diff read2mut.py @ 11:84a1a3f70407 draft

planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
author mheinzl
date Mon, 15 Feb 2021 21:53:24 +0000
parents e18c5293aac7
children 7a418148319d
line wrap: on
line diff
--- a/read2mut.py	Thu Feb 04 09:01:43 2021 +0000
+++ b/read2mut.py	Mon Feb 15 21:53:24 2021 +0000
@@ -10,7 +10,7 @@
 
 =======  ==========  =================  ================================
 Version  Date        Author             Description
-0.2.1    2019-10-27  Gundula Povysil    -
+2.0.0    2020-10-30  Gundula Povysil    -
 =======  ==========  =================  ================================
 
 
@@ -23,7 +23,6 @@
 from __future__ import division
 
 import argparse
-import itertools
 import json
 import operator
 import os
@@ -47,11 +46,7 @@
     parser.add_argument('--sscsJson',
                         help='JSON file with SSCS counts collected by mut2sscs.py.')
     parser.add_argument('--outputFile',
-                        help='Output xlsx file with summary of mutations.')
-    parser.add_argument('--outputFile2',
-                        help='Output xlsx file with allele frequencies of mutations.')
-    parser.add_argument('--outputFile3',
-                        help='Output xlsx file with examples of the tier classification.')
+                        help='Output xlsx file of mutation details.')
     parser.add_argument('--thresh', type=int, default=0,
                         help='Integer threshold for displaying mutations. Only mutations occuring less than thresh times are displayed. Default of 0 displays all.')
     parser.add_argument('--phred', type=int, default=20,
@@ -60,10 +55,6 @@
                         help='Integer threshold for assigning mutations at start and end of reads to lower tier. Default 10.')
     parser.add_argument('--chimera_correction', action="store_true",
                         help='Count chimeric variants and correct the variant frequencies')
-    parser.add_argument('--softclipping_dist',  type=int, default=15,
-                        help='Count mutation as an artifact if mutation lies within this parameter away from the softclipping part of the read.')
-    parser.add_argument('--reads_threshold',  type=float, default=1.0,
-                        help='Float number which specifies the minimum percentage of softclipped reads in a family to be considered in the softclipping tiers. Default: 1.0, means all reads of a family have to be softclipped.')
     return parser
 
 
@@ -81,14 +72,10 @@
     json_file = args.inputJson
     sscs_json = args.sscsJson
     outfile = args.outputFile
-    outfile2 = args.outputFile2
-    outfile3 = args.outputFile3
     thresh = args.thresh
     phred_score = args.phred
     trim = args.trim
     chimera_correction = args.chimera_correction
-    thr = args.softclipping_dist
-    threshold_reads = args.reads_threshold
 
     if os.path.isfile(file1) is False:
         sys.exit("Error: Could not find '{}'".format(file1))
@@ -102,8 +89,6 @@
         sys.exit("Error: phred is '{}', but only non-negative integers allowed".format(phred_score))
     if trim < 0:
         sys.exit("Error: trim is '{}', but only non-negative integers allowed".format(thresh))
-    if thr <= 0:
-        sys.exit("Error: trim is '{}', but only non-negative integers allowed".format(thr))
 
     # load dicts
     with open(json_file, "r") as f:
@@ -113,7 +98,6 @@
         (mut_pos_dict, ref_pos_dict) = json.load(f)
 
     # read bam file
-    # pysam.index(file2)
     bam = pysam.AlignmentFile(file2, "rb")
 
     # create mut_dict
@@ -121,21 +105,15 @@
     mut_read_pos_dict = {}
     mut_read_dict = {}
     reads_dict = {}
-    mut_read_cigar_dict = {}
     i = 0
     mut_array = []
 
-    for count, variant in enumerate(VCF(file1)):
-    	#if count == 2000:
-        #    break
+    for variant in VCF(file1):
         chrom = variant.CHROM
         stop_pos = variant.start
         #chrom_stop_pos = str(chrom) + "#" + str(stop_pos)
         ref = variant.REF
-        if len(variant.ALT) == 0:
-            continue
-        else:
-            alt = variant.ALT[0]
+        alt = variant.ALT[0]
         chrom_stop_pos = str(chrom) + "#" + str(stop_pos) + "#" + ref + "#" + alt
 
         if len(ref) == len(alt):
@@ -144,7 +122,6 @@
             mut_dict[chrom_stop_pos] = {}
             mut_read_pos_dict[chrom_stop_pos] = {}
             reads_dict[chrom_stop_pos] = {}
-            mut_read_cigar_dict[chrom_stop_pos] = {}
 
             for pileupcolumn in bam.pileup(chrom, stop_pos - 1, stop_pos + 1, max_depth=100000000):
                 if pileupcolumn.reference_pos == stop_pos:
@@ -155,8 +132,8 @@
                     count_other = 0
                     count_lowq = 0
                     n = 0
-                    #print("unfiltered reads=", pileupcolumn.n, "filtered reads=", len(pileupcolumn.pileups),
-                    #      "difference= ", len(pileupcolumn.pileups) - pileupcolumn.n)
+                    print("unfiltered reads=", pileupcolumn.n, "filtered reads=", len(pileupcolumn.pileups),
+                          "difference= ", len(pileupcolumn.pileups) - pileupcolumn.n)
                     for pileupread in pileupcolumn.pileups:
                         n += 1
                         if not pileupread.is_del and not pileupread.is_refskip:
@@ -172,13 +149,14 @@
                             else:
                                 mut_dict[chrom_stop_pos][tag][nuc] = 1
                             if tag not in mut_read_pos_dict[chrom_stop_pos]:
-                                mut_read_pos_dict[chrom_stop_pos][tag] = [pileupread.query_position + 1]
-                                reads_dict[chrom_stop_pos][tag] = [len(pileupread.alignment.query_sequence)]
-                                mut_read_cigar_dict[chrom_stop_pos][tag] = [pileupread.alignment.cigarstring]
+                                mut_read_pos_dict[chrom_stop_pos][tag] = np.array(pileupread.query_position) + 1
+                                reads_dict[chrom_stop_pos][tag] = len(pileupread.alignment.query_sequence)
                             else:
-                            	mut_read_pos_dict[chrom_stop_pos][tag].append(pileupread.query_position + 1)
-                            	reads_dict[chrom_stop_pos][tag].append(len(pileupread.alignment.query_sequence))
-                            	mut_read_cigar_dict[chrom_stop_pos][tag].append(pileupread.alignment.cigarstring)
+                                mut_read_pos_dict[chrom_stop_pos][tag] = np.append(
+                                    mut_read_pos_dict[chrom_stop_pos][tag], pileupread.query_position + 1)
+                                reads_dict[chrom_stop_pos][tag] = np.append(
+                                    reads_dict[chrom_stop_pos][tag], len(pileupread.alignment.query_sequence))
+
                             if nuc == alt:
                                 count_alt += 1
                                 if tag not in mut_read_dict:
@@ -197,9 +175,10 @@
                         else:
                             count_indel += 1
 
-                    #print("coverage at pos %s = %s, ref = %s, alt = %s, other bases = %s, N = %s, indel = %s, low quality = %s\n" % (pileupcolumn.pos, count_ref + count_alt, count_ref, count_alt, count_other, count_n, count_indel, count_lowq))
-        #else:
-        #    print("indels are currently not evaluated")
+                    print("coverage at pos %s = %s, ref = %s, alt = %s, other bases = %s, N = %s, indel = %s, low quality = %s\n" % (pileupcolumn.pos, count_ref + count_alt, count_ref, count_alt, count_other, count_n, count_indel, count_lowq))
+        else:
+            print("indels are currently not evaluated")
+
     mut_array = np.array(mut_array)
     for read in bam.fetch(until_eof=True):
         if read.is_unmapped:
@@ -219,10 +198,6 @@
     # create pure_tags_dict
     pure_tags_dict = {}
     for key1, value1 in sorted(mut_dict.items()):
-    	#if len(np.where(np.array(['#'.join(str(i) for i in z)
-        #                       for z in zip(mut_array[:, 0], mut_array[:, 1])]) == key1)[0]) == 0:
-    #		continue
-
         i = np.where(np.array(['#'.join(str(i) for i in z)
                                for z in zip(mut_array[:, 0], mut_array[:, 1], mut_array[:, 2], mut_array[:, 3])]) == key1)[0][0]
         ref = mut_array[i, 2]
@@ -246,16 +221,6 @@
     else:
         pure_tags_dict_short = pure_tags_dict
 
