Mercurial > repos > mheinzl > variant_analyzer2
diff read2mut.py @ 0:e5953c54cfb5 draft
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
| author | mheinzl |
|---|---|
| date | Sun, 04 Oct 2020 17:19:39 +0000 |
| parents | |
| children | 9d74f30275c6 |
line wrap: on
line diff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/read2mut.py Sun Oct 04 17:19:39 2020 +0000 @@ -0,0 +1,953 @@ +#!/usr/bin/env python + +"""read2mut.py + +Author -- Gundula Povysil +Contact -- povysil@bioinf.jku.at + +Looks for reads with mutation at known +positions and calculates frequencies and stats. + +======= ========== ================= ================================ +Version Date Author Description +0.2.1 2019-10-27 Gundula Povysil - +======= ========== ================= ================================ + + +USAGE: python read2mut.py --mutFile DCS_Mutations.tabular --bamFile Interesting_Reads.trim.bam + --inputJson tag_count_dict.json --sscsJson SSCS_counts.json + --outputFile mutant_reads_summary_short_trim.xlsx --thresh 10 --phred 20 --trim 10 --chimera_correction + +""" + +from __future__ import division + +import argparse +import json +import operator +import os +import re +import sys + +import numpy as np +import pysam +import xlsxwriter + + +def make_argparser(): + parser = argparse.ArgumentParser(description='Takes a tabular file with mutations, a BAM file and JSON files as input and prints stats about variants to a user specified output file.') + parser.add_argument('--mutFile', + help='TABULAR file with DCS mutations.') + parser.add_argument('--bamFile', + help='BAM file with aligned raw reads of selected tags (FASTQ created by mut2read.py - trimming with Trimmomatic - alignment with bwa).') + parser.add_argument('--inputJson', + help='JSON file with data collected by mut2read.py.') + parser.add_argument('--sscsJson', + help='JSON file with SSCS counts collected by mut2sscs.py.') + parser.add_argument('--outputFile', + help='Output xlsx file of mutation details.') + parser.add_argument('--thresh', type=int, default=0, + help='Integer threshold for displaying mutations. Only mutations occuring less than thresh times are displayed. Default of 0 displays all.') + parser.add_argument('--phred', type=int, default=20, + help='Integer threshold for Phred score. Only reads higher than this threshold are considered. Default 20.') + parser.add_argument('--trim', type=int, default=10, + help='Integer threshold for assigning mutations at start and end of reads to lower tier. Default 10.') + parser.add_argument('--chimera_correction', action="store_true", + help='Add additional tier for chimeric variants and correct the variant frequencies') + + return parser + + +def safe_div(x, y): + if y == 0: + return None + return x / y + + +def read2mut(argv): + parser = make_argparser() + args = parser.parse_args(argv[1:]) + file1 = args.mutFile + file2 = args.bamFile + json_file = args.inputJson + sscs_json = args.sscsJson + outfile = args.outputFile + thresh = args.thresh + phred_score = args.phred + trim = args.trim + chimera_correction = args.chimera_correction + + if os.path.isfile(file1) is False: + sys.exit("Error: Could not find '{}'".format(file1)) + if os.path.isfile(file2) is False: + sys.exit("Error: Could not find '{}'".format(file2)) + if os.path.isfile(json_file) is False: + sys.exit("Error: Could not find '{}'".format(json_file)) + if thresh < 0: + sys.exit("Error: thresh is '{}', but only non-negative integers allowed".format(thresh)) + if phred_score < 0: + sys.exit("Error: phred is '{}', but only non-negative integers allowed".format(phred_score)) + if trim < 0: + sys.exit("Error: trim is '{}', but only non-negative integers allowed".format(thresh)) + + # 1. read mut file + with open(file1, 'r') as mut: + mut_array = np.genfromtxt(mut, skip_header=1, delimiter='\t', comments='#', dtype=str) + + # 2. load dicts + with open(json_file, "r") as f: + (tag_dict, cvrg_dict) = json.load(f) + + with open(sscs_json, "r") as f: + (mut_pos_dict, ref_pos_dict) = json.load(f) + + # 3. read bam file + # pysam.index(file2) + bam = pysam.AlignmentFile(file2, "rb") + + # 4. create mut_dict + mut_dict = {} + mut_read_pos_dict = {} + mut_read_dict = {} + reads_dict = {} + if mut_array.shape == (1, 13): + mut_array = mut_array.reshape((1, len(mut_array))) + + for m in range(0, len(mut_array[:, 0])): + print(str(m + 1) + " of " + str(len(mut_array[:, 0]))) + # for m in range(0, 5): + chrom = mut_array[m, 1] + stop_pos = mut_array[m, 2].astype(int) + chrom_stop_pos = str(chrom) + "#" + str(stop_pos) + ref = mut_array[m, 9] + alt = mut_array[m, 10] + mut_dict[chrom_stop_pos] = {} + mut_read_pos_dict[chrom_stop_pos] = {} + reads_dict[chrom_stop_pos] = {} + + for pileupcolumn in bam.pileup(chrom.tostring(), stop_pos - 2, stop_pos, max_depth=1000000000): + if pileupcolumn.reference_pos == stop_pos - 1: + count_alt = 0 + count_ref = 0 + count_indel = 0 + count_n = 0 + count_other = 0 + count_lowq = 0 + n = 0 + print("unfiltered reads=", pileupcolumn.n, "filtered reads=", len(pileupcolumn.pileups), + "difference= ", len(pileupcolumn.pileups) - pileupcolumn.n) + for pileupread in pileupcolumn.pileups: + n += 1 + if not pileupread.is_del and not pileupread.is_refskip: + tag = pileupread.alignment.query_name + nuc = pileupread.alignment.query_sequence[pileupread.query_position] + phred = ord(pileupread.alignment.qual[pileupread.query_position]) - 33 + if phred < phred_score: + nuc = "lowQ" + if tag not in mut_dict[chrom_stop_pos]: + mut_dict[chrom_stop_pos][tag] = {} + if nuc in mut_dict[chrom_stop_pos][tag]: + mut_dict[chrom_stop_pos][tag][nuc] += 1 + else: + mut_dict[chrom_stop_pos][tag][nuc] = 1 + if tag not in mut_read_pos_dict[chrom_stop_pos]: + mut_read_pos_dict[chrom_stop_pos][tag] = np.array(pileupread.query_position) + 1 + reads_dict[chrom_stop_pos][tag] = len(pileupread.alignment.query_sequence) + else: + mut_read_pos_dict[chrom_stop_pos][tag] = np.append( + mut_read_pos_dict[chrom_stop_pos][tag], pileupread.query_position + 1) + reads_dict[chrom_stop_pos][tag] = np.append( + reads_dict[chrom_stop_pos][tag], len(pileupread.alignment.query_sequence)) + + if nuc == alt: + count_alt += 1 + if tag not in mut_read_dict: + mut_read_dict[tag] = {} + mut_read_dict[tag][chrom_stop_pos] = alt + else: + mut_read_dict[tag][chrom_stop_pos] = alt + elif nuc == ref: + count_ref += 1 + elif nuc == "N": + count_n += 1 + elif nuc == "lowQ": + count_lowq += 1 + else: + count_other += 1 + else: + count_indel += 1 + + print("coverage at pos %s = %s, ref = %s, alt = %s, other bases = %s, N = %s, indel = %s, low quality = %s\n" % (pileupcolumn.pos, count_ref + count_alt, count_ref, count_alt, count_other, count_n, count_indel, count_lowq)) + + for read in bam.fetch(until_eof=True): + if read.is_unmapped: + pure_tag = read.query_name[:-5] + nuc = "na" + for key in tag_dict[pure_tag].keys(): + if key not in mut_dict: + mut_dict[key] = {} + if read.query_name not in mut_dict[key]: + mut_dict[key][read.query_name] = {} + if nuc in mut_dict[key][read.query_name]: + mut_dict[key][read.query_name][nuc] += 1 + else: + mut_dict[key][read.query_name][nuc] = 1 + bam.close() + + # 5. create pure_tags_dict + pure_tags_dict = {} + for key1, value1 in sorted(mut_dict.items()): + i = np.where(np.array(['#'.join(str(i) for i in z) + for z in zip(mut_array[:, 1], mut_array[:, 2])]) == key1)[0][0] + ref = mut_array[i, 9] + alt = mut_array[i, 10] + pure_tags_dict[key1] = {} + for key2, value2 in sorted(value1.items()): + for key3, value3 in value2.items(): + pure_tag = key2[:-5] + if key3 == alt: + if pure_tag in pure_tags_dict[key1]: + pure_tags_dict[key1][pure_tag] += 1 + else: + pure_tags_dict[key1][pure_tag] = 1 + + # 6. create pure_tags_dict_short with thresh + if thresh > 0: + pure_tags_dict_short = {} + for key, value in sorted(pure_tags_dict.items()): + if len(value) < thresh: + pure_tags_dict_short[key] = value + else: + pure_tags_dict_short = pure_tags_dict + + #whole_array = [] + #for k in pure_tags_dict.values(): + # whole_array.extend(k.keys()) + + # 7. output summary with threshold + workbook = xlsxwriter.Workbook(outfile) + ws1 = workbook.add_worksheet("Results") + ws2 = workbook.add_worksheet("Allele frequencies") + ws3 = workbook.add_worksheet("Tiers") + + format1 = workbook.add_format({'bg_color': '#BCF5A9'}) # green + format2 = workbook.add_format({'bg_color': '#FFC7CE'}) # red + format3 = workbook.add_format({'bg_color': '#FACC2E'}) # yellow + + header_line = ('variant ID', 'tier', 'tag', 'mate', 'read pos.ab', 'read pos.ba', 'read median length.ab', + 'read median length.ba', 'DCS median length', + 'FS.ab', 'FS.ba', 'FSqc.ab', 'FSqc.ba', 'ref.ab', 'ref.ba', 'alt.ab', 'alt.ba', + 'rel. ref.ab', 'rel. ref.ba', 'rel. alt.ab', 'rel. alt.ba', + 'na.ab', 'na.ba', 'lowq.ab', 'lowq.ba', 'trim.ab', 'trim.ba', + 'SSCS alt.ab', 'SSCS alt.ba', 'SSCS ref.ab', 'SSCS ref.ba', + 'other mut', 'chimeric tag') + ws1.write_row(0, 0, header_line) + + counter_tier11 = 0 + counter_tier12 = 0 + counter_tier21 = 0 + counter_tier22 = 0 + counter_tier23 = 0 + counter_tier24 = 0 + counter_tier31 = 0 + counter_tier32 = 0 + counter_tier41 = 0 + counter_tier42 = 0 + + if chimera_correction: + counter_tier43 = 0 + + counter_tier5 = 0 + + row = 1 + tier_dict = {} + for key1, value1 in sorted(mut_dict.items()): + counts_mut = 0 + if key1 in pure_tags_dict_short.keys(): + i = np.where(np.array(['#'.join(str(i) for i in z) + for z in zip(mut_array[:, 1], mut_array[:, 2])]) == key1)[0][0] + ref = mut_array[i, 9] + alt = mut_array[i, 10] + dcs_median = cvrg_dict[key1][2] + whole_array = pure_tags_dict_short[key1].keys() + + tier_dict[key1] = {} + if chimera_correction: + values_tier_dict = [("tier 1.1", 0), ("tier 1.2", 0), ("tier 2.1", 0), ("tier 2.2", 0), ("tier 2.3", 0), ("tier 2.4", 0), ("tier 3.1", 0), ("tier 3.2", 0), ("tier 4.1", 0), ("tier 4.2", 0), ("tier 4.3", 0), ("tier 5", 0)] + else: + values_tier_dict = [("tier 1.1", 0), ("tier 1.2", 0), ("tier 2.1", 0), ("tier 2.2", 0), ("tier 2.3", 0), ("tier 2.4", 0), ("tier 3.1", 0), ("tier 3.2", 0), ("tier 4.1", 0), ("tier 4.2", 0), ("tier 5", 0)] + + for k, v in values_tier_dict: + tier_dict[key1][k] = v + + used_keys = [] + if 'ab' in mut_pos_dict[key1].keys(): + sscs_mut_ab = mut_pos_dict[key1]['ab'] + else: + sscs_mut_ab = 0 + if 'ba' in mut_pos_dict[key1].keys(): + sscs_mut_ba = mut_pos_dict[key1]['ba'] + else: + sscs_mut_ba = 0 + if 'ab' in ref_pos_dict[key1].keys(): + sscs_ref_ab = ref_pos_dict[key1]['ab'] + else: + sscs_ref_ab = 0 + if 'ba' in ref_pos_dict[key1].keys(): + sscs_ref_ba = ref_pos_dict[key1]['ba'] + else: + sscs_ref_ba = 0 + for key2, value2 in sorted(value1.items()): + add_mut14 = "" + add_mut23 = "" + if (key2[:-5] in pure_tags_dict_short[key1].keys()) and (key2[:-5] not in used_keys) and (key1 in tag_dict[key2[:-5]].keys()): + if key2[:-5] + '.ab.1' in mut_dict[key1].keys(): + total1 = sum(mut_dict[key1][key2[:-5] + '.ab.1'].values()) + if 'na' in mut_dict[key1][key2[:-5] + '.ab.1'].keys(): + na1 = mut_dict[key1][key2[:-5] + '.ab.1']['na'] + # na1f = na1/total1 + else: + # na1 = na1f = 0 + na1 = 0 + if 'lowQ' in mut_dict[key1][key2[:-5] + '.ab.1'].keys(): + lowq1 = mut_dict[key1][key2[:-5] + '.ab.1']['lowQ'] + # lowq1f = lowq1 / total1 + else: + # lowq1 = lowq1f = 0 + lowq1 = 0 + if ref in mut_dict[key1][key2[:-5] + '.ab.1'].keys(): + ref1 = mut_dict[key1][key2[:-5] + '.ab.1'][ref] + ref1f = ref1 / (total1 - na1 - lowq1) + else: + ref1 = ref1f = 0 + if alt in mut_dict[key1][key2[:-5] + '.ab.1'].keys(): + alt1 = mut_dict[key1][key2[:-5] + '.ab.1'][alt] + alt1f = alt1 / (total1 - na1 - lowq1) + else: + alt1 = alt1f = 0 + total1new = total1 - na1 - lowq1 + if (key2[:-5] + '.ab.1') in mut_read_dict.keys(): + k1 = mut_read_dict[(key2[:-5] + '.ab.1')].keys() + add_mut1 = len(k1) + if add_mut1 > 1: + for k, v in mut_read_dict[(key2[:-5] + '.ab.1')].items(): + if k != key1: + if len(add_mut14) == 0: + add_mut14 = str(k) + "_" + v + else: + add_mut14 = add_mut14 + ", " + str(k) + "_" + v + else: + k1 = [] + else: + total1 = total1new = na1 = lowq1 = 0 + ref1 = alt1 = ref1f = alt1f = 0 + k1 = [] + + if key2[:-5] + '.ab.2' in mut_dict[key1].keys(): + total2 = sum(mut_dict[key1][key2[:-5] + '.ab.2'].values()) + if 'na' in mut_dict[key1][key2[:-5] + '.ab.2'].keys(): + na2 = mut_dict[key1][key2[:-5] + '.ab.2']['na'] + # na2f = na2 / total2 + else: + # na2 = na2f = 0 + na2 = 0 + if 'lowQ' in mut_dict[key1][key2[:-5] + '.ab.2'].keys(): + lowq2 = mut_dict[key1][key2[:-5] + '.ab.2']['lowQ'] + # lowq2f = lowq2 / total2 + else: + # lowq2 = lowq2f = 0 + lowq2 = 0 + if ref in mut_dict[key1][key2[:-5] + '.ab.2'].keys(): + ref2 = mut_dict[key1][key2[:-5] + '.ab.2'][ref] + ref2f = ref2 / (total2 - na2 - lowq2) + else: + ref2 = ref2f = 0 + if alt in mut_dict[key1][key2[:-5] + '.ab.2'].keys(): + alt2 = mut_dict[key1][key2[:-5] + '.ab.2'][alt] + alt2f = alt2 / (total2 - na2 - lowq2) + else: + alt2 = alt2f = 0 + total2new = total2 - na2 - lowq2 + if (key2[:-5] + '.ab.2') in mut_read_dict.keys(): + k2 = mut_read_dict[(key2[:-5] + '.ab.2')].keys() + add_mut2 = len(k2) + if add_mut2 > 1: + for k, v in mut_read_dict[(key2[:-5] + '.ab.2')].items(): + if k != key1: + if len(add_mut23) == 0: + add_mut23 = str(k) + "_" + v + else: + add_mut23 = add_mut23 + ", " + str(k) + "_" + v + else: + k2 = [] + else: + total2 = total2new = na2 = lowq2 = 0 + ref2 = alt2 = ref2f = alt2f = 0 + k2 = [] + + if key2[:-5] + '.ba.1' in mut_dict[key1].keys(): + total3 = sum(mut_dict[key1][key2[:-5] + '.ba.1'].values()) + if 'na' in mut_dict[key1][key2[:-5] + '.ba.1'].keys(): + na3 = mut_dict[key1][key2[:-5] + '.ba.1']['na'] + # na3f = na3 / total3 + else: + # na3 = na3f = 0 + na3 = 0 + if 'lowQ' in mut_dict[key1][key2[:-5] + '.ba.1'].keys(): + lowq3 = mut_dict[key1][key2[:-5] + '.ba.1']['lowQ'] + # lowq3f = lowq3 / total3 + else: + # lowq3 = lowq3f = 0 + lowq3 = 0 + if ref in mut_dict[key1][key2[:-5] + '.ba.1'].keys(): + ref3 = mut_dict[key1][key2[:-5] + '.ba.1'][ref] + ref3f = ref3 / (total3 - na3 - lowq3) + else: + ref3 = ref3f = 0 + if alt in mut_dict[key1][key2[:-5] + '.ba.1'].keys(): + alt3 = mut_dict[key1][key2[:-5] + '.ba.1'][alt] + alt3f = alt3 / (total3 - na3 - lowq3) + else: + alt3 = alt3f = 0 + total3new = total3 - na3 - lowq3 + if (key2[:-5] + '.ba.1') in mut_read_dict.keys(): + add_mut3 = len(mut_read_dict[(key2[:-5] + '.ba.1')].keys()) + if add_mut3 > 1: + for k, v in mut_read_dict[(key2[:-5] + '.ba.1')].items(): + if k != key1 and k not in k2: + if len(add_mut23) == 0: + add_mut23 = str(k) + "_" + v + else: + add_mut23 = add_mut23 + ", " + str(k) + "_" + v + else: + total3 = total3new = na3 = lowq3 = 0 + ref3 = alt3 = ref3f = alt3f = 0 + + if key2[:-5] + '.ba.2' in mut_dict[key1].keys(): + total4 = sum(mut_dict[key1][key2[:-5] + '.ba.2'].values()) + if 'na' in mut_dict[key1][key2[:-5] + '.ba.2'].keys(): + na4 = mut_dict[key1][key2[:-5] + '.ba.2']['na'] + # na4f = na4 / total4 + else: + # na4 = na4f = 0 + na4 = 0 + if 'lowQ' in mut_dict[key1][key2[:-5] + '.ba.2'].keys(): + lowq4 = mut_dict[key1][key2[:-5] + '.ba.2']['lowQ'] + # lowq4f = lowq4 / total4 + else: + # lowq4 = lowq4f = 0 + lowq4 = 0 + if ref in mut_dict[key1][key2[:-5] + '.ba.2'].keys(): + ref4 = mut_dict[key1][key2[:-5] + '.ba.2'][ref] + ref4f = ref4 / (total4 - na4 - lowq4) + else: + ref4 = ref4f = 0 + if alt in mut_dict[key1][key2[:-5] + '.ba.2'].keys(): + alt4 = mut_dict[key1][key2[:-5] + '.ba.2'][alt] + alt4f = alt4 / (total4 - na4 - lowq4) + else: + alt4 = alt4f = 0 + total4new = total4 - na4 - lowq4 + if (key2[:-5] + '.ba.2') in mut_read_dict.keys(): + add_mut4 = len(mut_read_dict[(key2[:-5] + '.ba.2')].keys()) + if add_mut4 > 1: + for k, v in mut_read_dict[(key2[:-5] + '.ba.2')].items(): + if k != key1 and k not in k1: + if len(add_mut14) == 0: + add_mut14 = str(k) + "_" + v + else: + add_mut14 = add_mut14 + ", " + str(k) + "_" + v + else: + total4 = total4new = na4 = lowq4 = 0 + ref4 = alt4 = ref4f = alt4f = 0 + + read_pos1 = read_pos2 = read_pos3 = read_pos4 = -1 + read_len_median1 = read_len_median2 = read_len_median3 = read_len_median4 = 0 + + if key2[:-5] + '.ab.1' in mut_read_pos_dict[key1].keys(): + read_pos1 = np.median(mut_read_pos_dict[key1][key2[:-5] + '.ab.1']) + read_len_median1 = np.median(reads_dict[key1][key2[:-5] + '.ab.1']) + if key2[:-5] + '.ab.2' in mut_read_pos_dict[key1].keys(): + read_pos2 = np.median(mut_read_pos_dict[key1][key2[:-5] + '.ab.2']) + read_len_median2 = np.median(reads_dict[key1][key2[:-5] + '.ab.2']) + if key2[:-5] + '.ba.1' in mut_read_pos_dict[key1].keys(): + read_pos3 = np.median(mut_read_pos_dict[key1][key2[:-5] + '.ba.1']) + read_len_median3 = np.median(reads_dict[key1][key2[:-5] + '.ba.1']) + if key2[:-5] + '.ba.2' in mut_read_pos_dict[key1].keys(): + read_pos4 = np.median(mut_read_pos_dict[key1][key2[:-5] + '.ba.2']) + read_len_median4 = np.median(reads_dict[key1][key2[:-5] + '.ba.2']) + + used_keys.append(key2[:-5]) + counts_mut += 1 + if (alt1f + alt2f + alt3f + alt4f) > 0.5: + if total1new == 0: + ref1f = alt1f = None + alt1ff = -1 + else: + alt1ff = alt1f + if total2new == 0: + ref2f = alt2f = None + alt2ff = -1 + else: + alt2ff = alt2f + if total3new == 0: + ref3f = alt3f = None + alt3ff = -1 + else: + alt3ff = alt3f + if total4new == 0: + ref4f = alt4f = None + alt4ff = -1 + else: + alt4ff = alt4f + + beg1 = beg4 = beg2 = beg3 = 0 + + details1 = (total1, total4, total1new, total4new, ref1, ref4, alt1, alt4, ref1f, ref4f, alt1f, alt4f, na1, na4, lowq1, lowq4, beg1, beg4) + details2 = (total2, total3, total2new, total3new, ref2, ref3, alt2, alt3, ref2f, ref3f, alt2f, alt3f, na2, na3, lowq2, lowq3, beg2, beg3) + + chrom, pos = re.split(r'\#', key1) + var_id = '-'.join([chrom, pos, ref, alt]) + sample_tag = key2[:-5] + array2 = np.unique(whole_array) # remove duplicate sequences to decrease running time + # exclude identical tag from array2, to prevent comparison to itself + same_tag = np.where(array2 == sample_tag) + index_array2 = np.arange(0, len(array2), 1) + index_withoutSame = np.delete(index_array2, same_tag) # delete identical tag from the data + array2 = array2[index_withoutSame] + if len(array2) != 0: # only perform chimera analysis if there is more than 1 variant + array1_half = sample_tag[0:int(len(sample_tag) / 2)] # mate1 part1 + array1_half2 = sample_tag[int(len(sample_tag) / 2):int(len(sample_tag))] # mate1 part 2 + array2_half = np.array([ii[0:int(len(ii) / 2)] for ii in array2]) # mate2 part1 + array2_half2 = np.array([ii[int(len(ii) / 2):int(len(ii))] for ii in array2]) # mate2 part2 + + min_tags_list_zeros = [] + chimera_tags = [] + for mate_b in [False, True]: + i = 0 # counter, only used to see how many HDs of tags were already calculated + if mate_b is False: # HD calculation for all a's + half1_mate1 = array1_half + half2_mate1 = array1_half2 + half1_mate2 = array2_half + half2_mate2 = array2_half2 + elif mate_b is True: # HD calculation for all b's + half1_mate1 = array1_half2 + half2_mate1 = array1_half + half1_mate2 = array2_half2 + half2_mate2 = array2_half + # calculate HD of "a" in the tag to all "a's" or "b" in the tag to all "b's" + dist = np.array([sum(map(operator.ne, half1_mate1, c)) for c in half1_mate2]) + min_index = np.where(dist == dist.min()) # get index of min HD + # get all "b's" of the tag or all "a's" of the tag with minimum HD + min_tag_half2 = half2_mate2[min_index] + min_tag_array2 = array2[min_index] # get whole tag with min HD + min_value = dist.min() + # calculate HD of "b" to all "b's" or "a" to all "a's" + dist_second_half = np.array([sum(map(operator.ne, half2_mate1, e)) + for e in min_tag_half2]) + + dist2 = dist_second_half.max() + max_index = np.where(dist_second_half == dist_second_half.max())[0] # get index of max HD + max_tag = min_tag_array2[max_index] + + # tags which have identical parts: + if min_value == 0 or dist2 == 0: + min_tags_list_zeros.append(tag) + chimera_tags.append(max_tag) + # chimeric = True + # else: + # chimeric = False + + # if mate_b is False: + # text = "pos {}: sample tag: {}; HD a = {}; HD b' = {}; similar tag(s): {}; chimeric = {}".format(pos, sample_tag, min_value, dist2, list(max_tag), chimeric) + # else: + # text = "pos {}: sample tag: {}; HD a' = {}; HD b = {}; similar tag(s): {}; chimeric = {}".format(pos, sample_tag, dist2, min_value, list(max_tag), chimeric) + i += 1 + chimera_tags = [x for x in chimera_tags if x != []] + chimera_tags_new = [] + for i in chimera_tags: + if len(i) > 1: + for t in i: + chimera_tags_new.append(t) + else: + chimera_tags_new.extend(i) + chimera_tags_new = np.asarray(chimera_tags_new) + chimera = ", ".join(chimera_tags_new) + else: + chimera_tags_new = [] + chimera = "" + + trimmed = False + contradictory = False + chimeric_dcs = False + + if chimera_correction and len(chimera_tags_new) > 0: # chimeras + alt1ff = 0 + alt4ff = 0 + alt2ff = 0 + alt3ff = 0 + chimeric_dcs = True + trimmed = False + contradictory = False + elif ((all(float(ij) >= 0.5 for ij in [alt1ff, alt4ff]) & # contradictory variant + all(float(ij) == 0. for ij in [alt2ff, alt3ff])) | + (all(float(ij) >= 0.5 for ij in [alt2ff, alt3ff]) & + all(float(ij) == 0. for ij in [alt1ff, alt4ff]))): + alt1ff = 0 + alt4ff = 0 + alt2ff = 0 + alt3ff = 0 + trimmed = False + contradictory = True + chimeric_dcs = False + else: + if ((read_pos1 >= 0) and ((read_pos1 <= trim) | (abs(read_len_median1 - read_pos1) <= trim))): + beg1 = total1new + total1new = 0 + alt1ff = 0 + alt1f = 0 + trimmed = True + + if ((read_pos4 >= 0) and ((read_pos4 <= trim) | (abs(read_len_median4 - read_pos4) <= trim))): + beg4 = total4new + total4new = 0 + alt4ff = 0 + alt4f = 0 + trimmed = True + + if ((read_pos2 >= 0) and ((read_pos2 <= trim) | (abs(read_len_median2 - read_pos2) <= trim))): + beg2 = total2new + total2new = 0 + alt2ff = 0 + alt2f = 0 + trimmed = True + + if ((read_pos3 >= 0) and ((read_pos3 <= trim) | (abs(read_len_median3 - read_pos3) <= trim))): + beg3 = total3new + total3new = 0 + alt3ff = 0 + alt3f = 0 + trimmed = True + details1 = (total1, total4, total1new, total4new, ref1, ref4, alt1, alt4, ref1f, ref4f, alt1f, alt4f, na1, na4, lowq1, lowq4, beg1, beg4) + details2 = (total2, total3, total2new, total3new, ref2, ref3, alt2, alt3, ref2f, ref3f, alt2f, alt3f, na2, na3, lowq2, lowq3, beg2, beg3) + + # assign tiers + if ((all(int(ij) >= 3 for ij in [total1new, total4new]) & + all(float(ij) >= 0.75 for ij in [alt1ff, alt4ff])) | + (all(int(ij) >= 3 for ij in [total2new, total3new]) & + all(float(ij) >= 0.75 for ij in [alt2ff, alt3ff]))): + tier = "1.1" + counter_tier11 += 1 + tier_dict[key1]["tier 1.1"] += 1 + + elif (all(int(ij) >= 1 for ij in [total1new, total2new, total3new, total4new]) & + any(int(ij) >= 3 for ij in [total1new, total4new]) & + any(int(ij) >= 3 for ij in [total2new, total3new]) & + all(float(ij) >= 0.75 for ij in [alt1ff, alt2ff, alt3ff, alt4ff])): + tier = "1.2" + counter_tier12 += 1 + tier_dict[key1]["tier 1.2"] += 1 + + elif ((all(int(ij) >= 1 for ij in [total1new, total4new]) & + any(int(ij) >= 3 for ij in [total1new, total4new]) & + all(float(ij) >= 0.75 for ij in [alt1ff, alt4ff])) | + (all(int(ij) >= 1 for ij in [total2new, total3new]) & + any(int(ij) >= 3 for ij in [total2new, total3new]) & + all(float(ij) >= 0.75 for ij in [alt2ff, alt3ff]))): + tier = "2.1" + counter_tier21 += 1 + tier_dict[key1]["tier 2.1"] += 1 + + elif (all(int(ij) >= 1 for ij in [total1new, total2new, total3new, total4new]) & + all(float(ij) >= 0.75 for ij in [alt1ff, alt2ff, alt3ff, alt4ff])): + tier = "2.2" + counter_tier22 += 1 + tier_dict[key1]["tier 2.2"] += 1 + + elif ((all(int(ij) >= 1 for ij in [total1new, total4new]) & + any(int(ij) >= 3 for ij in [total2new, total3new]) & + all(float(ij) >= 0.75 for ij in [alt1ff, alt4ff]) & + any(float(ij) >= 0.75 for ij in [alt2ff, alt3ff])) | + (all(int(ij) >= 1 for ij in [total2new, total3new]) & + any(int(ij) >= 3 for ij in [total1new, total4new]) & + all(float(ij) >= 0.75 for ij in [alt2ff, alt3ff]) & + any(float(ij) >= 0.75 for ij in [alt1ff, alt4ff]))): + tier = "2.3" + counter_tier23 += 1 + tier_dict[key1]["tier 2.3"] += 1 + + elif ((all(int(ij) >= 1 for ij in [total1new, total4new]) & + all(float(ij) >= 0.75 for ij in [alt1ff, alt4ff])) | + (all(int(ij) >= 1 for ij in [total2new, total3new]) & + all(float(ij) >= 0.75 for ij in [alt2ff, alt3ff]))): + tier = "2.4" + counter_tier24 += 1 + tier_dict[key1]["tier 2.4"] += 1 + + elif ((len(pure_tags_dict_short[key1]) > 1) & + (all(float(ij) >= 0.5 for ij in [alt1ff, alt4ff]) | + all(float(ij) >= 0.5 for ij in [alt2ff, alt3ff]))): + tier = "3.1" + counter_tier31 += 1 + tier_dict[key1]["tier 3.1"] += 1 + + elif ((all(int(ij) >= 1 for ij in [total1new, total4new]) & + all(float(ij) >= 0.5 for ij in [alt1ff, alt4ff])) | + (all(int(ij) >= 1 for ij in [total2new, total3new]) & + all(float(ij) >= 0.5 for ij in [alt2ff, alt3ff]))): + tier = "3.2" + counter_tier32 += 1 + tier_dict[key1]["tier 3.2"] += 1 + + elif (trimmed): + tier = "4.1" + counter_tier41 += 1 + tier_dict[key1]["tier 4.1"] += 1 + + elif (contradictory): + tier = "4.2" + counter_tier42 += 1 + tier_dict[key1]["tier 4.2"] += 1 + + elif chimera_correction and chimeric_dcs: + tier = "4.3" + counter_tier43 += 1 + tier_dict[key1]["tier 4.3"] += 1 + + else: + tier = "5" + counter_tier5 += 1 + tier_dict[key1]["tier 5"] += 1 + + if (read_pos1 == -1): + read_pos1 = read_len_median1 = None + if (read_pos4 == -1): + read_pos4 = read_len_median4 = None + if (read_pos2 == -1): + read_pos2 = read_len_median2 = None + if (read_pos3 == -1): + read_pos3 = read_len_median3 = None + line = (var_id, tier, key2[:-5], 'ab1.ba2', read_pos1, read_pos4, read_len_median1, read_len_median4, dcs_median) + details1 + (sscs_mut_ab, sscs_mut_ba, sscs_ref_ab, sscs_ref_ba, add_mut14, chimera) + ws1.write_row(row, 0, line) + line = ("", "", key2[:-5], 'ab2.ba1', read_pos2, read_pos3, read_len_median2, read_len_median3, dcs_median) + details2 + (sscs_mut_ab, sscs_mut_ba, sscs_ref_ab, sscs_ref_ba, add_mut23, chimera) + ws1.write_row(row + 1, 0, line) + + ws1.conditional_format('L{}:M{}'.format(row + 1, row + 2), + {'type': 'formula', + 'criteria': '=OR($B${}="1.1", $B${}="1.2")'.format(row + 1, row + 1), + 'format': format1, + 'multi_range': 'L{}:M{} T{}:U{} B{}'.format(row + 1, row + 2, row + 1, row + 2, row + 1, row + 2)}) + ws1.conditional_format('L{}:M{}'.format(row + 1, row + 2), + {'type': 'formula', + 'criteria': '=OR($B${}="2.1", $B${}="2.2", $B${}="2.3", $B${}="2.4")'.format(row + 1, row + 1, row + 1, row + 1), + 'format': format3, + 'multi_range': 'L{}:M{} T{}:U{} B{}'.format(row + 1, row + 2, row + 1, row + 2, row + 1, row + 2)}) + ws1.conditional_format('L{}:M{}'.format(row + 1, row + 