Mercurial > repos > mheinzl > fsd_regions
changeset 0:b82fdb006304 draft
planemo upload for repository https://github.com/monikaheinzl/galaxyProject/tree/master/tools/fsd_regions commit 6055f8c5c052f528ff85fb5e0d43b4500830637a
| author | mheinzl |
|---|---|
| date | Thu, 10 May 2018 07:28:39 -0400 |
| parents | |
| children | 9ce2b4089c1b |
| files | fsd_regions.py fsd_regions.xml |
| diffstat | 2 files changed, 279 insertions(+), 0 deletions(-) [+] |
line wrap: on
line diff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fsd_regions.py Thu May 10 07:28:39 2018 -0400 @@ -0,0 +1,205 @@ +#!/usr/bin/env python + +# Family size distribution of tags which were aligned to the reference genome +# +# Author: Monika Heinzl, Johannes-Kepler University Linz (Austria) +# Contact: monika.heinzl@edumail.at +# +# Takes at least one TABULAR file with tags before the alignment to the SSCS +# and a TXT with tags of reads that overlap the regions of the reference genome as input. +# The program produces a plot which shows the distribution of family sizes of the tags from the input files and +# a CSV file with the data of the plot. + +# USAGE: python FSD_regions_1.6_FINAL.py --inputFile filenameSSCS --inputName1 filenameSSCS --ref_genome filenameRefGenome --sep "characterWhichSeparatesCSVFile" --output_csv outptufile_name_csv --output_pdf outptufile_name_pdf + +import numpy +import matplotlib.pyplot as plt +import argparse +import sys +import os +from matplotlib.backends.backend_pdf import PdfPages + +def readFileReferenceFree(file, delim): + with open(file, 'r') as dest_f: + data_array = numpy.genfromtxt(dest_f, skip_header=0, delimiter=delim, comments='#', dtype='string') + return(data_array) + +def make_argparser(): + parser = argparse.ArgumentParser(description='Family Size Distribution of tags which were aligned to regions of the reference genome') + parser.add_argument('--inputFile', + help='Tabular File with three columns: ab or ba, tag and family size.') + parser.add_argument('--inputName1') + parser.add_argument('--ref_genome', + help='TXT File with tags of reads that overlap the region.') + parser.add_argument('--output_csv', default="data.csv", type=str, + help='Name of the pdf and csv file.') + parser.add_argument('--output_pdf', default="data.pdf", type=str, + help='Name of the pdf and csv file.') + parser.add_argument('--sep', default=",", + help='Separator in the csv file.') + return parser + +def compare_read_families_refGenome(argv): + parser = make_argparser() + args = parser.parse_args(argv[1:]) + + firstFile = args.inputFile + name1 = args.inputName1 + name1 = name1.split(".tabular")[0] + refGenome = args.ref_genome + title_file = args.output_pdf + title_file2 = args.output_csv + sep = args.sep + + if type(sep) is not str or len(sep) > 1: + print("Error: --sep must be a single character.") + exit(3) + + with open(title_file2, "w") as output_file, PdfPages(title_file) as pdf: + data_array = readFileReferenceFree(firstFile, "\t") + + mut_array = readFileReferenceFree(refGenome, " ") + length_regions = len(mut_array) + + seq = numpy.array(data_array[:, 1]) + tags = numpy.array(data_array[:, 2]) + quant = numpy.array(data_array[:, 0]).astype(int) + group = numpy.array(mut_array[:, 0]) + + all_ab = seq[numpy.where(tags == "ab")[0]] + all_ba = seq[numpy.where(tags == "ba")[0]] + quant_ab = quant[numpy.where(tags == "ab")[0]] + quant_ba = quant[numpy.where(tags == "ba")[0]] + + seqDic_ab = dict(zip(all_ab, quant_ab)) + seqDic_ba = dict(zip(all_ba, quant_ba)) + + seq_mut = numpy.array(mut_array[:, 1]) + + groupUnique, group_index = numpy.unique(group, return_index=True) + groupUnique = groupUnique[numpy.argsort(group_index)] + + lst_ab = [] + for i in seq_mut: + lst_ab.append(seqDic_ab.get(i)) + + lst_ba = [] + for i in seq_mut: + lst_ba.append(seqDic_ba.get(i)) + + quant_ab = numpy.array(lst_ab) + quant_ba = numpy.array(lst_ba) + + quantAfterRegion = [] + for i in groupUnique: + dataAB = quant_ab[numpy.where(group == i)[0]] + dataBA = quant_ba[numpy.where(group == i)[0]] + bigFamilies = numpy.where(dataAB > 20)[0] + dataAB[bigFamilies] = 22 + bigFamilies = numpy.where(dataBA > 20)[0] + dataBA[bigFamilies] = 22 + + quantAll = numpy.concatenate((dataAB, dataBA)) + quantAfterRegion.append(quantAll) + + maximumX = numpy.amax(numpy.concatenate(quantAfterRegion)) + minimumX = numpy.amin(numpy.concatenate(quantAfterRegion)) + + ### PLOT ### + plt.rc('figure', figsize=(11.69, 8.27)) # A4 format + plt.rcParams['axes.facecolor'] = "E0E0E0" # grey background color + plt.rcParams['xtick.labelsize'] = 12 + plt.rcParams['ytick.labelsize'] = 12 + plt.rcParams['patch.edgecolor'] = "black" + fig = plt.figure() + plt.subplots_adjust(bottom=0.3) + + colors = ["#6E6E6E", "#0431B4", "#5FB404", "#B40431", "#F4FA58", "#DF7401", "#81DAF5"] + + col = [] + for i in range(0, len(groupUnique)): + col.append(colors[i]) + + counts = plt.hist(quantAfterRegion, bins=range(minimumX, maximumX + 1), stacked=False, label=groupUnique, + align="left", alpha=1, color=col, edgecolor="black", linewidth=1) + ticks = numpy.arange(minimumX - 1, maximumX, 1) + + ticks1 = map(str, ticks) + ticks1[len(ticks1) - 1] = ">20" + plt.xticks(numpy.array(ticks), ticks1) + count = numpy.bincount(map(int, quant_ab)) # original counts + + legend = "max. family size =\nabsolute frequency=\nrelative frequency=\n\ntotal nr. of reads=" + plt.text(0.15, 0.105, legend, size=11, transform=plt.gcf().transFigure) + + legend = "AB\n{}\n{}\n{:.5f}\n\n{:,}" \ + .format(max(map(int, quant_ab)), count[len(count) - 1], float(count[len(count) - 1]) / sum(count), + sum(numpy.array(data_array[:, 0]).astype(int))) + plt.text(0.35, 0.105, legend, size=11, transform=plt.gcf().transFigure) + + count2 = numpy.bincount(map(int, quant_ba)) # original counts + + legend = "BA\n{}\n{}\n{:.5f}" \ + .format(max(map(int, quant_ba)), count2[len(count2) - 1], float(count2[len(count2) - 1]) / sum(count2)) + plt.text(0.45, 0.15, legend, size=11, transform=plt.gcf().transFigure) + + legend1 = "total nr. of tags=" + legend2 = "total numbers * \n{:,}".format(length_regions) + plt.text(0.6, 0.2, legend1, size=11, transform=plt.gcf().transFigure) + plt.text(0.75, 0.2, legend2, size=11, transform=plt.gcf().transFigure) + legend4 = "* In the plot, both family sizes of the ab and ba strands were used.\nWhereas the total numbers indicate only the single count of the tags per region.\n" + plt.text(0.1, 0.02, legend4, size=11, transform=plt.gcf().transFigure) + + space = numpy.arange(0, len(groupUnique), 0.02) + for i, s, count in zip(groupUnique, space, quantAfterRegion): + plt.text(0.6, 0.05 + s, "{}=\n".format(i), size=11, transform=plt.gcf().transFigure) + plt.text(0.75, 0.05 + s, "{:,}\n".format(len(count) / 2), size=11, transform=plt.gcf().transFigure) + + plt.legend(loc='upper right', fontsize=14, bbox_to_anchor=(0.9, 1), frameon=True) + plt.title(name1, fontsize=14) + plt.xlabel("No. of Family Members", fontsize=12) + plt.ylabel("Absolute Frequency", fontsize=12) + plt.grid(b=True, which="major", color="#424242", linestyle=":") + plt.margins(0.01, None) + + # plt.savefig("{}_regions.pdf".format(title_file), bbox_inch="tight") + pdf.savefig(fig, bbox_inch="tight") + plt.close() + + output_file.write("Dataset:{}{}\n".format(sep, firstFile)) + output_file.write("{}AB{}BA\n".format(sep, sep)) + output_file.write("max. family size:{}{}{}{}\n".format(sep, max(map(int, quant_ab)), sep, max(map(int, quant_ba)))) + output_file.write("absolute frequency:{}{}{}{}\n".format(sep, count[len(count) - 1], sep, count2[len(count2) - 1])) + output_file.write("relative frequency:{}{:.3f}{}{:.3f}\n\n".format(sep, float(count[len(count) - 1]) / sum(count), sep, float(count2[len(count2) - 1]) / sum(count2))) + output_file.write("total nr. of reads{}{}\n".format(sep, sum(numpy.array(data_array[:, 0]).astype(int)))) + output_file.write("\n\nValues from family size distribution\n") + output_file.write("{}".format(sep)) + for i in groupUnique: + output_file.write("{}{}".format(i,sep)) + output_file.write("\n") + j=0 + for fs in counts[1][0:len(counts[1])-1]: + if fs == 21: + fs = ">20" + else: + fs = "={}".format(fs) + output_file.write("FS{}{}".format(fs,sep)) + for n in range(len(groupUnique)): + output_file.write("{}{}".format(int(counts[0][n][j]), sep)) + output_file.write("\n") + j+=1 + output_file.write("sum{}".format(sep)) + for i in counts[0]: + output_file.write("{}{}".format(int(sum(i)), sep)) + output_file.write("\n") + output_file.write("\n\nIn the plot, both family sizes of the ab and ba strands were used.