-    # whole_array = []
-    # for k in pure_tags_dict.values():
-    #    if len(k) != 0:
-    #        keys = k.keys()
-    #        if len(keys) > 1:
-    #            for k1 in keys:
-    #                whole_array.append(k1)
-    #        else:
-    #            whole_array.append(keys[0])
-
     # output summary with threshold
     workbook = xlsxwriter.Workbook(outfile)
     workbook2 = xlsxwriter.Workbook(outfile2)
@@ -284,7 +249,6 @@
                    'SSCS alt.ab', 'SSCS alt.ba', 'SSCS ref.ab', 'SSCS ref.ba',
                    'in phase', 'chimeric tag')
     ws1.write_row(0, 0, header_line)
-
     counter_tier11 = 0
     counter_tier12 = 0
     counter_tier21 = 0
@@ -295,21 +259,12 @@
     counter_tier32 = 0
     counter_tier41 = 0
     counter_tier42 = 0
-    # if chimera_correction:
-    #    counter_tier43 = 0
-    counter_tier51 = 0
-    counter_tier52 = 0
-    counter_tier53 = 0
-    counter_tier54 = 0
-    counter_tier55 = 0
-    counter_tier6 = 0
-
+    counter_tier5 = 0
     row = 1
     tier_dict = {}
     chimera_dict = {}
     for key1, value1 in sorted(mut_dict.items()):
         counts_mut = 0
-        chimeric_tag_list = []
         chimeric_tag = {}
         if key1 in pure_tags_dict_short.keys():
             i = np.where(np.array(['#'.join(str(i) for i in z)
@@ -317,12 +272,10 @@
             ref = mut_array[i, 2]
             alt = mut_array[i, 3]
             dcs_median = cvrg_dict[key1][2]
-            whole_array = pure_tags_dict_short[key1].keys()
+            whole_array = list(pure_tags_dict_short[key1].keys())
 
             tier_dict[key1] = {}
-            values_tier_dict = [("tier 1.1", 0), ("tier 1.2", 0), ("tier 2.1", 0), ("tier 2.2", 0), ("tier 2.3", 0), ("tier 2.4", 0), ("tier 3.1", 0),
-                                ("tier 3.2", 0), ("tier 4.1", 0), ("tier 4.2", 0), ("tier 5.1", 0), ("tier 5.2", 0), ("tier 5.3", 0), ("tier 5.4", 0), ("tier 5.5", 0),
-                                ("tier 6", 0)]
+            values_tier_dict = [("tier 1.1", 0), ("tier 1.2", 0), ("tier 2.1", 0), ("tier 2.2", 0), ("tier 2.3", 0), ("tier 2.4", 0), ("tier 3.1", 0), ("tier 3.2", 0), ("tier 4.1", 0), ("tier 4.2", 0), ("tier 5", 0)]
             for k, v in values_tier_dict:
                 tier_dict[key1][k] = v
 
@@ -351,15 +304,11 @@
                         total1 = sum(mut_dict[key1][key2[:-5] + '.ab.1'].values())
                         if 'na' in mut_dict[key1][key2[:-5] + '.ab.1'].keys():
                             na1 = mut_dict[key1][key2[:-5] + '.ab.1']['na']
-                            # na1f = na1/total1
                         else:
-                            # na1 = na1f = 0
                             na1 = 0
                         if 'lowQ' in mut_dict[key1][key2[:-5] + '.ab.1'].keys():
                             lowq1 = mut_dict[key1][key2[:-5] + '.ab.1']['lowQ']
-                            # lowq1f = lowq1 / total1
                         else:
-                            # lowq1 = lowq1f = 0
                             lowq1 = 0
                         if ref in mut_dict[key1][key2[:-5] + '.ab.1'].keys():
                             ref1 = mut_dict[key1][key2[:-5] + '.ab.1'][ref]
@@ -394,15 +343,11 @@
                         total2 = sum(mut_dict[key1][key2[:-5] + '.ab.2'].values())
                         if 'na' in mut_dict[key1][key2[:-5] + '.ab.2'].keys():
                             na2 = mut_dict[key1][key2[:-5] + '.ab.2']['na']
-                            # na2f = na2 / total2
                         else:
-                            # na2 = na2f = 0
                             na2 = 0
                         if 'lowQ' in mut_dict[key1][key2[:-5] + '.ab.2'].keys():
                             lowq2 = mut_dict[key1][key2[:-5] + '.ab.2']['lowQ']
-                            # lowq2f = lowq2 / total2
                         else:
-                            # lowq2 = lowq2f = 0
                             lowq2 = 0
                         if ref in mut_dict[key1][key2[:-5] + '.ab.2'].keys():
                             ref2 = mut_dict[key1][key2[:-5] + '.ab.2'][ref]
@@ -437,15 +382,11 @@
                         total3 = sum(mut_dict[key1][key2[:-5] + '.ba.1'].values())
                         if 'na' in mut_dict[key1][key2[:-5] + '.ba.1'].keys():
                             na3 = mut_dict[key1][key2[:-5] + '.ba.1']['na']
-                            # na3f = na3 / total3
                         else:
-                            # na3 = na3f = 0
                             na3 = 0
                         if 'lowQ' in mut_dict[key1][key2[:-5] + '.ba.1'].keys():
                             lowq3 = mut_dict[key1][key2[:-5] + '.ba.1']['lowQ']
-                            # lowq3f = lowq3 / total3
                         else:
-                            # lowq3 = lowq3f = 0
                             lowq3 = 0
                         if ref in mut_dict[key1][key2[:-5] + '.ba.1'].keys():
                             ref3 = mut_dict[key1][key2[:-5] + '.ba.1'][ref]
@@ -476,15 +417,11 @@
                         total4 = sum(mut_dict[key1][key2[:-5] + '.ba.2'].values())
                         if 'na' in mut_dict[key1][key2[:-5] + '.ba.2'].keys():
                             na4 = mut_dict[key1][key2[:-5] + '.ba.2']['na']
-                            # na4f = na4 / total4
                         else:
-                            # na4 = na4f = 0
                             na4 = 0
                         if 'lowQ' in mut_dict[key1][key2[:-5] + '.ba.2'].keys():
                             lowq4 = mut_dict[key1][key2[:-5] + '.ba.2']['lowQ']
-                            # lowq4f = lowq4 / total4
                         else:
-                            # lowq4 = lowq4f = 0
                             lowq4 = 0
                         if ref in mut_dict[key1][key2[:-5] + '.ba.2'].keys():
                             ref4 = mut_dict[key1][key2[:-5] + '.ba.2'][ref]
@@ -513,38 +450,19 @@
 
                     read_pos1 = read_pos2 = read_pos3 = read_pos4 = -1
                     read_len_median1 = read_len_median2 = read_len_median3 = read_len_median4 = 0
-                    cigars_dcs1 = cigars_dcs2 = cigars_dcs3 = cigars_dcs4 = []
-                    pos_read1 = pos_read2 = pos_read3 = pos_read4 = []
-                    end_read1 = end_read2 = end_read3 = end_read4 = []
+
                     if key2[:-5] + '.ab.1' in mut_read_pos_dict[key1].keys():
-                        read_pos1 = np.median(np.array(mut_read_pos_dict[key1][key2[:-5] + '.ab.1']))
-                        read_len_median1 = np.median(np.array(reads_dict[key1][key2[:-5] + '.ab.1']))
-                        cigars_dcs1 = mut_read_cigar_dict[key1][key2[:-5] + '.ab.1']
-                        #print(mut_read_cigar_dict[key1][key2[:-5] + '.ab.1'])
-                        pos_read1 = mut_read_pos_dict[key1][key2[:-5] + '.ab.1']
-                        #print(cigars_dcs1)
-                        end_read1 = reads_dict[key1][key2[:-5] + '.ab.1']
+                        read_pos1 = np.median(mut_read_pos_dict[key1][key2[:-5] + '.ab.1'])
+                        read_len_median1 = np.median(reads_dict[key1][key2[:-5] + '.ab.1'])
                     if key2[:-5] + '.ab.2' in mut_read_pos_dict[key1].keys():
-                        read_pos2 = np.median(np.array(mut_read_pos_dict[key1][key2[:-5] + '.ab.2']))
-                        read_len_median2 = np.median(np.array(reads_dict[key1][key2[:-5] + '.ab.2']))
-                        cigars_dcs2 = mut_read_cigar_dict[key1][key2[:-5] + '.ab.2']
-                        pos_read2 = mut_read_pos_dict[key1][key2[:-5] + '.ab.2']
-                        end_read2 = reads_dict[key1][key2[:-5] + '.ab.2']
+                        read_pos2 = np.median(mut_read_pos_dict[key1][key2[:-5] + '.ab.2'])
+                        read_len_median2 = np.median(reads_dict[key1][key2[:-5] + '.ab.2'])
                     if key2[:-5] + '.ba.1' in mut_read_pos_dict[key1].keys():
-                        read_pos3 = np.median(np.array(mut_read_pos_dict[key1][key2[:-5] + '.ba.1']))
-                        read_len_median3 = np.median(np.array(reads_dict[key1][key2[:-5] + '.ba.1']))
-                        cigars_dcs3 = mut_read_cigar_dict[key1][key2[:-5] + '.ba.1']
-                        pos_read3 = mut_read_pos_dict[key1][key2[:-5] + '.ba.1']
-                        end_read3 = reads_dict[key1][key2[:-5] + '.ba.1']
+                        read_pos3 = np.median(mut_read_pos_dict[key1][key2[:-5] + '.ba.1'])
+                        read_len_median3 = np.median(reads_dict[key1][key2[:-5] + '.ba.1'])
                     if key2[:-5] + '.ba.2' in mut_read_pos_dict[key1].keys():
-                        read_pos4 = np.median(np.array(mut_read_pos_dict[key1][key2[:-5] + '.ba.2']))
-                        read_len_median4 = np.median(np.array(reads_dict[key1][key2[:-5] + '.ba.2']))
-                        #print(mut_read_cigar_dict[key1][key2[:-5] + '.ba.2'])
-                        cigars_dcs4 = mut_read_cigar_dict[key1][key2[:-5] + '.ba.2']
-
-                        pos_read4 = mut_read_pos_dict[key1][key2[:-5] + '.ba.2']
-                        #print(cigars_dcs4)
-                        end_read4 = reads_dict[key1][key2[:-5] + '.ba.2']
+                        read_pos4 = np.median(mut_read_pos_dict[key1][key2[:-5] + '.ba.2'])
+                        read_len_median4 = np.median(reads_dict[key1][key2[:-5] + '.ba.2'])
 
