Mercurial > repos > mheinzl > variant_analyzer2

comparison read2mut.py @ 23:25625221b88f draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
author mheinzl
date Mon, 22 Feb 2021 16:23:48 +0000
parents 24c50e7539ef
children cf6f0fb05bad
comparison
equal deleted inserted replaced
22:24c50e7539ef 23:25625221b88f
811 fraction_chimeras = safe_div(chimeras_all, float(sum(used_tiers))) 811 fraction_chimeras = safe_div(chimeras_all, float(sum(used_tiers)))
812 if fraction_chimeras is None: 812 if fraction_chimeras is None:
813 fraction_chimeras = 0. 813 fraction_chimeras = 0.
814 new_cvrg = cvrg * (1. - fraction_chimeras) 814 new_cvrg = cvrg * (1. - fraction_chimeras)
815 lst.extend([chimeras_all, new_cvrg, safe_div(new_alt, new_cvrg)]) 815 lst.extend([chimeras_all, new_cvrg, safe_div(new_alt, new_cvrg)])
816 lst.extend([(cvrg - sum(used_tiers[-5:])), sum(used_tiers[0:6]), safe_div(sum(used_tiers[0:6]), (cvrg - sum(used_tiers[-5:])))]) 816 lst.extend([(cvrg - sum(used_tiers[-6:])), sum(used_tiers[0:6]), safe_div(sum(used_tiers[0:6]), (cvrg - sum(used_tiers[-6:])))])
817 if chimera_correction: 817 if chimera_correction:
818 chimeras_all = chimera_dict[key1][1] 818 chimeras_all = chimera_dict[key1][1]
819 new_alt = sum(used_tiers[0:6]) - chimeras_all 819 new_alt = sum(used_tiers[0:6]) - chimeras_all
820 fraction_chimeras = safe_div(chimeras_all, float(sum(used_tiers[0:6]))) 820 fraction_chimeras = safe_div(chimeras_all, float(sum(used_tiers[0:6])))
821 if fraction_chimeras is None: 821 if fraction_chimeras is None:
822 fraction_chimeras = 0. 822 fraction_chimeras = 0.
823 new_cvrg = (cvrg - sum(used_tiers[-5:])) * (1. - fraction_chimeras) 823 new_cvrg = (cvrg - sum(used_tiers[-6:])) * (1. - fraction_chimeras)
824 lst.extend([chimeras_all, new_cvrg, safe_div(new_alt, new_cvrg)]) 824 lst.extend([chimeras_all, new_cvrg, safe_div(new_alt, new_cvrg)])
825 lst.extend([alt_count, safe_div(alt_count, cvrg)]) 825 lst.extend([alt_count, safe_div(alt_count, cvrg)])
826 lst.extend(used_tiers) 826 lst.extend(used_tiers)
827 lst.extend(cum_af) 827 lst.extend(cum_af)
828 lst = tuple(lst) 828 lst = tuple(lst)
829 ws2.write_row(row + 1, 0, lst) 829 ws2.write_row(row + 1, 0, lst)
830 if chimera_correction: 830 if chimera_correction:
831 ws2.conditional_format('P{}:Q{}'.format(row + 2, row + 2), {'type': 'formula', 'criteria': '=$P$1="tier 1.1"', 'format': format1, 'multi_range': 'P{}:Q{} P1:Q1'.format(row + 2, row + 2)}) 831 ws2.conditional_format('P{}:Q{}'.format(row + 2, row + 2), {'type': 'formula', 'criteria': '=$P$1="tier 1.1"', 'format': format1, 'multi_range': 'P{}:Q{} P1:Q1'.format(row + 2, row + 2)})
832 ws2.conditional_format('R{}:U{}'.format(row + 2, row + 2), {'type': 'formula', 'criteria': '=$R$1="tier 2.1"', 'format': format3, 'multi_range': 'R{}:U{} R1:U1'.format(row + 2, row + 2)}) 832 ws2.conditional_format('R{}:U{}'.format(row + 2, row + 2), {'type': 'formula', 'criteria': '=$R$1="tier 2.1"', 'format': format3, 'multi_range': 'R{}:U{} R1:U1'.format(row + 2, row + 2)})
