# HG changeset patch
# User mheinzl
# Date 1526408501 14400
# Node ID 2631864873d759c194879ef2f7b45ca5922203d5
# Parent  9ce2b4089c1ba81fa6967167713d8ec850aec293
planemo upload for repository https://github.com/monikaheinzl/galaxyProject/tree/master/tools/fsd_regions commit 29bc65d5627553741c83ce1f298223e2b266f7c8

diff -r 9ce2b4089c1b -r 2631864873d7 fsd_regions.py
--- a/fsd_regions.py	Tue May 15 13:50:29 2018 -0400
+++ b/fsd_regions.py	Tue May 15 14:21:41 2018 -0400
@@ -31,10 +31,10 @@
     parser.add_argument('--inputName1')
     parser.add_argument('--ref_genome',
                         help='TXT File with tags of reads that overlap the region.')
+    parser.add_argument('--output_pdf', default="data.pdf", type=str,
+                       help='Name of the pdf and csv file.')
     parser.add_argument('--output_csv', default="data.csv", type=str,
                         help='Name of the pdf and csv file.')
-    parser.add_argument('--output_pdf', default="data.pdf", type=str,
-                        help='Name of the pdf and csv file.')
     parser.add_argument('--sep', default=",",
                         help='Separator in the csv file.')
     return parser
diff -r 9ce2b4089c1b -r 2631864873d7 fsd_regions.xml
--- a/fsd_regions.xml	Tue May 15 13:50:29 2018 -0400
+++ b/fsd_regions.xml	Tue May 15 14:21:41 2018 -0400
@@ -1,5 +1,5 @@
 <?xml version="1.0" encoding="UTF-8"?>
-<tool id="fsd_regions" name="Duplex Sequencing Analysis:" version="0.0.2">
+<tool id="fsd_regions" name="Duplex Sequencing Analysis:" version="0.0.3">
     <requirements>
         <requirement type="package" version="2.7">python</requirement>
         <requirement type="package" version="1.4">matplotlib</requirement>
@@ -37,7 +37,7 @@
     +-----+----------------------------+----+
     
     
-	In addition, a TXT file with the regions and all tags that were aligned to the reference genome is required. 	This file can obtained from a different tool.
+    In addition, a TXT file with the regions and all tags that were aligned to the reference genome is required.      This file can obtained from a different tool.
     
     +-----------+------------------------------+
     | 87_636    | AAATCAAAGTATGAATGAAGTTGCCT   |