                     used_keys.append(key2[:-5])
                     counts_mut += 1
@@ -577,222 +495,14 @@
 
                         trimmed = False
                         contradictory = False
-                        softclipped_mutation_allMates = False
-                        softclipped_mutation_oneOfTwoMates = False
-                        softclipped_mutation_oneOfTwoSSCS = False
-                        softclipped_mutation_oneMate = False
-                        softclipped_mutation_oneMateOneSSCS = False
-                        print()
-                        print(key1, cigars_dcs1, cigars_dcs4, cigars_dcs2, cigars_dcs3)
-                        dist_start_read1 = dist_start_read2 = dist_start_read3 = dist_start_read4 = []
-                        dist_end_read1 = dist_end_read2 = dist_end_read3 = dist_end_read4 = []
-                        ratio_dist_start1 = ratio_dist_start2 = ratio_dist_start3 = ratio_dist_start4 = False
-                        ratio_dist_end1 = ratio_dist_end2 = ratio_dist_end3 = ratio_dist_end4 = False
 
-                        # mate 1 - SSCS ab
-                        softclipped_idx1 = [True if re.search(r"^[0-9]+S", string) or re.search(r"S$", string) else False for string in cigars_dcs1]
-                        ratio1 = safe_div(sum(softclipped_idx1), float(len(softclipped_idx1))) >= threshold_reads
-
-                        if any(ij is True for ij in softclipped_idx1):
-                        	softclipped_both_ends_idx1 = [True if (re.search(r"^[0-9]+S", string) and re.search(r"S$", string)) else False for string in cigars_dcs1]
-                        	softclipped_start1 = [int(string.split("S")[0]) if re.search(r"^[0-9]+S", string) else -1 for string in cigars_dcs1]
-                        	softclipped_end1 = [int(re.split("[A-Z]", str(string))[-2]) if re.search(r"S$", string) else -1 for string in cigars_dcs1]
-                        	dist_start_read1 = [(pos - soft) if soft != -1 else thr + 1000 for soft, pos in zip(softclipped_start1, pos_read1)]
-                        	dist_end_read1 = [(length_read - pos - soft) if soft != -1 else thr + 1000 for soft, pos, length_read in zip(softclipped_end1, pos_read1, end_read1)]
-                        	
-                        	# if read at both ends softclipped --> select end with smallest distance between mut position and softclipping
-                        	if any(ij is True for ij in softclipped_both_ends_idx1):
-                        		print(softclipped_both_ends_idx1)
-                        		for nr, indx in enumerate(softclipped_both_ends_idx1):
-                        			if indx:
-                        				if dist_start_read1[nr] <= dist_end_read1[nr]:
-                        					dist_end_read1[nr] = thr + 1000 # use dist of start and set start to very large number
-                        				else:
-                        					dist_start_read1[nr] = thr + 1000 # use dist of end and set start to very large number
-                        	ratio_dist_start1 = safe_div(sum([True if x <= thr else False for x in dist_start_read1]), float(sum(softclipped_idx1))) >= threshold_reads
-                        	ratio_dist_end1 = safe_div(sum([True if x <= thr else False for x in dist_end_read1]), float(sum(softclipped_idx1))) >= threshold_reads
-                        print(key1, "mate1 ab", dist_start_read1, dist_end_read1, cigars_dcs1, ratio1, ratio_dist_start1, ratio_dist_end1)
-
-                        # mate 1 - SSCS ba
-                        softclipped_idx4 = [True if re.search(r"^[0-9]+S", string) or re.search(r"S$", string) else False for string in cigars_dcs4]
-                        ratio4 = safe_div(sum(softclipped_idx4), float(len(softclipped_idx4))) >= threshold_reads
-                        if any(ij is True for ij in softclipped_idx4):
-                        	softclipped_both_ends_idx4 = [True if (re.search(r"^[0-9]+S", string) and re.search(r"S$", string)) else False for string in cigars_dcs4]
-                        	softclipped_start4 = [int(string.split("S")[0]) if re.search(r"^[0-9]+S", string) else -1 for string in cigars_dcs4]
-                        	softclipped_end4 = [int(re.split("[A-Z]", str(string))[-2]) if re.search(r"S$", string) else -1 for string in cigars_dcs4]
-                        	dist_start_read4 = [(pos - soft) if soft != -1 else thr + 1000 for soft, pos in zip(softclipped_start4, pos_read4)]
-                        	dist_end_read4 = [(length_read - pos - soft) if soft != -1 else thr + 1000 for soft, pos, length_read in zip(softclipped_end4, pos_read4, end_read4)]
-                        	
-                        	# if read at both ends softclipped --> select end with smallest distance between mut position and softclipping
-                        	if any(ij is True for ij in softclipped_both_ends_idx4):
-                        		print(softclipped_both_ends_idx4)
-                        		for nr, indx in enumerate(softclipped_both_ends_idx4):
-                        			if indx:
-                        				if dist_start_read4[nr] <= dist_end_read4[nr]:
-                        					dist_end_read4[nr] = thr + 1000 # use dist of start and set start to very large number
-                        				else:
-                        					dist_start_read4[nr] = thr + 1000 # use dist of end and set start to very large number
-                       		ratio_dist_start4 = safe_div(sum([True if x <= thr else False for x in dist_start_read4]), float(sum(softclipped_idx4))) >= threshold_reads
-                        	ratio_dist_end4 = safe_div(sum([True if x <= thr else False for x in dist_end_read4]), float(sum(softclipped_idx4))) >= threshold_reads
-                        print(key1, "mate1 ba", dist_start_read4, dist_end_read4,cigars_dcs4, ratio4, ratio_dist_start4, ratio_dist_end4)
-
-                        # mate 2 - SSCS ab
-                        softclipped_idx2 = [True if re.search(r"^[0-9]+S", string) or re.search(r"S$", string) else False for string in cigars_dcs2]
-                        #print(sum(softclipped_idx2))
-                        ratio2 = safe_div(sum(softclipped_idx2), float(len(softclipped_idx2))) >= threshold_reads
-                        if any(ij is True for ij in softclipped_idx2):
-                            softclipped_both_ends_idx2 = [True if (re.search(r"^[0-9]+S", string) and re.search(r"S$", string)) else False for string in cigars_dcs2]
-                            softclipped_start2 = [int(string.split("S")[0]) if re.search(r"^[0-9]+S", string) else -1 for string in cigars_dcs2]
-                            softclipped_end2 = [int(re.split("[A-Z]", str(string))[-2]) if re.search(r"S$", string) else -1 for string in cigars_dcs2]
-                            dist_start_read2 = [(pos - soft) if soft != -1 else thr + 1000 for soft, pos in zip(softclipped_start2, pos_read2)]
-                            dist_end_read2 = [(length_read - pos - soft) if soft != -1 else thr + 1000 for soft, pos, length_read in zip(softclipped_end2, pos_read2, end_read2)]
-                            	
-                        	# if read at both ends softclipped --> select end with smallest distance between mut position and softclipping
-                            if any(ij is True for ij in softclipped_both_ends_idx2):
-                            	print(softclipped_both_ends_idx2)
-                                for nr, indx in enumerate(softclipped_both_ends_idx2):
-                                    if indx:
-                                        if dist_start_read2[nr] <= dist_end_read2[nr]:
-                                            dist_end_read2[nr] = thr + 1000 # use dist of start and set start to very large number
-                                        else:
-                                            dist_start_read2[nr] = thr + 1000 # use dist of end and set start to very large number
-                            ratio_dist_start2 = safe_div(sum([True if x <= thr else False for x in dist_start_read2]), float(sum(softclipped_idx2))) >= threshold_reads
-                            #print(ratio_dist_end2)
-                            #print([True if x <= thr else False for x in ratio_dist_end2])
-                            ratio_dist_end2 = safe_div(sum([True if x <= thr else False for x in dist_end_read2]), float(sum(softclipped_idx2))) >= threshold_reads
-                        print(key1, "mate2 ab", dist_start_read2, dist_end_read2,cigars_dcs2, ratio2, ratio_dist_start2, ratio_dist_end2)
-
-                        # mate 2 - SSCS ba
-                        softclipped_idx3 = [True if re.search(r"^[0-9]+S", string) or re.search(r"S$", string) else False for string in cigars_dcs3]
-                        ratio3 = safe_div(sum(softclipped_idx3), float(len(softclipped_idx3))) >= threshold_reads
-                        if any(ij is True for ij in softclipped_idx3):
-                            softclipped_both_ends_idx3 = [True if (re.search(r"^[0-9]+S", string) and re.search(r"S$", string)) else False for string in cigars_dcs3]
-                            softclipped_start3 = [int(string.split("S")[0]) if re.search(r"^[0-9]+S", string) else -1 for string in cigars_dcs3]
-                            softclipped_end3 = [int(re.split("[A-Z]", str(string))[-2]) if re.search(r"S$", string) else -1 for string in cigars_dcs3]
-                            dist_start_read3 = [(pos - soft) if soft != -1 else thr + 1000 for soft, pos in zip(softclipped_start3, pos_read3)]
-                            dist_end_read3 = [(length_read - pos - soft) if soft != -1 else thr + 1000 for soft, pos, length_read in zip(softclipped_end3, pos_read3, end_read3)]
-                            
-                        	# if read at both ends softclipped --> select end with smallest distance between mut position and softclipping
-                            if any(ij is True for ij in softclipped_both_ends_idx3):
-                            	print(softclipped_both_ends_idx3)
-                                for nr, indx in enumerate(softclipped_both_ends_idx3):
-                                    if indx:
-                                        if dist_start_read3[nr] <= dist_end_read3[nr]:
-                                            dist_end_read3[nr] = thr + 1000 # use dist of start and set start to a larger number than thresh
-                                        else:
-                                            dist_start_read3[nr] = thr + 1000 # use dist of end and set start to very large number
-                            #print([True if x <= thr else False for x in dist_start_read3])
-                            ratio_dist_start3 = safe_div(sum([True if x <= thr else False for x in dist_start_read3]), float(sum(softclipped_idx3))) >= threshold_reads
-                            ratio_dist_end3 = safe_div(sum([True if x <= thr else False for x in dist_end_read3]), float(sum(softclipped_idx3))) >= threshold_reads
-                        print(key1, "mate2 ba", dist_start_read3, dist_end_read3,cigars_dcs3, ratio3, ratio_dist_start3, ratio_dist_end3)
-
-                        if ((all(float(ij) >= 0.5 for ij in [alt1ff, alt4ff]) &  # contradictory variant
-                            all(float(ij) == 0. for ij in [alt2ff, alt3ff])) |
-                            (all(float(ij) >= 0.5 for ij in [alt2ff, alt3ff]) &
-                             all(float(ij) == 0. for ij in [alt1ff, alt4ff]))):
+                        if ((all(float(ij) >= 0.5 for ij in [alt1ff, alt4ff]) & all(float(ij) == 0. for ij in [alt2ff, alt3ff])) | (all(float(ij) >= 0.5 for ij in [alt2ff, alt3ff]) & all(float(ij) == 0. for ij in [alt1ff, alt4ff]))):
                             alt1ff = 0
                             alt4ff = 0
                             alt2ff = 0
                             alt3ff = 0
                             trimmed = False
                             contradictory = True
-                        # softclipping tiers
-                        # information of both mates available --> all reads for both mates and SSCS are softclipped
-                        elif (ratio1 & ratio4 & ratio2 & ratio3 & 
-                              (ratio_dist_start1 | ratio_dist_end1) & (ratio_dist_start4 | ratio_dist_end4) & (ratio_dist_start2 | ratio_dist_end2) & (ratio_dist_start3 | ratio_dist_end3) &
-                              all(float(ij) > 0. for ij in [alt1ff, alt2ff, alt3ff, alt4ff])): # all mates available
-                        	# if distance between softclipping and mutation is at start or end of the read smaller than threshold
-                            softclipped_mutation_allMates = True
-                            softclipped_mutation_oneOfTwoMates = False
-                            softclipped_mutation_oneOfTwoSSCS = False
-                            softclipped_mutation_oneMate = False
-                            softclipped_mutation_oneMateOneSSCS = False
-                            alt1ff = 0
-                            alt4ff = 0
-                            alt2ff = 0
-                            alt3ff = 0
-                            trimmed = False
-                            contradictory = False
-                            print(key1, "softclipped_mutation_allMates", softclipped_mutation_allMates)
-                        # information of both mates available --> only one mate softclipped
-                        elif (((ratio1 & ratio4 & (ratio_dist_start1 | ratio_dist_end1) & (ratio_dist_start4 | ratio_dist_end4)) |
-                               (ratio2 & ratio3 & (ratio_dist_start2 | ratio_dist_end2) & (ratio_dist_start3 | ratio_dist_end3))) &
-                               all(float(ij) > 0. for ij in [alt1ff, alt2ff, alt3ff, alt4ff])): # all mates available
-                        	# if distance between softclipping and mutation is at start or end of the read smaller than threshold
-                            softclipped_mutation_allMates = False
-                            softclipped_mutation_oneOfTwoMates = True
-                            softclipped_mutation_oneOfTwoSSCS = False
-                            softclipped_mutation_oneMate = False
-                            softclipped_mutation_oneMateOneSSCS = False
-                            alt1ff = 0
-                            alt4ff = 0
-                            alt2ff = 0
-                            alt3ff = 0
-                            trimmed = False
-                            contradictory = False
-                            print(key1, "softclipped_mutation_oneOfTwoMates", softclipped_mutation_oneOfTwoMates)
-                        # information of both mates available --> only one mate softclipped
-                        elif (((ratio1 & (ratio_dist_start1 | ratio_dist_end1)) | (ratio4 & (ratio_dist_start4 | ratio_dist_end4))) &
-                              ((ratio2 & (ratio_dist_start2 | ratio_dist_end2)) | (ratio3 & (ratio_dist_start3 | ratio_dist_end3))) &
-                               all(float(ij) > 0. for ij in [alt1ff, alt2ff, alt3ff, alt4ff])): # all mates available
-                        	# if distance between softclipping and mutation is at start or end of the read smaller than threshold
-                            softclipped_mutation_allMates = False
-                            softclipped_mutation_oneOfTwoMates = False
-                            softclipped_mutation_oneOfTwoSSCS = True
-                            softclipped_mutation_oneMate = False
-                            softclipped_mutation_oneMateOneSSCS = False
-                            alt1ff = 0
-                            alt4ff = 0
-                            alt2ff = 0
-                            alt3ff = 0
-                            trimmed = False
-                            contradictory = False
-                            print(key1, "softclipped_mutation_oneOfTwoSSCS", softclipped_mutation_oneOfTwoSSCS, [alt1ff, alt2ff, alt3ff, alt4ff])
-                        # information of one mate available --> all reads of one mate are softclipped
-                        elif ((ratio1 & ratio4 & (ratio_dist_start1 | ratio_dist_end1) & (ratio_dist_start4 | ratio_dist_end4) &
-                              all(float(ij) < 0. for ij in [alt2ff, alt3ff]) & all(float(ij) > 0. for ij in [alt1ff, alt4ff])) |
-                        	  (ratio2 & ratio3 & (ratio_dist_start2 | ratio_dist_end2) & (ratio_dist_start3 | ratio_dist_end3) &
-                        	  all(float(ij) < 0. for ij in [alt1ff, alt4ff]) & all(float(ij) > 0. for ij in [alt2ff, alt3ff]))): # all mates available
-                        	# if distance between softclipping and mutation is at start or end of the read smaller than threshold
-                            #if ((((len(dist_start_read1) > 0 | len(dist_end_read1) > 0 ) & all(ij <= thr or nm <= thr for ij, nm in zip(dist_start_read1, dist_end_read1))) &
-                        #		((len(dist_start_read4) > 0 | len(dist_end_read4) > 0 ) & all(ij <= thr or nm <= thr for ij, nm in zip(dist_start_read4, dist_end_read4)))) |
-                        #		(((len(dist_start_read2) > 0 | len(dist_end_read2) > 0 ) & all(ij <= thr or nm <= thr for ij, nm in zip(dist_start_read2, dist_end_read2))) &
-                       # 		((len(dist_start_read3) > 0 | len(dist_end_read3) > 0 ) & all(ij <= thr or nm <= thr for ij, nm in zip(dist_start_read3, dist_end_read3))))):
-                            softclipped_mutation_allMates = False
-                            softclipped_mutation_oneOfTwoMates = False
-                            softclipped_mutation_oneOfTwoSSCS = False
-                            softclipped_mutation_oneMate = True
-                            softclipped_mutation_oneMateOneSSCS = False
-                            alt1ff = 0
-                            alt4ff = 0
-                            alt2ff = 0
-                            alt3ff = 0
-                            trimmed = False
-                            contradictory = False
-                            print(key1, "softclipped_mutation_oneMate", softclipped_mutation_oneMate)
-                        # information of one mate available --> only one SSCS is softclipped
-                        elif ((((ratio1 & (ratio_dist_start1 | ratio_dist_end1)) | (ratio4 & (ratio_dist_start4 | ratio_dist_end4))) &
-                              (all(float(ij) < 0. for ij in [alt2ff, alt3ff]) & all(float(ij) > 0. for ij in [alt1ff, alt4ff]))) |
-                        	  (((ratio2 & (ratio_dist_start2 | ratio_dist_end2)) | (ratio3 & (ratio_dist_start3 | ratio_dist_end3))) &
-                        	  (all(float(ij) < 0. for ij in [alt1ff, alt4ff]) & all(float(ij) < 0. for ij in [alt2ff, alt3ff])))): # all mates available
-                        	# if distance between softclipping and mutation is at start or end of the read smaller than threshold
-                            #if ((all(ij <= thr or nm <= thr for ij, nm in zip(dist_start_read1, dist_end_read1)) |
-                        	#	all(ij <= thr or nm <= thr for ij, nm in zip(dist_start_read4, dist_end_read4))) |
-                        #		(all(ij <= thr or nm <= thr for ij, nm in zip(dist_start_read2, dist_end_read2)) |
-                       # 		all(ij <= thr or nm <= thr for ij, nm in zip(dist_start_read3, dist_end_read3)))):
-                            softclipped_mutation_allMates = False
-                            softclipped_mutation_oneOfTwoMates = False
-                            softclipped_mutation_oneOfTwoSSCS = False
-                            softclipped_mutation_oneMate = False
-                            softclipped_mutation_oneMateOneSSCS = True
-                            alt1ff = 0
-                            alt4ff = 0
-                            alt2ff = 0
-                            alt3ff = 0
-                            trimmed = False
-                            contradictory = False
-                            print(key1, "softclipped_mutation_oneMateOneSSCS", softclipped_mutation_oneMateOneSSCS)
-
                         else:
                             if ((read_pos1 >= 0) and ((read_pos1 <= trim) | (abs(read_len_median1 - read_pos1) <= trim))):
                                 beg1 = total1new
@@ -825,69 +535,47 @@
                             details2 = (total2, total3, total2new, total3new, ref2, ref3, alt2, alt3, ref2f, ref3f, alt2f, alt3f, na2, na3, lowq2, lowq3, beg2, beg3)
 