833 ws2.conditional_format('V{}:Z{}'.format(row + 2, row + 2), {'type': 'formula', 'criteria': '=$V$1="tier 3.1"', 'format': format2, 'multi_range': 'V{}:Z{} V1:Z1'.format(row + 2, row + 2)}) 833 ws2.conditional_format('V{}:AA{}'.format(row + 2, row + 2), {'type': 'formula', 'criteria': '=$V$1="tier 3.1"', 'format': format2, 'multi_range': 'V{}:AA{} V1:AA1'.format(row + 2, row + 2)})
834 else: 834 else:
835 ws2.conditional_format('J{}:K{}'.format(row + 2, row + 2), {'type': 'formula', 'criteria': '=$J$1="tier 1.1"', 'format': format1, 'multi_range': 'J{}:K{} J1:K1'.format(row + 2, row + 2)}) 835 ws2.conditional_format('J{}:K{}'.format(row + 2, row + 2), {'type': 'formula', 'criteria': '=$J$1="tier 1.1"', 'format': format1, 'multi_range': 'J{}:K{} J1:K1'.format(row + 2, row + 2)})
836 ws2.conditional_format('L{}:O{}'.format(row + 2, row + 2), {'type': 'formula', 'criteria': '=$L$1="tier 2.1"', 'format': format3, 'multi_range': 'L{}:O{} L1:O1'.format(row + 2, row + 2)}) 836 ws2.conditional_format('L{}:O{}'.format(row + 2, row + 2), {'type': 'formula', 'criteria': '=$L$1="tier 2.1"', 'format': format3, 'multi_range': 'L{}:O{} L1:O1'.format(row + 2, row + 2)})
837 ws2.conditional_format('P{}:U{}'.format(row + 2, row + 2), {'type': 'formula', 'criteria': '=$P$1="tier 3.1"', 'format': format2, 'multi_range': 'P{}:U{} P1:U1'.format(row + 2, row + 2)}) 837 ws2.conditional_format('P{}:U{}'.format(row + 2, row + 2), {'type': 'formula', 'criteria': '=$P$1="tier 3.1"', 'format': format2, 'multi_range': 'P{}:U{} P1:U1'.format(row + 2, row + 2)})
838 row += 1 838 row += 1
856 {'type': 'formula', 856 {'type': 'formula',
857 'criteria': '=OR($A${}="tier 2.1", $A${}="tier 2.2", $A${}="tier 2.3", $A${}="tier 2.4")'.format(i + 2, i + 2, i + 2, i + 2), 857 'criteria': '=OR($A${}="tier 2.1", $A${}="tier 2.2", $A${}="tier 2.3", $A${}="tier 2.4")'.format(i + 2, i + 2, i + 2, i + 2),
858 'format': format3}) 858 'format': format3})
859 ws3.conditional_format('A{}:B{}'.format(i + 2, i + 2), 859 ws3.conditional_format('A{}:B{}'.format(i + 2, i + 2),
860 {'type': 'formula', 860 {'type': 'formula',
861 'criteria': '=$A${}>="3"'.format(i + 2), 861 'criteria': '=OR($A${}="tier 3.1", $A${}="tier 3.2", $A${}="tier 4.1", $A${}="tier 4.2", $A${}="tier 5", $A${}="tier 6")'.format(i + 2, i + 2, i + 2, i + 2, i + 2, i + 2),
862 'format': format2}) 862 'format': format2})
863 863
864 description_tiers = [("Tier 1.1", "both ab and ba SSCS present (>75% of the sites with alternative base) and minimal FS>=3 for both SSCS in at least one mate"), ("", ""), 864 description_tiers = [("Tier 1.1", "both ab and ba SSCS present (>75% of the sites with alternative base) and minimal FS>=3 for both SSCS in at least one mate"), ("", ""),
