Mercurial > repos > mheinzl > fsd_bvsa
comparison fsd_beforevsafter.xml @ 9:e486f84adbec draft
planemo upload for repository https://github.com/monikaheinzl/duplexanalysis_galaxy/tree/master/tools/fsd_beforevsafter commit 31f11c1cb3303d741ee11a25903c3cc42a23f30d
author | mheinzl |
---|---|
date | Mon, 26 Nov 2018 04:26:20 -0500 |
parents | 238a71241876 |
children | e80557c091e9 |
comparison
equal
deleted
inserted
replaced
8:238a71241876 | 9:e486f84adbec |
---|---|
1 <?xml version="1.0" encoding="UTF-8"?> | 1 <?xml version="1.0" encoding="UTF-8"?> |
2 <tool id="fsd_beforevsafter" name="FSD Before/After" version="1.0.0"> | 2 <tool id="fsd_beforevsafter" name="FSD Before/After" version="1.0.0"> |
3 <description>: Family Size Distribution of duplex sequecning tags during DuNovo analysis</description> | 3 <description>: Family Size Distribution of duplex sequecning tags during DuNovo analysis</description> |
4 <macros> | |
5 <import>fsd_reg_macros.xml</import> | |
6 </macros> | |
4 <requirements> | 7 <requirements> |
5 <!-- galaxy version 16.04 --> | 8 <!-- galaxy version 16.04 --> |
6 <requirement type="package" version="2.7">python</requirement> | 9 <requirement type="package" version="2.7">python</requirement> |
7 <requirement type="package" version="1.4">matplotlib</requirement> | 10 <requirement type="package" version="1.4">matplotlib</requirement> |
8 <requirement type="package" version="1.71">biopython</requirement> | 11 <requirement type="package" version="1.71">biopython</requirement> |
9 </requirements> | 12 </requirements> |
10 <command> | 13 <command> |
11 python2 '$__tool_directory__/fsd_beforevsafter.py' --inputFile_SSCS '$file1' --inputName1 '$file1.name' --makeDCS '$makeDCS' --afterTrimming '$afterTrimming' --alignedTags '$alignedTags' --output_pdf $output_pdf --output_tabular $output_tabular | 14 python2 '$__tool_directory__/fsd_beforevsafter.py' --inputFile_SSCS '$file1' --inputName1 '$file1.name' --makeDCS '$makeDCS' --afterTrimming '$afterTrimming' --bamFile '$bamFile' --output_pdf $output_pdf --output_tabular $output_tabular |
12 </command> | 15 </command> |
13 <inputs> | 16 <inputs> |
14 <param name="file1" type="data" format="tabular" label="Dataset 1: input tags of whole dataset" optional="false" help="Input in tabular format with the family size, tags and the direction of the strand ('ab' or 'ba') for each family."/> | 17 <param name="file1" type="data" format="tabular" label="Dataset 1: input tags of whole dataset" optional="false" help="Input in tabular format with the family size, tags and the direction of the strand ('ab' or 'ba') for each family."/> |
15 <param name="makeDCS" type="data" format="fasta" label="Dataset 2: tags after making DCSs" help="Input in fasta format with the tags of the reads, which were aligned to DCSs, and their family sizes of both strands (reverse and forward) in the header, as well as the read itself in the next line."/> | 18 <param name="makeDCS" type="data" format="fasta" label="Dataset 2: tags after making DCSs" help="Input in fasta format with the tags of the reads, which were aligned to DCSs, and their family sizes of both strands (reverse and forward) in the header, as well as the read itself in the next line."/> |
16 <param name="afterTrimming" type="data" format="fasta" optional="true" label="Dataset 3: tags after trimming" help="Input in fasta format with the tags of the reads, which were not filtered out after trimming, and their family sizes of both strands (reverse and forward) in the header, as well as the read itself in the next following line."/> | 19 <param name="afterTrimming" type="data" format="fasta" optional="true" label="Dataset 3: tags after trimming" help="Input in fasta format with the tags of the reads, which were not filtered out after trimming, and their family sizes of both strands (reverse and forward) in the header, as well as the read itself in the next following line."/> |