                         # assign tiers
-                        if ((all(int(ij) >= 3 for ij in [total1new, total4new]) &
-                             all(float(ij) >= 0.75 for ij in [alt1ff, alt4ff])) |
-                            (all(int(ij) >= 3 for ij in [total2new, total3new]) &
-                             all(float(ij) >= 0.75 for ij in [alt2ff, alt3ff]))):
+                        if ((all(int(ij) >= 3 for ij in [total1new, total4new]) & all(float(ij) >= 0.75 for ij in [alt1ff, alt4ff])) | (all(int(ij) >= 3 for ij in [total2new, total3new]) & all(float(ij) >= 0.75 for ij in [alt2ff, alt3ff]))):
                             tier = "1.1"
                             counter_tier11 += 1
                             tier_dict[key1]["tier 1.1"] += 1
 
-                        elif (all(int(ij) >= 1 for ij in [total1new, total2new, total3new, total4new]) &
-                              any(int(ij) >= 3 for ij in [total1new, total4new]) &
-                              any(int(ij) >= 3 for ij in [total2new, total3new]) &
-                              all(float(ij) >= 0.75 for ij in [alt1ff, alt2ff, alt3ff, alt4ff])):
+                        elif (all(int(ij) >= 1 for ij in [total1new, total2new, total3new, total4new]) & any(int(ij) >= 3 for ij in [total1new, total4new])
+                              & any(int(ij) >= 3 for ij in [total2new, total3new]) & all(float(ij) >= 0.75 for ij in [alt1ff, alt2ff, alt3ff, alt4ff])):
                             tier = "1.2"
                             counter_tier12 += 1
                             tier_dict[key1]["tier 1.2"] += 1
 
-                        elif ((all(int(ij) >= 1 for ij in [total1new, total4new]) &
-                               any(int(ij) >= 3 for ij in [total1new, total4new]) &
-                               all(float(ij) >= 0.75 for ij in [alt1ff, alt4ff])) |
-                              (all(int(ij) >= 1 for ij in [total2new, total3new]) &
-                               any(int(ij) >= 3 for ij in [total2new, total3new]) &
-                               all(float(ij) >= 0.75 for ij in [alt2ff, alt3ff]))):
+                        elif ((all(int(ij) >= 1 for ij in [total1new, total4new]) & any(int(ij) >= 3 for ij in [total1new, total4new]) & all(float(ij) >= 0.75 for ij in [alt1ff, alt4ff]))
+                              | (all(int(ij) >= 1 for ij in [total2new, total3new]) & any(int(ij) >= 3 for ij in [total2new, total3new]) & all(float(ij) >= 0.75 for ij in [alt2ff, alt3ff]))):
                             tier = "2.1"
                             counter_tier21 += 1
                             tier_dict[key1]["tier 2.1"] += 1
 
-                        elif (all(int(ij) >= 1 for ij in [total1new, total2new, total3new, total4new]) &
-                              all(float(ij) >= 0.75 for ij in [alt1ff, alt2ff, alt3ff, alt4ff])):
+                        elif (all(int(ij) >= 1 for ij in [total1new, total2new, total3new, total4new]) & all(float(ij) >= 0.75 for ij in [alt1ff, alt2ff, alt3ff, alt4ff])):
                             tier = "2.2"
                             counter_tier22 += 1
                             tier_dict[key1]["tier 2.2"] += 1
 
-                        elif ((all(int(ij) >= 1 for ij in [total1new, total4new]) &
-                               any(int(ij) >= 3 for ij in [total2new, total3new]) &
-                               all(float(ij) >= 0.75 for ij in [alt1ff, alt4ff]) &
-                               any(float(ij) >= 0.75 for ij in [alt2ff, alt3ff])) |
-                              (all(int(ij) >= 1 for ij in [total2new, total3new]) &
-                               any(int(ij) >= 3 for ij in [total1new, total4new]) &
-                               all(float(ij) >= 0.75 for ij in [alt2ff, alt3ff]) &
-                               any(float(ij) >= 0.75 for ij in [alt1ff, alt4ff]))):
+                        elif ((all(int(ij) >= 1 for ij in [total1new, total4new]) & any(int(ij) >= 3 for ij in [total2new, total3new]) & all(float(ij) >= 0.75 for ij in [alt1ff, alt4ff]) & any(float(ij) >= 0.75 for ij in [alt2ff, alt3ff]))
+                              | (all(int(ij) >= 1 for ij in [total2new, total3new]) & any(int(ij) >= 3 for ij in [total1new, total4new]) & all(float(ij) >= 0.75 for ij in [alt2ff, alt3ff]) & any(float(ij) >= 0.75 for ij in [alt1ff, alt4ff]))):
                             tier = "2.3"
                             counter_tier23 += 1
                             tier_dict[key1]["tier 2.3"] += 1
 