865 ("Tier 1.2", "both ab and ba SSCS present (>75% of the sites with alt. base) and mate pair validation (min. FS=1) and minimal FS>=3 for at least one of the SSCS"), 865 ("Tier 1.2", "both ab and ba SSCS present (>75% of the sites with alt. base) and mate pair validation (min. FS=1) and minimal FS>=3 for at least one of the SSCS"),
866 ("Tier 2.1", "both ab and ba SSCS present (>75% of the sites with alt. base) and minimal FS>=3 for at least one of the SSCS in at least one mate"), 866 ("Tier 2.1", "both ab and ba SSCS present (>75% of the sites with alt. base) and minimal FS>=3 for at least one of the SSCS in at least one mate"),
867 ("Tier 2.2", "both ab and ba SSCS present (>75% of the sites with alt. base) and mate pair validation (min. FS=1)"), 867 ("Tier 2.2", "both ab and ba SSCS present (>75% of the sites with alt. base) and mate pair validation (min. FS=1)"),
868 ("Tier 2.3", "both ab and ba SSCS present (>75% of the sites with alt. base) and minimal FS=1 for both SSCS in one mate and minimal FS>=3 for at least one of the SSCS in the other mate"), 868 ("Tier 2.3", "both ab and ba SSCS present (>75% of the sites with alt. base) and minimal FS=1 for both SSCS in one mate and minimal FS>=3 for at least one of the SSCS in the other mate"),
869 ("Tier 2.4", "both ab and ba SSCS present (>75% of the sites with alt. base) and minimal FS=1 for both SSCS in at least one mate"), 869 ("Tier 2.4", "both ab and ba SSCS present (>75% of the sites with alt. base) and minimal FS=1 for both SSCS in at least one mate"),
870 ("Tier 3.1", "both ab and ba SSCS present (>50% of the sites with alt. base) and recurring mutation on this position"), 870 ("Tier 3.1", "both ab and ba SSCS present (>50% of the sites with alt. base) and recurring mutation on this position"),
871 ("Tier 3.2", "both ab and ba SSCS present (>50% of the sites with alt. base) and minimal FS>=1 for both SSCS in at least one mate"), 871 ("Tier 3.2", "both ab and ba SSCS present (>50% of the sites with alt. base) and minimal FS>=1 for both SSCS in at least one mate"),
872 ("Tier 4.1", "variants at the start of the reads"), 872 ("Tier 4.1", "variants at the beginning of the reads"),
873 ("Tier 4.2", "variants at the end of the reads"), 873 ("Tier 4.2", "variants at the end of the reads"),
874 ("Tier 5", "mates with contradictory information"), 874 ("Tier 5", "mates with contradictory information"),
875 ("Tier 6", "remaining variants")] 875 ("Tier 6", "remaining variants")]
876 examples_tiers = [[("Chr5:5-20000-11068-C-G", "1.1", "AAAAAGATGCCGACTACCTT", "ab1.ba2", "254", "228", "287", "288", "289", 876 examples_tiers = [[("chr5-11068-C-G", "1.1", "AAAAAGATGCCGACTACCTT", "ab1.ba2", "254", "228", "287", "288", "289",
877 "3", "6", "3", "6", "0", "0", "3", "6", "0", "0", "1", "1", "0", "0", "0", "0", "0", "0", 877 "3", "6", "3", "6", "0", "0", "3", "6", "0", "0", "1", "1", "0", "0", "0", "0", "0", "0",
