# HG changeset patch
# User mheinzl
# Date 1526406629 14400
# Node ID 9ce2b4089c1ba81fa6967167713d8ec850aec293
# Parent  b82fdb0063043d19ca09e8f666ca4c3f9e4d332c
planemo upload for repository https://github.com/monikaheinzl/galaxyProject/tree/master/tools/fsd_regions commit b9403b3ce2b7a41fa8ee1aa47909152de78cf641

diff -r b82fdb006304 -r 9ce2b4089c1b fsd_regions.py
--- a/fsd_regions.py	Thu May 10 07:28:39 2018 -0400
+++ b/fsd_regions.py	Tue May 15 13:50:29 2018 -0400
@@ -108,8 +108,8 @@
         ### PLOT ###
         plt.rc('figure', figsize=(11.69, 8.27))  # A4 format
         plt.rcParams['axes.facecolor'] = "E0E0E0"  # grey background color
-        plt.rcParams['xtick.labelsize'] = 12
-        plt.rcParams['ytick.labelsize'] = 12
+        plt.rcParams['xtick.labelsize'] = 14
+        plt.rcParams['ytick.labelsize'] = 14
         plt.rcParams['patch.edgecolor'] = "black"
         fig = plt.figure()
         plt.subplots_adjust(bottom=0.3)
@@ -156,9 +156,9 @@
             plt.text(0.75, 0.05 + s, "{:,}\n".format(len(count) / 2), size=11, transform=plt.gcf().transFigure)
 
         plt.legend(loc='upper right', fontsize=14, bbox_to_anchor=(0.9, 1), frameon=True)
-        plt.title(name1, fontsize=14)
-        plt.xlabel("No. of Family Members", fontsize=12)
-        plt.ylabel("Absolute Frequency", fontsize=12)
+        #plt.title(name1, fontsize=14)
+        plt.xlabel("Family size", fontsize=14)
+        plt.ylabel("Absolute Frequency", fontsize=14)
         plt.grid(b=True, which="major", color="#424242", linestyle=":")
         plt.margins(0.01, None)
 
@@ -166,7 +166,7 @@
         pdf.savefig(fig, bbox_inch="tight")
         plt.close()
 
-        output_file.write("Dataset:{}{}\n".format(sep, firstFile))
+        output_file.write("Dataset:{}{}\n".format(sep, name1))
         output_file.write("{}AB{}BA\n".format(sep, sep))
         output_file.write("max. family size:{}{}{}{}\n".format(sep, max(map(int, quant_ab)), sep, max(map(int, quant_ba))))
         output_file.write("absolute frequency:{}{}{}{}\n".format(sep, count[len(count) - 1], sep, count2[len(count2) - 1]))
diff -r b82fdb006304 -r 9ce2b4089c1b fsd_regions.xml
--- a/fsd_regions.xml	Thu May 10 07:28:39 2018 -0400
+++ b/fsd_regions.xml	Tue May 15 13:50:29 2018 -0400
@@ -1,12 +1,12 @@
 <?xml version="1.0" encoding="UTF-8"?>
-<tool id="fsd_regions" name="Duplex Sequencing Analysis:" version="0.0.1">
+<tool id="fsd_regions" name="Duplex Sequencing Analysis:" version="0.0.2">
     <requirements>
         <requirement type="package" version="2.7">python</requirement>
         <requirement type="package" version="1.4">matplotlib</requirement>
     </requirements>
     <description>Family size distribution (FSD) of aligned tags to reference genome</description>
     <command>
-        python2 $__tool_directory__/fsd_regions.py --inputFile "$file1" --inputName1 "$file1.name" --ref_genome "$file2" --sep $separator --output_csv $output_csv --output_pdf $output_pdf
+        python2 $__tool_directory__/fsd_regions.py --inputFile "$file1" --inputName1 "$file1.name" --ref_genome "$file2" --sep $separator --output_pdf $output_pdf --output_csv $output_csv 
     </command>
     <inputs>
         <param name="file1" type="data" format="tabular" label="Dataset 1: input tags of whole dataset" optional="false" help="Input in tabular format with the family size, tags and the direction of the strand ('ab' or 'ba') for each family."/>
@@ -36,7 +36,8 @@
     | 28  | AAAAAAAAAAATGGTATGGACCGA   | ab |
     +-----+----------------------------+----+
     
-    In addition, a TXT file with the regions and all tags that were aligned to the reference genome is required. This file can obtained from a different tool.
+    
+	In addition, a TXT file with the regions and all tags that were aligned to the reference genome is required. 	This file can obtained from a different tool.
     
     +-----------+------------------------------+
     | 87_636    | AAATCAAAGTATGAATGAAGTTGCCT   |