-                        elif ((all(int(ij) >= 1 for ij in [total1new, total4new]) &
-                               all(float(ij) >= 0.75 for ij in [alt1ff, alt4ff])) |
-                              (all(int(ij) >= 1 for ij in [total2new, total3new]) &
-                               all(float(ij) >= 0.75 for ij in [alt2ff, alt3ff]))):
+                        elif ((all(int(ij) >= 1 for ij in [total1new, total4new]) & all(float(ij) >= 0.75 for ij in [alt1ff, alt4ff]))
+                              | (all(int(ij) >= 1 for ij in [total2new, total3new]) & all(float(ij) >= 0.75 for ij in [alt2ff, alt3ff]))):
                             tier = "2.4"
                             counter_tier24 += 1
                             tier_dict[key1]["tier 2.4"] += 1
 
-                        elif ((len(pure_tags_dict_short[key1]) > 1) &
-                              (all(float(ij) >= 0.5 for ij in [alt1ff, alt4ff]) |
-                               all(float(ij) >= 0.5 for ij in [alt2ff, alt3ff]))):
+                        elif ((len(pure_tags_dict_short[key1]) > 1) & (all(float(ij) >= 0.5 for ij in [alt1ff, alt4ff]) | all(float(ij) >= 0.5 for ij in [alt2ff, alt3ff]))):
                             tier = "3.1"
                             counter_tier31 += 1
                             tier_dict[key1]["tier 3.1"] += 1
 
-                        elif ((all(int(ij) >= 1 for ij in [total1new, total4new]) &
-                               all(float(ij) >= 0.5 for ij in [alt1ff, alt4ff])) |
-                              (all(int(ij) >= 1 for ij in [total2new, total3new]) &
-                               all(float(ij) >= 0.5 for ij in [alt2ff, alt3ff]))):
+                        elif ((all(int(ij) >= 1 for ij in [total1new, total4new]) & all(float(ij) >= 0.5 for ij in [alt1ff, alt4ff]))
+                              | (all(int(ij) >= 1 for ij in [total2new, total3new]) & all(float(ij) >= 0.5 for ij in [alt2ff, alt3ff]))):
                             tier = "3.2"
                             counter_tier32 += 1
                             tier_dict[key1]["tier 3.2"] += 1
@@ -902,38 +590,13 @@
                             counter_tier42 += 1
                             tier_dict[key1]["tier 4.2"] += 1
 
-                        elif softclipped_mutation_allMates:
-                            tier = "5.1"
-                            counter_tier51 += 1
-                            tier_dict[key1]["tier 5.1"] += 1
-
-                        elif softclipped_mutation_oneOfTwoMates:
-                            tier = "5.2"
-                            counter_tier52 += 1
-                            tier_dict[key1]["tier 5.2"] += 1
-
-                        elif softclipped_mutation_oneOfTwoSSCS:
-                            tier = "5.3"
-                            counter_tier53 += 1
-                            tier_dict[key1]["tier 5.3"] += 1
-
-                        elif softclipped_mutation_oneMate:
-                            tier = "5.4"
-                            counter_tier54 += 1
-                            tier_dict[key1]["tier 5.4"] += 1
-
-                        elif softclipped_mutation_oneMateOneSSCS:
-                            tier = "5.5"
-                            counter_tier55 += 1
-                            tier_dict[key1]["tier 5.5"] += 1
-
                         else:
-                            tier = "6"
-                            counter_tier6 += 1
-                            tier_dict[key1]["tier 6"] += 1
+                            tier = "5"
+                            counter_tier5 += 1
+                            tier_dict[key1]["tier 5"] += 1
 
                         chrom, pos, ref_a, alt_a = re.split(r'\#', key1)
-                        var_id = '-'.join([chrom, str(int(pos)+1), ref, alt])
+                        var_id = '-'.join([chrom, str(int(pos) + 1), ref, alt])
                         sample_tag = key2[:-5]
                         array2 = np.unique(whole_array)  # remove duplicate sequences to decrease running time
                         # exclude identical tag from array2, to prevent comparison to itself
@@ -962,14 +625,14 @@
                                     half1_mate2 = array2_half2
                                     half2_mate2 = array2_half
                                 # calculate HD of "a" in the tag to all "a's" or "b" in the tag to all "b's"
-                                dist = np.array([sum(itertools.imap(operator.ne, half1_mate1, c)) for c in half1_mate2])
+                                dist = np.array([sum(map(operator.ne, half1_mate1, c)) for c in half1_mate2])
                                 min_index = np.where(dist == dist.min())  # get index of min HD
                                 # get all "b's" of the tag or all "a's" of the tag with minimum HD
                                 min_tag_half2 = half2_mate2[min_index]
                                 min_tag_array2 = array2[min_index]  # get whole tag with min HD
                                 min_value = dist.min()
                                 # calculate HD of "b" to all "b's" or "a" to all "a's"
-                                dist_second_half = np.array([sum(itertools.imap(operator.ne, half2_mate1, e))
+                                dist_second_half = np.array([sum(map(operator.ne, half2_mate1, e))
                                                              for e in min_tag_half2])
 
                                 dist2 = dist_second_half.max()
@@ -980,14 +643,7 @@
                                 if min_value == 0 or dist2 == 0:
                                     min_tags_list_zeros.append(tag)
                                     chimera_tags.append(max_tag)
-                                    # chimeric = True
-                                # else:
-                                    # chimeric = False
 
-                                # if mate_b is False:
-                                #    text = "pos {}: sample tag: {}; HD a = {}; HD b' = {}; similar tag(s): {}; chimeric = {}".format(pos, sample_tag, min_value, dist2, list(max_tag), chimeric)
-                                # else:
-                                #     text = "pos {}: sample tag: {}; HD a' = {}; HD b = {}; similar tag(s): {}; chimeric = {}".format(pos, sample_tag, dist2, min_value, list(max_tag), chimeric)
                                 i += 1
                             chimera_tags = [x for x in chimera_tags if x != []]
                             chimera_tags_new = []
@@ -1027,19 +683,19 @@
                                                {'type': 'formula',
                                                 'criteria': '=OR($B${}="1.1", $B${}="1.2")'.format(row + 1, row + 1),
                                                 'format': format1,
-                                                'multi_range': 'L{}:M{} T{}:U{} B{}'.format(row + 1, row + 2, row + 1, row + 2, row + 1, row + 2)})
+                                                'multi_range': 'L{}:M{} T{}:U{} B{}'.format(row + 1, row + 2, row + 1, row + 2, row + 1)})
                         ws1.conditional_format('L{}:M{}'.format(row + 1, row + 2),
                                                {'type': 'formula',
                                                 'criteria': '=OR($B${}="2.1", $B${}="2.2", $B${}="2.3", $B${}="2.4")'.format(row + 1, row + 1, row + 1, row + 1),
                                                 'format': format3,
-                                                'multi_range': 'L{}:M{} T{}:U{} B{}'.format(row + 1, row + 2, row + 1, row + 2, row + 1, row + 2)})
+                                                'multi_range': 'L{}:M{} T{}:U{} B{}'.format(row + 1, row + 2, row + 1, row + 2, row + 1)})
                         ws1.conditional_format('L{}:M{}'.format(row + 1, row + 2),
                                                {'type': 'formula',
                                                 'criteria': '=$B${}>="3"'.format(row + 1),
                                                 'format': format2,
-                                                'multi_range': 'L{}:M{} T{}:U{} B{}'.format(row + 1, row + 2, row + 1, row + 2, row + 1, row + 2)})
+                                                'multi_range': 'L{}:M{} T{}:U{} B{}'.format(row + 1, row + 2, row + 1, row + 2, row + 1)})
+                        row += 3
 