878 "4081", "4098", "5", "10", "", ""), 878 "4081", "4098", "5", "10", "", ""),
879 ("", "", "AAAAAGATGCCGACTACCTT", "ab2.ba1", None, None, None, None, 879 ("", "", "AAAAAGATGCCGACTACCTT", "ab2.ba1", None, None, None, None,
880 "289", "0", "0", "0", "0", "0", "0", "0", "0", None, None, None, None, 880 "289", "0", "0", "0", "0", "0", "0", "0", "0", None, None, None, None,
881 "0", "0", "0", "0", "0", "0", "4081", "4098", "5", "10", "", "")], 881 "0", "0", "0", "0", "0", "0", "4081", "4098", "5", "10", "", "")],
882 [("Chr5:5-20000-11068-C-G", "1.1", "AAAAATGCGTAGAAATATGC", "ab1.ba2", "254", "228", "287", "288", "289", 882 [("chr5-11068-C-G", "1.1", "AAAAATGCGTAGAAATATGC", "ab1.ba2", "254", "228", "287", "288", "289",
883 "33", "43", "33", "43", "0", "0", "33", "43", "0", "0", "1", "1", "0", "0", "0", "0", "0", 883 "33", "43", "33", "43", "0", "0", "33", "43", "0", "0", "1", "1", "0", "0", "0", "0", "0",
884 "0", "4081", "4098", "5", "10", "", ""), 884 "0", "4081", "4098", "5", "10", "", ""),
885 ("", "", "AAAAATGCGTAGAAATATGC", "ab2.ba1", "268", "268", "270", "288", "289", 885 ("", "", "AAAAATGCGTAGAAATATGC", "ab2.ba1", "268", "268", "270", "288", "289",
886 "11", "34", "10", "27", "0", "0", "10", "27", "0", "0", "1", "1", "0", "0", "1", 886 "11", "34", "10", "27", "0", "0", "10", "27", "0", "0", "1", "1", "0", "0", "1",
887 "7", "0", "0", "4081", "4098", "5", "10", "", "")], 887 "7", "0", "0", "4081", "4098", "5", "10", "", "")],
888 [("Chr5:5-20000-10776-G-T", "1.2", "CTATGACCCGTGAGCCCATG", "ab1.ba2", "132", "132", "287", "288", "290", 888 [("chr5-10776-G-T", "1.2", "CTATGACCCGTGAGCCCATG", "ab1.ba2", "132", "132", "287", "288", "290",
889 "4", "1", "4", "1", "0", "0", "4", "1", "0", "0", "1", "1", "0", "0", "0", "0", 889 "4", "1", "4", "1", "0", "0", "4", "1", "0", "0", "1", "1", "0", "0", "0", "0",
890 "0", "0", "1", "6", "47170", "41149", "", ""), 890 "0", "0", "1", "6", "47170", "41149", "", ""),
891 ("", "", "CTATGACCCGTGAGCCCATG", "ab2.ba1", "77", "132", "233", "200", "290", 891 ("", "", "CTATGACCCGTGAGCCCATG", "ab2.ba1", "77", "132", "233", "200", "290",
892 "4", "1", "4", "1", "0", "0", "4", "1", "0", "0", "1", "1", "0", "0", "0", "0", 892 "4", "1", "4", "1", "0", "0", "4", "1", "0", "0", "1", "1", "0", "0", "0", "0",
893 "0", "0", "1", "6", "47170", "41149", "", "")], 893 "0", "0", "1", "6", "47170", "41149", "", "")],
894 [("Chr5:5-20000-11068-C-G", "2.1", "AAAAAAACATCATACACCCA", "ab1.ba2", "246", "244", "287", "288", "289", 894 [("chr5-11068-C-G", "2.1", "AAAAAAACATCATACACCCA", "ab1.ba2", "246", "244", "287", "288", "289",
895 "2", "8", "2", "8", "0", "0", "2", "8", "0", "0", "1", "1", "0", "0", "0", "0", "0", "0", 895 "2", "8", "2", "8", "0", "0", "2", "8", "0", "0", "1", "1", "0", "0", "0", "0", "0", "0",
896 "4081", "4098", "5", "10", "", ""), 896 "4081", "4098", "5", "10", "", ""),