2), + {'type': 'formula', + 'criteria': '=$B${}>="3"'.format(row + 1), + 'format': format2, + 'multi_range': 'L{}:M{} T{}:U{} B{}'.format(row + 1, row + 2, row + 1, row + 2, row + 1, row + 2)}) + + row += 3 + + if chimera_correction: + header_line2 = ('variant ID', 'cvrg', 'AC alt (all tiers)', 'AF (all tiers)', 'cvrg (tiers 1.1-2.4)', 'AC alt (tiers 1.1-2.4)', 'AF (tiers 1.1-2.4)', 'AC alt (orginal DCS)', 'AF (original DCS)', + 'tier 1.1', 'tier 1.2', 'tier 2.1', 'tier 2.2', 'tier 2.3', 'tier 2.4', + 'tier 3.1', 'tier 3.2', 'tier 4.1', 'tier 4.2', 'tier 4.3', 'tier 5', 'AF 1.1-1.2', 'AF 1.1-2.1', 'AF 1.1-2.2', + 'AF 1.1-2.3', 'AF 1.1-2.4', 'AF 1.1-3.1', 'AF 1.1-3.2', 'AF 1.1-4.1', 'AF 1.1-4.2', 'AF 1.1-4.3', 'AF 1.1-5') + else: + header_line2 = ('variant ID', 'cvrg', 'AC alt (all tiers)', 'AF (all tiers)', 'cvrg (tiers 1.1-2.4)', 'AC alt (tiers 1.1-2.4)', 'AF (tiers 1.1-2.4)', 'AC alt (orginal DCS)', 'AF (original DCS)', + 'tier 1.1', 'tier 1.2', 'tier 2.1', 'tier 2.2', 'tier 2.3', 'tier 2.4', + 'tier 3.1', 'tier 3.2', 'tier 4.1', 'tier 4.2', 'tier 5', 'AF 1.1-1.2', 'AF 1.1-2.1', 'AF 1.1-2.2', + 'AF 1.1-2.3', 'AF 1.1-2.4', 'AF 1.1-3.1', 'AF 1.1-3.2', 'AF 1.1-4.1', 'AF 1.1-4.2', 'AF 1.1-5') + + ws2.write_row(0, 0, header_line2) + row = 0 + + for key1, value1 in sorted(tier_dict.items()): + if key1 in pure_tags_dict_short.keys(): + i = np.where(np.array(['#'.join(str(i) for i in z) + for z in zip(mut_array[:, 1], mut_array[:, 2])]) == key1)[0][0] + ref = mut_array[i, 9] + alt = mut_array[i, 10] + chrom, pos = re.split(r'\#', key1) + ref_count = cvrg_dict[key1][0] + alt_count = cvrg_dict[key1][1] + cvrg = ref_count + alt_count + + var_id = '-'.join([chrom, pos, ref, alt]) + lst = [var_id, cvrg] + used_tiers = [] + cum_af = [] + for key2, value2 in sorted(value1.items()): + # calculate cummulative AF + used_tiers.append(value2) + if len(used_tiers) > 1: + cum = safe_div(sum(used_tiers), cvrg) + cum_af.append(cum) + lst.extend([sum(used_tiers), safe_div(sum(used_tiers), cvrg)]) + if chimera_correction: + lst.extend([(cvrg - sum(used_tiers[-6:])), sum(used_tiers[0:6]), safe_div(sum(used_tiers[0:6]), (cvrg - sum(used_tiers[-6:]))), alt_count, safe_div(alt_count, cvrg)]) + else: + lst.extend([(cvrg - sum(used_tiers[-5:])), sum(used_tiers[0:6]), safe_div(sum(used_tiers[0:6]), (cvrg - sum(used_tiers[-5:]))), alt_count, safe_div(alt_count, cvrg)]) + lst.extend(used_tiers) + lst.extend(cum_af) + lst = tuple(lst) + ws2.write_row(row + 1, 0, lst) + ws2.conditional_format('J{}:K{}'.format(row + 2, row + 2), {'type': 'formula', 'criteria': '=$J$1="tier 1.1"', 'format': format1, 'multi_range': 'J{}:K{} J1:K1'.format(row + 2, row + 2)}) + ws2.conditional_format('L{}:O{}'.format(row + 2, row + 2), {'type': 'formula', 'criteria': '=$L$1="tier 2.1"', 'format': format3, 'multi_range': 'L{}:O{} L1:O1'.format(row + 2, row + 2)}) + if chimera_correction: + ws2.conditional_format('P{}:U{}'.format(row + 2, row + 2), {'type': 'formula', 'criteria': '=$P$1="tier 3.1"', 'format': format2, 'multi_range': 'P{}:U{} P1:U1'.format(row + 2, row + 2)}) + else: + ws2.conditional_format('P{}:T{}'.format(row + 2, row + 2), {'type': 'formula', 'criteria': '=$P$1="tier 3.1"', 'format': format2, 'multi_range': 'P{}:T{} P1:T1'.format(row + 2, row + 2)}) + + row += 1 + + # sheet 3 + if chimera_correction: + sheet3 = [("tier 1.1", counter_tier11), ("tier 1.2", counter_tier12), ("tier 2.1", counter_tier21), + ("tier 2.2", counter_tier22), ("tier 2.3", counter_tier23), ("tier 2.4", counter_tier24), + ("tier 3.1", counter_tier31), ("tier 3.2", counter_tier32), ("tier 4.1", counter_tier41), + ("tier 4.2", counter_tier42), ("tier 4.3", counter_tier43), ("tier 5", counter_tier5)] + else: + sheet3 = [("tier 1.1", counter_tier11), ("tier 1.2", counter_tier12), ("tier 2.1", counter_tier21), + ("tier 2.2", counter_tier22), ("tier 2.3", counter_tier23), ("tier 2.4", counter_tier24), + ("tier 3.1", counter_tier31), ("tier 3.2", counter_tier32), ("tier 4.1", counter_tier41), + ("tier 4.2", counter_tier42), ("tier 5", counter_tier5)] + + + header = ("tier", "count") + ws3.write_row(0, 0, header) + + for i in range(len(sheet3)): + ws3.write_row(i + 1, 0, sheet3[i]) + ws3.conditional_format('A{}:B{}'.format(i + 2, i + 2), + {'type': 'formula', + 'criteria': '=OR($A${}="tier 1.1", $A${}="tier 1.2")'.format(i + 2, i + 2), + 'format': format1}) + ws3.conditional_format('A{}:B{}'.format(i + 2, i + 2), + {'type': 'formula', + 'criteria': '=OR($A${}="tier 2.1", $A${}="tier 2.2", $A${}="tier 2.3", $A${}="tier 2.4")'.format(i + 2, i + 2, i + 2, i + 2), + 'format': format3}) + ws3.conditional_format('A{}:B{}'.format(i + 2, i + 2), + {'type': 'formula', + 'criteria': '=$A${}>="3"'.format(i + 2), + 'format': format2}) + if chimera_correction: + description_tiers = [("Tier 1.1", "both ab and ba SSCS present (>75% of the sites with alternative base) and minimal FS>=3 for both SSCS in at least one mate"), ("", ""), ("Tier 1.2", "both ab and ba SSCS present (>75% of the sites with alt. base) and mate pair validation (min. FS=1) and minimal FS>=3 for at least one of the SSCS"), ("Tier 2.1", "both ab and ba SSCS present (>75% of the sites with alt. base) and minimal FS>=3 for at least one of the SSCS in at least one mate"), ("Tier 2.2", "both ab and ba SSCS present (>75% of the sites with alt. base) and mate