-                        row += 3
             if chimera_correction:
                 chimeric_dcs_high_tiers = 0
                 chimeric_dcs = 0
@@ -1052,17 +708,18 @@
                     else:
                         chimeric_dcs_high_tiers += high_tiers
                 chimera_dict[key1] = (chimeric_dcs, chimeric_dcs_high_tiers)
+
     # sheet 2
     if chimera_correction:
         header_line2 = ('variant ID', 'cvrg', 'AC alt (all tiers)', 'AF (all tiers)', 'chimeras in AC alt (all tiers)', 'chimera-corrected cvrg', 'chimera-corrected AF (all tiers)', 'cvrg (tiers 1.1-2.4)', 'AC alt (tiers 1.1-2.4)', 'AF (tiers 1.1-2.4)', 'chimeras in AC alt (tiers 1.1-2.4)', 'chimera-corrected cvrg (tiers 1.1-2.4)', 'chimera-corrected AF (tiers 1.1-2.4)', 'AC alt (orginal DCS)', 'AF (original DCS)',
-                    'tier 1.1', 'tier 1.2', 'tier 2.1', 'tier 2.2', 'tier 2.3', 'tier 2.4',
-                    'tier 3.1', 'tier 3.2', 'tier 4.1', 'tier 4.2', 'tier 5.1', 'tier 5.2', 'tier 5.3', 'tier 5.4', 'tier 5.5', 'tier 6', 'AF 1.1-1.2', 'AF 1.1-2.1', 'AF 1.1-2.2',
-                    'AF 1.1-2.3', 'AF 1.1-2.4', 'AF 1.1-3.1', 'AF 1.1-3.2', 'AF 1.1-4.1', 'AF 1.1-4.2', 'AF 1.1-5.1', 'AF 1.1-5.2', 'AF 1.1-5.3', 'AF 1.1-5.4', 'AF 1.1-5.5', 'AF 1.1-6')
+                        'tier 1.1', 'tier 1.2', 'tier 2.1', 'tier 2.2', 'tier 2.3', 'tier 2.4',
+                        'tier 3.1', 'tier 3.2', 'tier 4.1', 'tier 4.2', 'tier 5', 'AF 1.1-1.2', 'AF 1.1-2.1', 'AF 1.1-2.2',
+                        'AF 1.1-2.3', 'AF 1.1-2.4', 'AF 1.1-3.1', 'AF 1.1-3.2', 'AF 1.1-4.1', 'AF 1.1-4.2', 'AF 1.1-5')
     else:
         header_line2 = ('variant ID', 'cvrg', 'AC alt (all tiers)', 'AF (all tiers)', 'cvrg (tiers 1.1-2.4)', 'AC alt (tiers 1.1-2.4)', 'AF (tiers 1.1-2.4)', 'AC alt (orginal DCS)', 'AF (original DCS)',
                         'tier 1.1', 'tier 1.2', 'tier 2.1', 'tier 2.2', 'tier 2.3', 'tier 2.4',
-                        'tier 3.1', 'tier 3.2', 'tier 4.1', 'tier 4.2', 'tier 5.1', 'tier 5.2', 'tier 5.3', 'tier 5.4', 'tier 5.5', 'tier 6', 'AF 1.1-1.2', 'AF 1.1-2.1', 'AF 1.1-2.2',
-                        'AF 1.1-2.3', 'AF 1.1-2.4', 'AF 1.1-3.1', 'AF 1.1-3.2', 'AF 1.1-4.1', 'AF 1.1-4.2', 'AF 1.1-5.1', 'AF 1.1-5.2', 'AF 1.1-5.3', 'AF 1.1-5.4', 'AF 1.1-5.5', 'AF 1.1-6')
+                        'tier 3.1', 'tier 3.2', 'tier 4.1', 'tier 4.2', 'tier 5', 'AF 1.1-1.2', 'AF 1.1-2.1', 'AF 1.1-2.2',
+                        'AF 1.1-2.3', 'AF 1.1-2.4', 'AF 1.1-3.1', 'AF 1.1-3.2', 'AF 1.1-4.1', 'AF 1.1-4.2', 'AF 1.1-5')
 
     ws2.write_row(0, 0, header_line2)
     row = 0
@@ -1078,7 +735,7 @@
             alt_count = cvrg_dict[key1][1]
             cvrg = ref_count + alt_count
 
-            var_id = '-'.join([chrom, str(int(pos)+1), ref, alt])
+            var_id = '-'.join([chrom, str(int(pos) + 1), ref, alt])
             lst = [var_id, cvrg]
             used_tiers = []
             cum_af = []
@@ -1088,8 +745,6 @@
                 if len(used_tiers) > 1:
                     cum = safe_div(sum(used_tiers), cvrg)
                     cum_af.append(cum)
-            if sum(used_tiers) == 0: # skip mutations that are filtered by the VA in the first place
-            	continue
             lst.extend([sum(used_tiers), safe_div(sum(used_tiers), cvrg)])
             if chimera_correction:
                 chimeras_all = chimera_dict[key1][0]
@@ -1114,21 +769,20 @@
             lst = tuple(lst)
             ws2.write_row(row + 1, 0, lst)
             if chimera_correction:
-                ws2.conditional_format('P{}:Q{}'.format(row + 2, row + 2), {'type': 'formula', 'criteria': '=$P$1="tier 1.1"', 'format': format12, 'multi_range': 'P{}:Q{} P1:Q1'.format(row + 2, row + 2)})
-                ws2.conditional_format('R{}:U{}'.format(row + 2, row + 2), {'type': 'formula', 'criteria': '=$R$1="tier 2.1"', 'format': format32, 'multi_range': 'R{}:U{} R1:U1'.format(row + 2, row + 2)})
-                ws2.conditional_format('V{}:AE{}'.format(row + 2, row + 2), {'type': 'formula', 'criteria': '=$V$1="tier 3.1"', 'format': format22, 'multi_range': 'V{}:AE{} V1:AE1'.format(row + 2, row + 2)})
+                ws2.conditional_format('P{}:Q{}'.format(row + 2, row + 2), {'type': 'formula', 'criteria': '=$P$1="tier 1.1"', 'format': format1, 'multi_range': 'P{}:Q{} P1:Q1'.format(row + 2, row + 2)})
+                ws2.conditional_format('R{}:U{}'.format(row + 2, row + 2), {'type': 'formula', 'criteria': '=$R$1="tier 2.1"', 'format': format3, 'multi_range': 'R{}:U{} R1:U1'.format(row + 2, row + 2)})
+                ws2.conditional_format('V{}:Z{}'.format(row + 2, row + 2), {'type': 'formula', 'criteria': '=$V$1="tier 3.1"', 'format': format2, 'multi_range': 'V{}:Z{} V1:Z1'.format(row + 2, row + 2)})
             else:
-                ws2.conditional_format('J{}:K{}'.format(row + 2, row + 2), {'type': 'formula', 'criteria': '=$J$1="tier 1.1"', 'format': format12, 'multi_range': 'J{}:K{} J1:K1'.format(row + 2, row + 2)})
-                ws2.conditional_format('L{}:O{}'.format(row + 2, row + 2), {'type': 'formula', 'criteria': '=$L$1="tier 2.1"', 'format': format32, 'multi_range': 'L{}:O{} L1:O1'.format(row + 2, row + 2)})
-                ws2.conditional_format('P{}:Y{}'.format(row + 2, row + 2), {'type': 'formula', 'criteria': '=$P$1="tier 3.1"', 'format': format22, 'multi_range': 'P{}:Y{} P1:Y1'.format(row + 2, row + 2)})
+                ws2.conditional_format('J{}:K{}'.format(row + 2, row + 2), {'type': 'formula', 'criteria': '=$J$1="tier 1.1"', 'format': format1, 'multi_range': 'J{}:K{} J1:K1'.format(row + 2, row + 2)})
+                ws2.conditional_format('L{}:O{}'.format(row + 2, row + 2), {'type': 'formula', 'criteria': '=$L$1="tier 2.1"', 'format': format3, 'multi_range': 'L{}:O{} L1:O1'.format(row + 2, row + 2)})
+                ws2.conditional_format('P{}:T{}'.format(row + 2, row + 2), {'type': 'formula', 'criteria': '=$P$1="tier 3.1"', 'format': format2, 'multi_range': 'P{}:T{} P1:T1'.format(row + 2, row + 2)})
             row += 1
 
     # sheet 3
     sheet3 = [("tier 1.1", counter_tier11), ("tier 1.2", counter_tier12), ("tier 2.1", counter_tier21),
               ("tier 2.2", counter_tier22), ("tier 2.3", counter_tier23), ("tier 2.4", counter_tier24),
               ("tier 3.1", counter_tier31), ("tier 3.2", counter_tier32), ("tier 4.1", counter_tier41),
-              ("tier 4.2", counter_tier42), ("tier 5.1", counter_tier51), ("tier 5.2", counter_tier52),
-              ("tier 5.3", counter_tier53), ("tier 5.4", counter_tier54), ("tier 5.5", counter_tier55), ("tier 6", counter_tier6)]
+              ("tier 4.2", counter_tier42), ("tier 5", counter_tier5)]
 
     header = ("tier", "count")
     ws3.write_row(0, 0, header)
@@ -1148,21 +802,7 @@
                                 'criteria': '=$A${}>="3"'.format(i + 2),
                                 'format': format2})
 