897 ("", "", "AAAAAAACATCATACACCCA", "ab2.ba1", None, None, None, None, 897 ("", "", "AAAAAAACATCATACACCCA", "ab2.ba1", None, None, None, None,
898 "289", "0", "0", "0", "0", "0", "0", "0", "0", None, None, None, None, "0", "0", 898 "289", "0", "0", "0", "0", "0", "0", "0", "0", None, None, None, None, "0", "0",
899 "0", "0", "0", "0", "4081", "4098", "5", "10", "", "")], 899 "0", "0", "0", "0", "4081", "4098", "5", "10", "", "")],
900 [("Chr5:5-20000-11068-C-G", "2.2", "ATCAGCCATGGCTATTATTG", "ab1.ba2", "72", "72", "217", "288", "289", 900 [("chr5-11068-C-G", "2.2", "ATCAGCCATGGCTATTATTG", "ab1.ba2", "72", "72", "217", "288", "289",
901 "1", "1", "1", "1", "0", "0", "1", "1", "0", "0", "1", "1", "0", "0", "0", "0", "0", "0", 901 "1", "1", "1", "1", "0", "0", "1", "1", "0", "0", "1", "1", "0", "0", "0", "0", "0", "0",
902 "4081", "4098", "5", "10", "", ""), 902 "4081", "4098", "5", "10", "", ""),
903 ("", "", "ATCAGCCATGGCTATTATTG", "ab2.ba1", "153", "164", "217", "260", "289", 903 ("", "", "ATCAGCCATGGCTATTATTG", "ab2.ba1", "153", "164", "217", "260", "289",
904 "1", "1", "1", "1", "0", "0", "1", "1", "0", "0", "1", "1", "0", "0", "0", "0", "0", "0", 904 "1", "1", "1", "1", "0", "0", "1", "1", "0", "0", "1", "1", "0", "0", "0", "0", "0", "0",
905 "4081", "4098", "5", "10", "", "")], 905 "4081", "4098", "5", "10", "", "")],
906 [("Chr5:5-20000-11068-C-G", "2.3", "ATCAATATGGCCTCGCCACG", "ab1.ba2", None, None, None, None, 906 [("chr5-11068-C-G", "2.3", "ATCAATATGGCCTCGCCACG", "ab1.ba2", None, None, None, None,
907 "289", "0", "5", "0", "5", "0", "0", "0", "5", None, None, None, "1", "0", 907 "289", "0", "5", "0", "5", "0", "0", "0", "5", None, None, None, "1", "0",
908 "0", "0", "0", "0", "0", "4081", "4098", "5", "10", "", ""), 908 "0", "0", "0", "0", "0", "4081", "4098", "5", "10", "", ""),
909 ("", "", "ATCAATATGGCCTCGCCACG", "ab2.ba1", "202", "255", "277", "290", "289", 909 ("", "", "ATCAATATGGCCTCGCCACG", "ab2.ba1", "202", "255", "277", "290", "289",
910 "1", "3", "1", "3", "0", "0", "1", "3", "0", "0", "1", "1", "0", "0", "0", "0", 910 "1", "3", "1", "3", "0", "0", "1", "3", "0", "0", "1", "1", "0", "0", "0", "0",
911 "0", "0", "4081", "4098", "5", "10", "", "")], 911 "0", "0", "4081", "4098", "5", "10", "", "")],
912 [("Chr5:5-20000-11068-C-G", "2.4", "ATCAGCCATGGCTATTTTTT", "ab1.ba2", "72", "72", "217", "288", "289", 912 [("chr5-11068-C-G", "2.4", "ATCAGCCATGGCTATTTTTT", "ab1.ba2", "72", "72", "217", "288", "289",
913 "1", "1", "1", "1", "0", "0", "1", "1", "0", "0", "1", "1", "0", "0", "0", "0", "0", "0", "4081", 913 "1", "1", "1", "1", "0", "0", "1", "1", "0", "0", "1", "1", "0", "0", "0", "0", "0", "0", "4081",
914 "4098", "5", "10", "", ""), 914 "4098", "5", "10", "", ""),
915 ("", "", "ATCAGCCATGGCTATTTTTT", "ab2.ba1", "153", "164", "217", "260", "289", 915 ("", "", "ATCAGCCATGGCTATTTTTT", "ab2.ba1", "153", "164", "217", "260", "289",