pair validation (min. FS=1)"), ("Tier 2.3", "both ab and ba SSCS present (>75% of the sites with alt. base) and minimal FS=1 for both SSCS in one mate and minimal FS>=3 for at least one of the SSCS in the other mate"), ("Tier 2.4", "both ab and ba SSCS present (>75% of the sites with alt. base) and minimal FS=1 for both SSCS in at least one mate"), ("Tier 3.1", "both ab and ba SSCS present (>50% of the sites with alt. base) and recurring mutation on this position"), ("Tier 3.2", "both ab and ba SSCS present (>50% of the sites with alt. base) and minimal FS>=1 for both SSCS in at least one mate"), ("Tier 4.1", "variants at the start or end of the reads"), ("Tier 4.2", "mates with contradictory information"), ("Tier 4.3", "variants that are chimeric"), ("Tier 5", "remaining variants")] + else: + description_tiers = [("Tier 1.1", "both ab and ba SSCS present (>75% of the sites with alternative base) and minimal FS>=3 for both SSCS in at least one mate"), ("", ""), ("Tier 1.2", "both ab and ba SSCS present (>75% of the sites with alt. base) and mate pair validation (min. FS=1) and minimal FS>=3 for at least one of the SSCS"), ("Tier 2.1", "both ab and ba SSCS present (>75% of the sites with alt. base) and minimal FS>=3 for at least one of the SSCS in at least one mate"), ("Tier 2.2", "both ab and ba SSCS present (>75% of the sites with alt. base) and mate pair validation (min. FS=1)"), ("Tier 2.3", "both ab and ba SSCS present (>75% of the sites with alt. base) and minimal FS=1 for both SSCS in one mate and minimal FS>=3 for at least one of the SSCS in the other mate"), ("Tier 2.4", "both ab and ba SSCS present (>75% of the sites with alt. base) and minimal FS=1 for both SSCS in at least one mate"), ("Tier 3.1", "both ab and ba SSCS present (>50% of the sites with alt. base) and recurring mutation on this position"), ("Tier 3.2", "both ab and ba SSCS present (>50% of the sites with alt. base) and minimal FS>=1 for both SSCS in at least one mate"), ("Tier 4.1", "variants at the start or end of the reads"), ("Tier 4.2", "mates with contradictory information"), ("Tier 5", "remaining variants")] + + examples_tiers = [[("Chr5:5-20000-11068-C-G", "1.1", "AAAAAGATGCCGACTACCTT", "ab1.ba2", "254", "228", "287", "288", "289", + "3", "6", "3", "6", "0", "0", "3", "6", "0", "0", "1", "1", "0", "0", "0", "0", "0", "0", + "4081", "4098", "5", "10", "", ""), + ("", "", "AAAAAGATGCCGACTACCTT", "ab2.ba1", None, None, None, None, + "289", "0", "0", "0", "0", "0", "0", "0", "0", None, None, None, None, + "0", "0", "0", "0", "0", "0", "4081", "4098", "5", "10", "", "")], + [("Chr5:5-20000-11068-C-G", "1.1", "AAAAATGCGTAGAAATATGC", "ab1.ba2", "254", "228", "287", "288", "289", + "33", "43", "33", "43", "0", "0", "33", "43", "0", "0", "1", "1", "0", "0", "0", "0", "0", + "0", "4081", "4098", "5", "10", "", ""), + ("", "", "AAAAATGCGTAGAAATATGC", "ab2.ba1", "268", "268", "270", "288", "289", + "11", "34", "10", "27", "0", "0", "10", "27", "0", "0", "1", "1", "0", "0", "1", + "7", "0", "0", "4081", "4098", "5", "10", "", "")], + [("Chr5:5-20000-10776-G-T", "1.2", "CTATGACCCGTGAGCCCATG", "ab1.ba2", "132", "132", "287", "288", "290", + "4", "1", "4", "1", "0", "0", "4", "1", "0", "0", "1", "1", "0", "0", "0", "0", + "0", "0", "1", "6", "47170", "41149", "", ""), + ("", "", "CTATGACCCGTGAGCCCATG", "ab2.ba1", "77", "132", "233", "200", "290", + "4", "1", "4", "1", "0", "0", "4", "1", "0", "0", "1", "1", "0", "0", "0", "0", + "0", "0", "1", "6", "47170", "41149", "", "")], + [("Chr5:5-20000-11068-C-G", "2.1", "AAAAAAACATCATACACCCA", "ab1.ba2", "246", "244", "287", "288", "289", + "2", "8", "2", "8", "0", "0", "2", "8", "0", "0", "1", "1", "0", "0", "0", "0", "0", "0", + "4081", "4098", "5", "10", "", ""), + ("", "", "AAAAAAACATCATACACCCA", "ab2.ba1", None, None, None, None, + "289", "0", "0", "0", "0", "0", "0", "0", "0", None, None, None, None, "0", "0", + "0", "0", "0", "0", "4081", "4098", "5", "10", "", "")], + [("Chr5:5-20000-11068-C-G", "2.2", "ATCAGCCATGGCTATTATTG", "ab1.ba2", "72", "72", "217", "288", "289", + "1", "1", "1", "1", "0", "0", "1", "1", "0", "0", "1", "1", "0", "0", "0", "0", "0", "0", + "4081", "4098", "5", "10", "", ""), + ("", "", "ATCAGCCATGGCTATTATTG", "ab2.ba1", "153", "164", "217", "260", "289", + "1", "1", "1", "1", "0", "0", "1", "1", "0", "0", "1", "1", "0", "0", "0", "0", "0", "0", + "4081", "4098", "5", "10", "", "")], + [("Chr5:5-20000-11068-C-G", "2.3", "ATCAATATGGCCTCGCCACG", "ab1.ba2", None, None, None, None, + "289", "0", "5", "0", "5", "0", "0", "0", "5", None, None, None, "1", "0", + "0", "0", "0", "0", "0", "4081", "4098", "5", "10", "", ""), + ("", "", "ATCAATATGGCCTCGCCACG", "ab2.ba1", "202", "255", "277", "290", "289", + "1", "3", "1", "3", "0", "0", "1", "3", "0", "0", "1", "1", "0", "0", "0", "0", + "0", "0", "4081", "4098", "5", "10", "", "")], + [("Chr5:5-20000-11068-C-G", "2.4", "ATCAGCCATGGCTATTTTTT", "ab1.ba2", "72", "72", "217", "288", "289", + "1", "1", "1", "1", "0", "0", "1", "1", "0", "0", "1", "1", "0", "0", "0", "0", "0", "0", "4081", + "4098", "5", "10", "", ""), + ("", "", "ATCAGCCATGGCTATTTTTT", "ab2.ba1", "153", "164", "217", "260", "289", + "1", "1", "0", "0", "0", "0", "0", "0", "0", "0", "0", "0", "1", "1", "0", "0", "0", "0", "4081", + "4098", "5", "10", "", "")], + [("Chr5:5-20000-10776-G-T", "3.1