-    description_tiers = [("Tier 1.1", "both ab and ba SSCS present (>75% of the sites with alternative base) and minimal FS>=3 for both SSCS in at least one mate"), ("", ""),
-                         ("Tier 1.2", "both ab and ba SSCS present (>75% of the sites with alt. base) and mate pair validation (min. FS=1) and minimal FS>=3 for at least one of the SSCS"),
-                         ("Tier 2.1", "both ab and ba SSCS present (>75% of the sites with alt. base) and minimal FS>=3 for at least one of the SSCS in at least one mate"),
-                         ("Tier 2.2", "both ab and ba SSCS present (>75% of the sites with alt. base) and mate pair validation (min. FS=1)"),
-                         ("Tier 2.3", "both ab and ba SSCS present (>75% of the sites with alt. base) and minimal FS=1 for both SSCS in one mate and minimal FS>=3 for at least one of the SSCS in the other mate"),
-                         ("Tier 2.4", "both ab and ba SSCS present (>75% of the sites with alt. base) and minimal FS=1 for both SSCS in at least one mate"),
-                         ("Tier 3.1", "both ab and ba SSCS present (>50% of the sites with alt. base) and recurring mutation on this position"),
-                         ("Tier 3.2", "both ab and ba SSCS present (>50% of the sites with alt. base) and minimal FS>=1 for both SSCS in at least one mate"),
-                         ("Tier 4.1", "variants at the start or end of the reads"), ("Tier 4.2", "mates with contradictory information"),
-                         ("Tier 5.1", "variant is close to softclipping in both mates"),
-                         ("Tier 5.2", "variant is close to softclipping in one of the mates"),
-                         ("Tier 5.3", "variant is close to softclipping in one of the SSCS of both mates"),
-                         ("Tier 5.4", "variant is close to softclipping in one mate (no information of second mate"),
-                         ("Tier 5.5", "variant is close to softclipping in one of the SSCS (no information of the second mate"),
-                         ("Tier 6", "remaining variants")]
+    description_tiers = [("Tier 1.1", "both ab and ba SSCS present (>75% of the sites with alternative base) and minimal FS>=3 for both SSCS in at least one mate"), ("", ""), ("Tier 1.2", "both ab and ba SSCS present (>75% of the sites with alt. base) and mate pair validation (min. FS=1) and minimal FS>=3 for at least one of the SSCS"), ("Tier 2.1", "both ab and ba SSCS present (>75% of the sites with alt. base) and minimal FS>=3 for at least one of the SSCS in at least one mate"), ("Tier 2.2", "both ab and ba SSCS present (>75% of the sites with alt. base) and mate pair validation (min. FS=1)"), ("Tier 2.3", "both ab and ba SSCS present (>75% of the sites with alt. base) and minimal FS=1 for both SSCS in one mate and minimal FS>=3 for at least one of the SSCS in the other mate"), ("Tier 2.4", "both ab and ba SSCS present (>75% of the sites with alt. base) and minimal FS=1 for both SSCS in at least one mate"), ("Tier 3.1", "both ab and ba SSCS present (>50% of the sites with alt. base) and recurring mutation on this position"), ("Tier 3.2", "both ab and ba SSCS present (>50% of the sites with alt. base) and minimal FS>=1 for both SSCS in at least one mate"), ("Tier 4.1", "variants at the start or end of the reads"), ("Tier 4.2", "mates with contradictory information"), ("Tier 5", "remaining variants")]
     examples_tiers = [[("Chr5:5-20000-11068-C-G", "1.1", "AAAAAGATGCCGACTACCTT", "ab1.ba2", "254", "228", "287", "288", "289",
                         "3", "6", "3", "6", "0", "0", "3", "6", "0", "0", "1", "1", "0", "0", "0", "0", "0", "0",
                         "4081", "4098", "5", "10", "", ""),
@@ -1228,15 +868,14 @@
                        ("", "", "TTTTTAAGAATAACCCACAC", "ab2.ba1", "100", "112", "140", "145", "263",
                         "7", "12", "7", "12", "7", "12", "0", "0", "1", "1", "0",
                         "0", "0", "0", "0", "0", "0", "0", "1", "1", "5348", "5350", "", "")],
-                      [("" * 34), ("" * 34)], [("" * 34), ("" * 34)], [("" * 34), ("" * 34)], [("" * 34), ("" * 34)], [("" * 34), ("" * 34)],
-                      [("Chr5:5-20000-13983-G-C", "6", "ATGTTGTGAATAACCCACAC", "ab1.ba2", None, "186", None, "276", "269",
+                      [("Chr5:5-20000-13983-G-C", "5", "ATGTTGTGAATAACCCACAC", "ab1.ba2", None, "186", None, "276", "269",
                         "0", "6", "0", "6", "0", "0", "0", "6", "0", "0", "0", "1", "0", "0", "0", "0", "0",
                         "0", "1", "1", "5348", "5350", "", ""),
                        ("", "", "ATGTTGTGAATAACCCACAC", "ab2.ba1", None, None, None, None,
                         "269", "0", "0", "0", "0", "0", "0", "0", "0", None, None, None, None, "0",
                         "0", "0", "0", "0", "0", "1", "1", "5348", "5350", "", "")]]
 
-    start_row = 20
+    start_row = 15
     ws3.write(start_row, 0, "Description of tiers with examples")
     ws3.write_row(start_row + 1, 0, header_line)
     row = 0
@@ -1245,16 +884,16 @@
         ex = examples_tiers[i]
         for k in range(len(ex)):
             ws3.write_row(start_row + 2 + row + i + k + 2, 0, ex[k])
-        ws3.conditional_format('L{}:M{}'.format(start_row + 2 + row + i + k + 2, start_row + 2 + row + i + k + 3), {'type': 'formula', 'criteria': '=OR($B${}="1.1", $B${}="1.2")'.format(start_row + 2 + row + i + k + 2, start_row + 2 + row + i + k + 2), 'format': format13, 'multi_range': 'L{}:M{} T{}:U{} B{}'.format(start_row + 2 + row + i + k + 2, start_row + 2 + row + i + k + 3, start_row + 2 + row + i + k + 2, start_row + 2 + row + i + k + 3, start_row + 2 + row + i + k + 2, start_row + 2 + row + i + k + 3)})
+        ws3.conditional_format('L{}:M{}'.format(start_row + 2 + row + i + k + 2, start_row + 2 + row + i + k + 3), {'type': 'formula', 'criteria': '=OR($B${}="1.1", $B${}="1.2")'.format(start_row + 2 + row + i + k + 2, start_row + 2 + row + i + k + 2), 'format': format1, 'multi_range': 'L{}:M{} T{}:U{} B{}'.format(start_row + 2 + row + i + k + 2, start_row + 2 + row + i + k + 3, start_row + 2 + row + i + k + 2, start_row + 2 + row + i + k + 3, start_row + 2 + row + i + k + 2)})
         ws3.conditional_format('L{}:M{}'.format(start_row + 2 + row + i + k + 2, start_row + 2 + row + i + k + 3),
                                {'type': 'formula', 'criteria': '=OR($B${}="2.1",$B${}="2.2", $B${}="2.3", $B${}="2.4")'.format(start_row + 2 + row + i + k + 2, start_row + 2 + row + i + k + 2, start_row + 2 + row + i + k + 2, start_row + 2 + row + i + k + 2),
-                                'format': format33,
-                                'multi_range': 'L{}:M{} T{}:U{} B{}'.format(start_row + 2 + row + i + k + 2, start_row + 2 + row + i + k + 3, start_row + 2 + row + i + k + 2, start_row + 2 + row + i + k + 3, start_row + 2 + row + i + k + 2, start_row + 2 + row + i + k + 3)})
+                                'format': format3,
+                                'multi_range': 'L{}:M{} T{}:U{} B{}'.format(start_row + 2 + row + i + k + 2, start_row + 2 + row + i + k + 3, start_row + 2 + row + i + k + 2, start_row + 2 + row + i + k + 3, start_row + 2 + row + i + k + 2)})
         ws3.conditional_format('L{}:M{}'.format(start_row + 2 + row + i + k + 2, start_row + 2 + row + i + k + 3),
                                {'type': 'formula',
                                 'criteria': '=$B${}>="3"'.format(start_row + 2 + row + i + k + 2),
-                                'format': format23,
-                                'multi_range': 'L{}:M{} T{}:U{} B{}'.format(start_row + 2 + row + i + k + 2, start_row + 2 + row + i + k + 3, start_row + 2 + row + i + k + 2, start_row + 2 + row + i + k + 3, start_row + 2 + row + i + k + 2, start_row + 2 + row + i + k + 3)})
+                                'format': format2,
+                                'multi_range': 'L{}:M{} T{}:U{} B{}'.format(start_row + 2 + row + i + k + 2, start_row + 2 + row + i + k + 3, start_row + 2 + row + i + k + 2, start_row + 2 + row + i + k + 3, start_row + 2 + row + i + k + 2)})
         row += 3
     workbook.close()
     workbook2.close()
@@ -1263,4 +902,3 @@
 
 if __name__ == '__main__':
     sys.exit(read2mut(sys.argv))
-