916 "1", "1", "0", "0", "0", "0", "0", "0", "0", "0", "0", "0", "1", "1", "0", "0", "0", "0", "4081", 916 "1", "1", "0", "0", "0", "0", "0", "0", "0", "0", "0", "0", "1", "1", "0", "0", "0", "0", "4081",
917 "4098", "5", "10", "", "")], 917 "4098", "5", "10", "", "")],
918 [("Chr5:5-20000-10776-G-T", "3.1", "ATGCCTACCTCATTTGTCGT", "ab1.ba2", "46", "15", "287", "288", "290", 918 [("chr5-10776-G-T", "3.1", "ATGCCTACCTCATTTGTCGT", "ab1.ba2", "46", "15", "287", "288", "290",
919 "3", "3", "3", "2", "3", "1", "0", "1", "1", "0.5", "0", "0.5", "0", "0", "0", "1", 919 "3", "3", "3", "2", "3", "1", "0", "1", "1", "0.5", "0", "0.5", "0", "0", "0", "1",
920 "0", "0", "3", "3", "47170", "41149", "", ""), 920 "0", "0", "3", "3", "47170", "41149", "", ""),
921 ("", "", "ATGCCTACCTCATTTGTCGT", "ab2.ba1", None, "274", None, 921 ("", "", "ATGCCTACCTCATTTGTCGT", "ab2.ba1", None, "274", None,
922 "288", "290", "0", "3", "0", "2", "0", "1", "0", "1", None, "0.5", None, "0.5", 922 "288", "290", "0", "3", "0", "2", "0", "1", "0", "1", None, "0.5", None, "0.5",
923 "0", "0", "0", "1", "0", "0", "3", "3", "47170", "41149", "", "")], 923 "0", "0", "0", "1", "0", "0", "3", "3", "47170", "41149", "", "")],
924 [("Chr5:5-20000-11315-C-T", "3.2", "ACAACATCACGTATTCAGGT", "ab1.ba2", "197", "197", "240", "255", "271", 924 [("chr5-11315-C-T", "3.2", "ACAACATCACGTATTCAGGT", "ab1.ba2", "197", "197", "240", "255", "271",
925 "2", "3", "2", "3", "0", "1", "2", "2", "0", "0.333333333333333", "1", 925 "2", "3", "2", "3", "0", "1", "2", "2", "0", "0.333333333333333", "1",
926 "0.666666666666667", "0", "0", "0", "0", "0", "0", "1", "1", "6584", "6482", "", ""), 926 "0.666666666666667", "0", "0", "0", "0", "0", "0", "1", "1", "6584", "6482", "", ""),
927 ("", "", "ACAACATCACGTATTCAGGT", "ab2.ba1", "35", "35", "240", "258", "271", 927 ("", "", "ACAACATCACGTATTCAGGT", "ab2.ba1", "35", "35", "240", "258", "271",
928 "2", "3", "2", "3", "0", "1", "2", "2", "0", "0.333333333333333", "1", 928 "2", "3", "2", "3", "0", "1", "2", "2", "0", "0.333333333333333", "1",
929 "0.666666666666667", "0", "0", "0", "0", "0", "0", "1", "1", "6584", "6482", "", "")], 929 "0.666666666666667", "0", "0", "0", "0", "0", "0", "1", "1", "6584", "6482", "", "")],
930 [("Chr5:5-20000-13983-G-C", "4.1", "AAAAAAAGAATAACCCACAC", "ab1.ba2", "1", "5", "255", "276", "269", 930 [("chr5-13983-G-C", "4.1", "AAAAAAAGAATAACCCACAC", "ab1.ba2", "1", "5", "255", "276", "269",
931 "5", "6", "0", "6", "0", "0", "5", "6", "0", "0", "0", "1", "0", "0", "0", "0", "5", "0", "1", "1", "5348", "5350", "", ""), 931 "5", "6", "0", "6", "0", "0", "5", "6", "0", "0", "0", "1", "0", "0", "0", "0", "5", "0", "1", "1", "5348", "5350", "", ""),
932 ("", "", "AAAAAAAGAATAACCCACAC", "ab2.ba1", None, None, None, None, 932 ("", "", "AAAAAAAGAATAACCCACAC", "ab2.ba1", None, None, None, None,
933 "269", "0", "0", "0", "0", "0", "0", "0", "0", None, None, None, None, "0", 933 "269", "0", "0", "0", "0", "0", "0", "0", "0", None, None, None, None, "0",