17 <param name="alignedTags" type="data" format="txt" optional="true" label="Dataset 4: input tags aligned to the reference genome" help="Input in txt format with the regions of the reference genome and the tags, which were aligned to the reference genome."/> | 20 <param name="bamFile" type="data" format="bam" optional="true" label="Dataset 4: input tags aligned to the reference genome" help="Input in BAM format with the reads that were aligned to the reference genome."/> |
18 </inputs> | 21 </inputs> |
19 <outputs> | 22 <outputs> |
20 <data name="output_pdf" format="pdf" /> | 23 <data name="output_pdf" format="pdf" /> |
21 <data name="output_tabular" format="tabular"/> | 24 <data name="output_tabular" format="tabular"/> |
22 </outputs> | 25 </outputs> |
23 <tests> | 26 <tests> |
24 <test> | 27 <test> |
25 <param name="file1" value="Test_data.tabular"/> | 28 <param name="file1" value="fsd_ba_data.tab"/> |
26 <param name="makeDCS" value="Test_data_DCS.fasta"/> | 29 <param name="makeDCS" value="fsd_ba_DCS.fna"/> |
27 <param name="afterTrimming" value="Test_data_trimming.fasta"/> | 30 <param name="afterTrimming" value="fsd_ba_trimmed.fna"/> |
28 <param name="alignedTags" value="Test_data_regions.txt"/> | 31 <param name="bamFile" value="fsd_ba.bam"/> |
29 <output name="output_pdf" file="output_file.pdf" lines_diff="183"/> | 32 <output name="output_pdf" file="fsd_ba_output.pdf" lines_diff="183"/> |
30 <output name="output_tabular" file="output_file.tabular"/> | 33 <output name="output_tabular" file="fsd_ba_output.tab"/> |
31 </test> | 34 </test> |
32 </tests> | 35 </tests> |
33 <help><![CDATA[ | 36 <help><![CDATA[ |
34 | 37 |
35 **What it does** | 38 **What it does** |
54 >AAAAAAAAATAGATCATAGACTCT 7-10 | 57 >AAAAAAAAATAGATCATAGACTCT 7-10 |
55 CTAGACTCACTGGCGTTACTGACTGCGAGACCCTCCACGTG | 58 CTAGACTCACTGGCGTTACTGACTGCGAGACCCTCCACGTG |
56 >AAAAAAAAGGCAGAAGATATACGC 11-3 | 59 >AAAAAAAAGGCAGAAGATATACGC 11-3 |
57 CNCNGGCCCCCCGCTCCGTGCACAGACGNNGCNACTGACAA | 60 CNCNGGCCCCCCGCTCCGTGCACAGACGNNGCNACTGACAA |
58 | 61 |
59 **Dataset 4 (optional):** Finally, a TXT file with the regions and all tags that were aligned to the reference genome can be given as input. This file can be obtained by the tool "Duplex Sequencing Analysis: range2tag":: | 62 **Dataset 4 (optional):** BAM file of the aligned reads. This file can be obtained by the tool "Map with BWA-MEM". |
60 | |
61 87_636 AAATCAAAGTATGAATGAAGTTGCCT | |
62 87_636 AAATTCATAGCATTAATTTCAACGGG | |
63 656_1143 GGGGCAGCCATATTGGCAATTATCAT | |
64 | 63 |
65 **Output** | 64 **Output** |
66 | 65 |
67 The output is a PDF file with the plot and a tabular file with the data of the plot. | 66 The output is a PDF file with the plot and a tabular file with the data of the plot. |
68 | 67 |
69 **About Author** | 68 @author@ |
70 | |
71 Author: Monika Heinzl | |
72 Department: Institute of Bioinformatics, Johannes Kepler University Linz, Austria | |
73 Contact: monika.heinzl@edumail.at | |
74 | 69 |
75 ]]> | 70 ]]> |
76 | |
77 </help> | 71 </help> |
78 <citations> | 72 <expand macro="@citation@" /> |
79 <citation type="bibtex"> | |
80 @misc{duplex, | |
81 author = {Heinzl, Monika}, | |
82 year = {2018}, | |
83 title = {Development of algorithms for the analysis of duplex sequencing data} | |
84 } | |
85 </citation> | |
86 </citations> | |
87 </tool> | 73 </tool> |