# HG changeset patch
# User mheinzl
# Date 1615574703 0
# Node ID 0b3df6ea143443c532546ef00b2d7701d6628cd6
# Parent  04741369fc0731ea7a4b99f31e9527fd05b2c782
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8

diff -r 04741369fc07 -r 0b3df6ea1434 read2mut.py
--- a/read2mut.py	Fri Mar 12 14:34:21 2021 +0000
+++ b/read2mut.py	Fri Mar 12 18:45:03 2021 +0000
@@ -593,6 +593,7 @@
                         softclipped_mutation_allMates = False
                         softclipped_mutation_oneOfTwoMates = False
                         softclipped_mutation_oneOfTwoSSCS = False
+                        softclipped_mutation_oneOfTwoSSCS_diffMates = False
                         softclipped_mutation_oneMate = False
                         softclipped_mutation_oneMateOneSSCS = False
                         print()
@@ -718,6 +719,7 @@
                             softclipped_mutation_allMates = True
                             softclipped_mutation_oneOfTwoMates = False
                             softclipped_mutation_oneOfTwoSSCS = False
+                            softclipped_mutation_oneOfTwoSSCS_diffMates = False
                             softclipped_mutation_oneMate = False
                             softclipped_mutation_oneMateOneSSCS = False
                             alt1ff = 0
@@ -735,6 +737,7 @@
                             softclipped_mutation_allMates = False
                             softclipped_mutation_oneOfTwoMates = True
                             softclipped_mutation_oneOfTwoSSCS = False
+                            softclipped_mutation_oneOfTwoSSCS_diffMates = False
                             softclipped_mutation_oneMate = False
                             softclipped_mutation_oneMateOneSSCS = False
                             alt1ff = 0
@@ -752,6 +755,7 @@
                             softclipped_mutation_allMates = False
                             softclipped_mutation_oneOfTwoMates = False
                             softclipped_mutation_oneOfTwoSSCS = True
+                            softclipped_mutation_oneOfTwoSSCS_diffMates = False
                             softclipped_mutation_oneMate = False
                             softclipped_mutation_oneMateOneSSCS = False
                             alt1ff = 0
@@ -761,6 +765,7 @@
                             trimmed = False
                             contradictory = False
                             print(key1, "softclipped_mutation_oneOfTwoSSCS", softclipped_mutation_oneOfTwoSSCS, [alt1ff, alt2ff, alt3ff, alt4ff])
+
                         # information of one mate available --> all reads of one mate are softclipped
                         elif ((ratio1 & ratio4 & (ratio_dist_start1 | ratio_dist_end1) & (ratio_dist_start4 | ratio_dist_end4) &
                               all(float(ij) < 0. for ij in [alt2ff, alt3ff]) & all(float(ij) > 0. for ij in [alt1ff, alt4ff])) |
@@ -774,6 +779,7 @@
                             softclipped_mutation_allMates = False
                             softclipped_mutation_oneOfTwoMates = False
                             softclipped_mutation_oneOfTwoSSCS = False
+                            softclipped_mutation_oneOfTwoSSCS_diffMates = False
                             softclipped_mutation_oneMate = True
                             softclipped_mutation_oneMateOneSSCS = False
                             alt1ff = 0
@@ -796,6 +802,7 @@
                             softclipped_mutation_allMates = False
                             softclipped_mutation_oneOfTwoMates = False
                             softclipped_mutation_oneOfTwoSSCS = False
+                            softclipped_mutation_oneOfTwoSSCS_diffMates = False
                             softclipped_mutation_oneMate = False
                             softclipped_mutation_oneMateOneSSCS = True
                             alt1ff = 0
@@ -1104,6 +1111,8 @@
                     line1 = list(line1)
                     line1[1] = "2.5"
                     line1 = tuple(line1)
+                    counter_tier25 += 1
+                    counter_tier4 -= 1
                 ws1.write_row(row_number, 0, line1)
                 csv_writer.writerow(line1)
                 ws1.write_row(row_number + 1, 0, line2)
@@ -1231,11 +1240,11 @@
                          ("Tier 3.1", "both ab and ba SSCS present (>50% of the sites with alt. base) and recurring mutation on this position"),
                          ("Tier 3.2", "both ab and ba SSCS present (>50% of the sites with alt. base) and minimal FS>=1 for both SSCS in at least one mate"),
                          ("Tier 4", "variants at the start or end of the reads"),
-                         ("Tier 5.1", "variant is close to softclipping in both mates"),
-                         ("Tier 5.2", "variant is close to softclipping in one of the mates"),
+                         ("Tier 5.1", "variant is close to softclipping in both mates and SSCS"),
+                         ("Tier 5.2", "variant is close to softclipping in one of the mates but both SSCS"),
                          ("Tier 5.3", "variant is close to softclipping in one of the SSCS of both mates"),
-                         ("Tier 5.4", "variant is close to softclipping in one mate (no information of second mate"),
-                         ("Tier 5.5", "variant is close to softclipping in one of the SSCS (no information of the second mate"),
+                         ("Tier 5.4", "variant is close to softclipping in one mate and both SSCS (no information of second mate)"),
+                         ("Tier 5.5", "variant is close to softclipping in one of the SSCS (no information of the second mate)"),
                          ("Tier 6", "mates with contradictory information"),
                          ("Tier 7", "remaining variants")]
     examples_tiers = [[("chr5-11068-C-G", "1.1", "AAAAAGATGCCGACTACCTT", "ab1.ba2", "254", "228", "287", "288", "289",