", "ATGCCTACCTCATTTGTCGT", "ab1.ba2", "46", "15", "287", "288", "290", + "3", "3", "3", "2", "3", "1", "0", "1", "1", "0.5", "0", "0.5", "0", "0", "0", "1", + "0", "0", "3", "3", "47170", "41149", "", ""), + ("", "", "ATGCCTACCTCATTTGTCGT", "ab2.ba1", None, "274", None, + "288", "290", "0", "3", "0", "2", "0", "1", "0", "1", None, "0.5", None, "0.5", + "0", "0", "0", "1", "0", "0", "3", "3", "47170", "41149", "", "")], + [("Chr5:5-20000-11315-C-T", "3.2", "ACAACATCACGTATTCAGGT", "ab1.ba2", "197", "197", "240", "255", "271", + "2", "3", "2", "3", "0", "1", "2", "2", "0", "0.333333333333333", "1", + "0.666666666666667", "0", "0", "0", "0", "0", "0", "1", "1", "6584", "6482", "", ""), + ("", "", "ACAACATCACGTATTCAGGT", "ab2.ba1", "35", "35", "240", "258", "271", + "2", "3", "2", "3", "0", "1", "2", "2", "0", "0.333333333333333", "1", + "0.666666666666667", "0", "0", "0", "0", "0", "0", "1", "1", "6584", "6482", "", "")], + [("Chr5:5-20000-13983-G-C", "4.1", "AAAAAAAGAATAACCCACAC", "ab1.ba2", "0", "100", "255", "276", "269", + "5", "6", "0", "6", "0", "0", "5", "6", "0", "0", "0", "1", "0", "0", "0", "0", "5", "0", "1", "1", "5348", "5350", "", ""), + ("", "", "AAAAAAAGAATAACCCACAC", "ab2.ba1", None, None, None, None, + "269", "0", "0", "0", "0", "0", "0", "0", "0", None, None, None, None, "0", + "0", "0", "0", "0", "0", "1", "1", "5348", "5350", "", "")], + [("Chr5:5-20000-13963-T-C", "4.2", "TTTTTAAGAATAACCCACAC", "ab1.ba2", "38", "38", "240", "283", "263", + "110", "54", "110", "54", "0", "0", "110", "54", "0", "0", "1", "1", "0", "0", "0", + "0", "0", "0", "1", "1", "5348", "5350", "", ""), + ("", "", "TTTTTAAGAATAACCCACAC", "ab2.ba1", "100", "112", "140", "145", "263", + "7", "12", "7", "12", "7", "12", "0", "0", "1", "1", "0", + "0", "0", "0", "0", "0", "0", "0", "1", "1", "5348", "5350", "", "")]] + + if chimera_correction: + examples_tiers.extend([[("Chr5:5-20000-13963-T-C", "4.3", "TTTTTAAGAAGCTATTTTTT", "ab1.ba2", "72", "72", "217", "288", "289", + "1", "1", "1", "1", "0", "0", "1", "1", "0", "0", "1", "1", "0", "0", "0", "0", "0", "0", "4081", + "4098", "5", "10", "", "TTTTTAAGAATAACCCACAC"), + ("", "", "TTTTTAAGAAGCTATTTTTT", "ab2.ba1", "153", "164", "217", "260", "289", + "1", "1", "0", "0", "0", "0", "0", "0", "0", "0", "0", "0", "1", "1", "0", "0", "0", "0", "4081", + "4098", "5", "10", "", "TTTTTAAGAATAACCCACAC")], + [("Chr5:5-20000-13983-G-C", "5", "ATGTTGTGAATAACCCACAC", "ab1.ba2", None, "186", None, "276", "269", + "0", "6", "0", "6", "0", "0", "0", "6", "0", "0", "0", "1", "0", "0", "0", "0", "0", + "0", "1", "1", "5348", "5350", "", ""), + ("", "", "ATGTTGTGAATAACCCACAC", "ab2.ba1", None, None, None, None, + "269", "0", "0", "0", "0", "0", "0", "0", "0", None, None, None, None, "0", + "0", "0", "0", "0", "0", "1", "1", "5348", "5350", "", "")]]) + else: + examples_tiers.extend([ + [("Chr5:5-20000-13983-G-C", "5", "ATGTTGTGAATAACCCACAC", "ab1.ba2", None, "186", None, "276", "269", + "0", "6", "0", "6", "0", "0", "0", "6", "0", "0", "0", "1", "0", "0", "0", "0", "0", + "0", "1", "1", "5348", "5350", "", ""), + ("", "", "ATGTTGTGAATAACCCACAC", "ab2.ba1", None, None, None, None, + "269", "0", "0", "0", "0", "0", "0", "0", "0", None, None, None, None, "0", + "0", "0", "0", "0", "0", "1", "1", "5348", "5350", "", "")]]) + + start_row = 15 + ws3.write(start_row, 0, "Description of tiers with examples") + ws3.write_row(start_row + 1, 0, header_line) + row = 0 + for i in range(len(description_tiers)): + ws3.write_row(start_row + 2 + row + i + 1, 0, description_tiers[i]) + ex = examples_tiers[i] + for k in range(len(ex)): + ws3.write_row(start_row + 2 + row + i + k + 2, 0, ex[k]) + ws3.conditional_format('L{}:M{}'.format(start_row + 2 + row + i + k + 2, start_row + 2 + row + i + k + 3), {'type': 'formula', 'criteria': '=OR($B${}="1.1", $B${}="1.2")'.format(start_row + 2 + row + i + k + 2, start_row + 2 + row + i + k + 2), 'format': format1, 'multi_range': 'L{}:M{} T{}:U{} B{}'.format(start_row + 2 + row + i + k + 2, start_row + 2 + row + i + k + 3, start_row + 2 + row + i + k + 2, start_row + 2 + row + i + k + 3, start_row + 2 + row + i + k + 2, start_row + 2 + row + i + k + 3)}) + ws3.conditional_format('L{}:M{}'.format(start_row + 2 + row + i + k + 2, start_row + 2 + row + i + k + 3), + {'type': 'formula', 'criteria': '=OR($B${}="2.1",$B${}="2.2", $B${}="2.3", $B${}="2.4")'.format(start_row + 2 + row + i + k + 2, start_row + 2 + row + i + k + 2, start_row + 2 + row + i + k + 2, start_row + 2 + row + i + k + 2), + 'format': format3, + 'multi_range': 'L{}:M{} T{}:U{} B{}'.format(start_row + 2 + row + i + k + 2, start_row + 2 + row + i + k + 3, start_row + 2 + row + i + k + 2, start_row + 2 + row + i + k + 3, start_row + 2 + row + i + k + 2, start_row + 2 + row + i + k + 3)}) + ws3.conditional_format('L{}:M{}'.format(start_row + 2 + row + i + k + 2, start_row + 2 + row + i + k + 3), + {'type': 'formula', + 'criteria': '=$B${}>="3"'.format(start_row + 2 + row + i + k + 2), + 'format': format2, + 'multi_range': 'L{}:M{} T{}:U{} B{}'.format(start_row + 2 + row + i + k + 2, start_row + 2 + row + i + k + 3, start_row + 2 + row + i + k + 2, start_row + 2 + row + i + k + 3, start_row + 2 + row + i + k + 2, start_row + 2 + row + i + k + 3)}) + row += 3 + workbook.close() + + +if __name__ == '__main__': + sys.exit(read2mut(sys.argv))
