 AAAAAAAAACCTTATTACAGCGGA ab +1 AAAAAAAAACGATTCTCTGTATCT ba +1 AAAAAAAAACGTACCGCACTCTCA ba +4 AAAAAAAAACTACCCAGATTTTTT ba +1 AAAAAAAAACTAGATGAGACGACC ba +4 AAAAAAAAACTGTCTGCTTGGCGG ba +1 AAAAAAAAAGAAGTTTAATTTTAA ab +1 AAAAAAAAAGAATGCCTAAGACGA ba +6 AAAAAAAAAGACCGGCCTTAGACA ba +1 AAAAAAAAAGATATCGTGGTTTGT ba +1 AAAAAAAAAGCAATACTCAAGCTG ba +6 AAAAAAAAAGCAATGTCTAAGCCT ba +1 AAAAAAAAAGCACTGTCTAAGCCT ab +2 AAAAAAAAAGCTAATAATGCCAGT ab +1 AAAAAAAAAGTTTCGTGAAGGTCC ba +1 AAAAAAAAATAAAGGTCCGAATCT ab +1 AAAAAAAAATAAATGAGAGTGTAA ba +8 AAAAAAAAATAAGTCTCACATTTA ab +1 AAAAAAAAATAATAACCTCTGGCG ab +10 AAAAAAAAATAATAACCTTTGGCG ab +1 AAAAAAAAATAATCCCCTTTGTCG ab +6 AAAAAAAAATACGCAAACGCTGAG ab +4 AAAAAAAAATAGATCATAGACTCT ab +10 AAAAAAAAATAGATCATAGACTCT ba +10 AAAAAAAAATAGTAGGATTTCATG ba +7 AAAAAAAAATATGAATACCCTCGT ba +1 AAAAAAAAATATGCCACTTGATCC ba +1 AAAAAAAAATATTCTGCCACTTGA ba +3 AAAAAAAAATCAAACCAAGAGGAC ba +1 AAAAAAAAATCAGTACCCCTAAAC ab +12 AAAAAAAAATCCTAGTTAATGAAG ba +1 AAAAAAAAATCGATTCTTTATGCG ab +1 AAAAAAAAATGTCTGAAAATATCT ab +4 AAAAAAAAATGTCTGAAAATATCT ba +1 AAAAAAAAATTTCCGCAGACCGTT ba +8 AAAAAAAAATTTGGGCTACTACAA ba +1 AAAAAAAACAAAATTAGAACCCTT ab +1 AAAAAAAACAAACCGCTCCTCACA ba +5 AAAAAAAACAACGTACGCGGTATT ab +4 AAAAAAAACAATATCGTTGATATG ba +4 AAAAAAAACAATCACGTTAATAGG ab +1 AAAAAAAACAGAATCGTGGTTTGT ba +1 AAAAAAAACCAAATCGTTGATATG ba +9 AAAAAAAACCAAGTCCAGGCATCT ba +2 AAAAAAAACCACGGTGAGACAAGG ba +1 AAAAAAAACCGCCCAACTGCCGGT ab +5 AAAAAAAACCTCTCAACCCCAAAT ba +7 AAAAAAAACCTCTTGCGATGTTGT ab +1 AAAAAAAACCTCTTGCGCTGTTGT ab +1 AAAAAAAACCTCTTGTGATGTTGT ab +12 AAAAAAAACCTGAGCAATGGTTCC ab +3 AAAAAAAACCTTGACCCTCACATG ba +6 AAAAAAAACCTTGCACTCGTCCTA ba +9 AAAAAAAACGAAATAAAAAAACCT ba +1 AAAAAAAACGACCGGCCTTAGACA ba +4 AAAAAAAACGCCACCACCCCCTTT ab +12 AAAAAAAACGCCACGGGCACTATT ba +13 AAAAAAAACGTATCAGTAGATCCT ab +1 AAAAAAAACTAGTAGGATTTCATG ba +3 AAAAAAAACTATAGAAAATCCATT ba +1 AAAAAAAACTATTCTATTTCCGAT ba +13 AAAAAAAACTGATCTGCTTGGCGG ba +8 AAAAAAAACTTGCGAATAGCATCG ba +4 AAAAAAAACTTGTTATCAAAACGT ab +1 AAAAAAAAGAAAAGTTCAACACGC ba +1 AAAAAAAAGAAGTTCGCCCTCCGA ab +13 AAAAAAAAGAGAGTTTAGTCATGG ab +1 AAAAAAAAGAGAGTTTAGTCATGG ba +1 AAAAAAAAGAGAGTTTAGTCCTGG ab \ No newline at end of file diff -r 000000000000 -r 9736b9d04a0b test-data/output_file.csv --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/output_file.csv Wed Apr 25 08:59:17 2018 -0400 @@ -0,0 +1,54 @@ +Values from family size distribution with all datasets + +Family size,Test_data,sum +FS=1,63,63 +FS=2,5,5 +FS=3,8,8 +FS=4,10,10 +FS=5,3,3 +FS=6,5,5 +FS=7,3,3 +FS=8,3,3 +FS=9,2,2 +FS=10,3,3 +FS=11,1,1 +FS=12,6,6 +sum,112,112 + +Dataset:,Test_data +max. family size:,13 +absolute frequency:,3 +relative frequency:,0.027 + +,singletons:,,family size > 20: +,absolute nr.,rel. freq,absolute nr.,rel. freq,total length +Test_data,63,0.562,6,0.054,112 + +The unique frequencies were calculated from the dataset where the tags occured only once (=ab without DCS, ba without DCS) +Whereas the total frequencies were calculated from the whole dataset (=including the DCS). + +FS >= 1,,unique:,total: +nr./rel. freq of ab=,47,0.431,0.420 +nr./rel. freq of ba=,59,0.488,0.476 +nr./rel. freq of DCS (total)=,3 (6),0.028,0.027 (0.054) +length of dataset=,109,109,112 +FS >= 3,,unique:,total: +nr./rel. freq of ab=,14,0.341,0.318 +nr./rel. freq of ba=,26,0.491,0.464 +nr./rel. freq of DCS (total)=,1 (2),0.037,0.023 (0.045) +length of dataset=,41,41,44 + +Values from family size distribution +,duplex,ab,ba,sum +FS=1,2,30,31,63 +FS=2,0,3,2,5 +FS=3,0,3,5,8 +FS=4,2,3,5,10 +FS=5,0,2,1,3 +FS=6,0,1,4,5 +FS=7,0,1,2,3 +FS=8,0,1,2,3 +FS=9,0,0,2,2 +FS=10,1,1,1,3 +FS=11,0,0,1,1 +FS=12,1,2,3,6 diff -r 000000000000 -r 9736b9d04a0b test-data/output_file.pdf Binary file test-data/output_file.pdf has changed