\nWhereas the total numbers indicate only the single count of the tags per region.\n") + output_file.write("Region{}total nr. of tags per region\n".format(sep)) + for i, count in zip(groupUnique, quantAfterRegion): + output_file.write("{}{}{}\n".format(i,sep,len(count) / 2)) + output_file.write("sum of tags{}{}\n".format(sep,length_regions)) + + print("Files successfully created!") + #print("Files saved under {}.pdf and {}.csv in {}!".format(title_file, title_file, os.getcwd())) + +if __name__ == '__main__': + sys.exit(compare_read_families_refGenome(sys.argv))
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fsd_regions.xml Thu May 10 07:28:39 2018 -0400 @@ -0,0 +1,74 @@ +<?xml version="1.0" encoding="UTF-8"?> +<tool id="fsd_regions" name="Duplex Sequencing Analysis:" version="0.0.1"> + <requirements> + <requirement type="package" version="2.7">python</requirement> + <requirement type="package" version="1.4">matplotlib</requirement> + </requirements> + <description>Family size distribution (FSD) of aligned tags to reference genome</description> + <command> + python2 $__tool_directory__/fsd_regions.py --inputFile "$file1" --inputName1 "$file1.name" --ref_genome "$file2" --sep $separator --output_csv $output_csv --output_pdf $output_pdf + </command> + <inputs> + <param name="file1" type="data" format="tabular" label="Dataset 1: input tags of whole dataset" optional="false" help="Input in tabular format with the family size, tags and the direction of the strand ('ab' or 'ba') for each family."/> + <param name="file2" type="data" format="txt" label="Dataset 2: input tags aligned to the reference genome" help="Input in txt format with the regions and the tags, which were aligned to the reference genome."/> + <param name="separator" type="text" label="Separator of the CSV file." help="can be a single character" value=","/> + </inputs> + <outputs> + <data name="output_pdf" format="pdf" /> + <data name="output_csv" format="csv"/> + </outputs> + <help> <![CDATA[ + +**What it does** + + This tool will create a distribution of family sizes of all tags, which were aligned to the reference genome. The distribution is separated after the regions of the reference genome. + + +**Input** + + This tools expects a tabular file with the tags of all families, their sizes and information about forward (ab) and reverse (ba) strands. + + +-----+----------------------------+----+ + | 1 | AAAAAAAAAAAATGTTGGAATCTT | ba | + +-----+----------------------------+----+ + | 10 | AAAAAAAAAAAGGCGGTCCACCCC | ab | + +-----+----------------------------+----+ + | 28 | AAAAAAAAAAATGGTATGGACCGA | ab | + +-----+----------------------------+----+ + + In addition, a TXT file with the regions and all tags that were aligned to the reference genome is required. This file can obtained from a different tool. + + +-----------+------------------------------+ + | 87_636 | AAATCAAAGTATGAATGAAGTTGCCT | + +-----------+------------------------------+ + | 87_636 | AAATTCATAGCATTAATTTCAACGGG | + +-----------+------------------------------+ + | 656_1143 | GGGGCAGCCATATTGGCAATTATCAT | + +-----------+------------------------------+ + +**Output** + + The output is a PDF file with the plot and a CSV with the data of the plot. + + +**About Author** + + Author: Monika Heinzl + + Department: Institute of Bioinformatics, Johannes Kepler University Linz, Austria + + Contact: monika.heinzl@edumail.at + + ]]> + + </help> + <citations> + <citation type="bibtex"> + @misc{duplex, + author = {Heinzl, Monika}, + year = {2018}, + title = {Development of algorithms for the analysis of duplex sequencing data} + } + </citation> + </citations> +</tool>