934 "0", "0", "0", "0", "0", "1", "1", "5348", "5350", "", "")], 934 "0", "0", "0", "0", "0", "1", "1", "5348", "5350", "", "")],
935 [("Chr5:5-20000-13983-G-C", "4.2", "AAAAAAAGAATAACCCACAC", "ab1.ba2", "250", "270", "255", "276", "269", 935 [("chr5-13983-G-C", "4.2", "AAAAAAAGAATAACCCACAC", "ab1.ba2", "250", "270", "255", "276", "269",
936 "5", "6", "0", "6", "0", "0", "5", "6", "0", "0", "0", "1", "0", "0", "0", "0", "5", "0", "1", "1", "5348", "5350", "", ""), 936 "5", "6", "0", "6", "0", "0", "5", "6", "0", "0", "0", "1", "0", "0", "0", "0", "5", "0", "1", "1", "5348", "5350", "", ""),
937 ("", "", "AAAAAAAGAATAACCCACAC", "ab2.ba1", None, None, None, None, 937 ("", "", "AAAAAAAGAATAACCCACAC", "ab2.ba1", None, None, None, None,
938 "269", "0", "0", "0", "0", "0", "0", "0", "0", None, None, None, None, "0", 938 "269", "0", "0", "0", "0", "0", "0", "0", "0", None, None, None, None, "0",
939 "0", "0", "0", "0", "0", "1", "1", "5348", "5350", "", "")], 939 "0", "0", "0", "0", "0", "1", "1", "5348", "5350", "", "")],
940 [("Chr5:5-20000-13963-T-C", "5", "TTTTTAAGAATAACCCACAC", "ab1.ba2", "38", "38", "240", "283", "263", 940 [("chr5-13963-T-C", "5", "TTTTTAAGAATAACCCACAC", "ab1.ba2", "38", "38", "240", "283", "263",
941 "110", "54", "110", "54", "0", "0", "110", "54", "0", "0", "1", "1", "0", "0", "0", 941 "110", "54", "110", "54", "0", "0", "110", "54", "0", "0", "1", "1", "0", "0", "0",
942 "0", "0", "0", "1", "1", "5348", "5350", "", ""), 942 "0", "0", "0", "1", "1", "5348", "5350", "", ""),
943 ("", "", "TTTTTAAGAATAACCCACAC", "ab2.ba1", "100", "112", "140", "145", "263", 943 ("", "", "TTTTTAAGAATAACCCACAC", "ab2.ba1", "100", "112", "140", "145", "263",
944 "7", "12", "7", "12", "7", "12", "0", "0", "1", "1", "0", 944 "7", "12", "7", "12", "7", "12", "0", "0", "1", "1", "0",
945 "0", "0", "0", "0", "0", "0", "0", "1", "1", "5348", "5350", "", "")], 945 "0", "0", "0", "0", "0", "0", "0", "1", "1", "5348", "5350", "", "")],
946 [("Chr5:5-20000-13983-G-C", "6", "ATGTTGTGAATAACCCACAC", "ab1.ba2", None, "186", None, "276", "269", 946 [("chr5-13983-G-C", "6", "ATGTTGTGAATAACCCACAC", "ab1.ba2", None, "186", None, "276", "269",
947 "0", "6", "0", "6", "0", "0", "0", "6", "0", "0", "0", "1", "0", "0", "0", "0", "0", 947 "0", "6", "0", "6", "0", "0", "0", "6", "0", "0", "0", "1", "0", "0", "0", "0", "0",
948 "0", "1", "1", "5348", "5350", "", ""), 948 "0", "1", "1", "5348", "5350", "", ""),
949 ("", "", "ATGTTGTGAATAACCCACAC", "ab2.ba1", None, None, None, None, 949 ("", "", "ATGTTGTGAATAACCCACAC", "ab2.ba1", None, None, None, None,
950 "269", "0", "0", "0", "0", "0", "0", "0", "0", None, None, None, None, "0", 950 "269", "0", "0", "0", "0", "0", "0", "0", "0", None, None, None, None, "0",
951 "0", "0", "0", "0", "0", "1", "1", "5348", "5350", "", "")]] 951 "0", "0", "0", "0", "0", "1", "1", "5348", "5350", "", "")]]