Mercurial > repos > mheinzl > variant_analyzer2
changeset 11:84a1a3f70407 draft
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
| author | mheinzl |
|---|---|
| date | Mon, 15 Feb 2021 21:53:24 +0000 |
| parents | e18c5293aac7 |
| children | 7a418148319d |
| files | mut2read.py mut2read.xml mut2sscs.py mut2sscs.xml read2mut.py read2mut.xml test-data/Variant_Analyzer_allele_frequencies_test.xlsx test-data/Variant_Analyzer_summary_test.xlsx test-data/Variant_Analyzer_test.xlsx test-data/Variant_Analyzer_tiers_test.xlsx va_macros.xml |
| diffstat | 11 files changed, 110 insertions(+), 505 deletions(-) [+] |
line wrap: on
line diff
--- a/mut2read.py Thu Feb 04 09:01:43 2021 +0000 +++ b/mut2read.py Mon Feb 15 21:53:24 2021 +0000 @@ -11,7 +11,7 @@ ======= ========== ================= ================================ Version Date Author Description -0.2.1 2019-10-27 Gundula Povysil - +2.0.0 2020-10-30 Gundula Povysil - ======= ========== ================= ================================ USAGE: python mut2read.py DCS_Mutations.tabular DCS.bam Aligned_Families.tabular Interesting_Reads.fastq tag_count_dict.json @@ -62,7 +62,6 @@ sys.exit("Error: Could not find '{}'".format(file3)) # read dcs bam file -# pysam.index(file2) bam = pysam.AlignmentFile(file2, "rb") # get tags @@ -74,14 +73,8 @@ stop_pos = variant.start #chrom_stop_pos = str(chrom) + "#" + str(stop_pos) ref = variant.REF - if len(variant.ALT) == 0: - continue - else: - alt = variant.ALT[0] - print(alt) + alt = variant.ALT[0] chrom_stop_pos = str(chrom) + "#" + str(stop_pos) + "#" + ref + "#" + alt - - dcs_len = [] if len(ref) == len(alt): for pileupcolumn in bam.pileup(chrom, stop_pos - 1, stop_pos + 1, max_depth=100000000): @@ -152,4 +145,3 @@ if __name__ == '__main__': sys.exit(mut2read(sys.argv)) -
--- a/mut2read.xml Thu Feb 04 09:01:43 2021 +0000 +++ b/mut2read.xml Mon Feb 15 21:53:24 2021 +0000 @@ -1,15 +1,10 @@ <?xml version="1.0" encoding="UTF-8"?> -<tool id="mut2read" name="DCS mutations to tags/reads:" version="2.0.0" profile="19.01"> +<tool id="mut2read" name="DCS mutations to tags/reads:" version="2.0.1" profile="19.01"> <description>Extracts all tags that carry a mutation in the duplex consensus sequence (DCS)</description> <macros> <import>va_macros.xml</import> </macros> - <requirements> - <requirement type="package" version="2.7">python</requirement> - <requirement type="package" version="1.4.0">matplotlib</requirement> - <requirement type="package" version="0.15">pysam</requirement> - <requirement type="package" version="0.11.6">cyvcf2</requirement> - </requirements> + <expand macro="requirements"/> <command><![CDATA[ ln -s '$file2' bam_input.bam && ln -s '${file2.metadata.bam_index}' bam_input.bam.bai && @@ -32,10 +27,10 @@ </outputs> <tests> <test> - <param name="file1" value="FreeBayes_test.vcf" lines_diff="2"/> + <param name="file1" value="FreeBayes_test.vcf"/> <param name="file2" value="DCS_test.bam"/> <param name="file3" value="Aligned_Families_test.tabular"/> - <output name="output_fastq" file="Interesting_Reads_test.fastq" lines_diff="136"/> + <output name="output_fastq" file="Interesting_Reads_test.fastq"/> <output name="output_json" file="tag_count_dict_test.json" lines_diff="2"/> </test> </tests>
--- a/mut2sscs.py Thu Feb 04 09:01:43 2021 +0000 +++ b/mut2sscs.py Mon Feb 15 21:53:24 2021 +0000 @@ -11,7 +11,7 @@ ======= ========== ================= ================================ Version Date Author Description -0.2.1 2019-10-27 Gundula Povysil - +2.0.0 2020-10-30 Gundula Povysil - ======= ========== ================= ================================ USAGE: python mut2sscs.py DCS_Mutations.tabular SSCS.bam SSCS_counts.json @@ -25,7 +25,6 @@ import os import sys -import numpy as np import pysam from cyvcf2 import VCF @@ -56,7 +55,6 @@ sys.exit("Error: Could not find '{}'".format(file2)) # read SSCS bam file -# pysam.index(file2) bam = pysam.AlignmentFile(file2, "rb") # get tags @@ -68,14 +66,10 @@ stop_pos = variant.start #chrom_stop_pos = str(chrom) + "#" + str(stop_pos) ref = variant.REF - if len(variant.ALT) == 0: - continue - else: - alt = variant.ALT[0] + alt = variant.ALT[0] chrom_stop_pos = str(chrom) + "#" + str(stop_pos) + "#" + ref + "#" + alt if len(ref) == len(alt): - for pileupcolumn in bam.pileup(chrom, stop_pos - 1, stop_pos + 1, max_depth=1000000000): if pileupcolumn.reference_pos == stop_pos: count_alt = 0 @@ -137,4 +131,3 @@ if __name__ == '__main__': sys.exit(mut2sscs(sys.argv)) -
--- a/mut2sscs.xml Thu Feb 04 09:01:43 2021 +0000 +++ b/mut2sscs.xml Mon Feb 15 21:53:24 2021 +0000 @@ -1,15 +1,10 @@ <?xml version="1.0" encoding="UTF-8"?> -<tool id="mut2sscs" name="DCS mutations to SSCS stats:" version="2.0.0" profile="19.01"> +<tool id="mut2sscs" name="DCS mutations to SSCS stats:" version="2.0.1" profile="19.01"> <description>Extracts all tags from the single stranded consensus sequence (SSCS) bam file that carry a mutation at the same position a mutation is called in the duplex consensus sequence (DCS) and calculates their frequencies</description> <macros> <import>va_macros.xml</import> </macros> - <requirements> - <requirement type="package" version="2.7">python</requirement> - <requirement type="package" version="1.4.0">matplotlib</requirement> - <requirement type="package" version="0.15">pysam</requirement> - <requirement type="package" version="0.11.6">cyvcf2</requirement> - </requirements> + <expand macro="requirements"/> <command><![CDATA[ ln -s '$file2' bam_input.bam && ln -s '${file2.metadata.bam_index}' bam_input.bam.bai &&
--- a/read2mut.py Thu Feb 04 09:01:43 2021 +0000 +++ b/read2mut.py Mon Feb 15 21:53:24 2021 +0000 @@ -10,7 +10,7 @@ ======= ========== ================= ================================ Version Date Author Description -0.2.1 2019-10-27 Gundula Povysil - +2.0.0 2020-10-30 Gundula Povysil - ======= ========== ================= ================================ @@ -23,7 +23,6 @@ from __future__ import division import argparse -import itertools import json import operator import os @@ -47,11 +46,7 @@ parser.add_argument('--sscsJson', help='JSON file with SSCS counts collected by mut2sscs.py.') parser.add_argument('--outputFile', - help='Output xlsx file with summary of mutations.') - parser.add_argument('--outputFile2', - help='Output xlsx file with allele frequencies of mutations.') - parser.add_argument('--outputFile3', - help='Output xlsx file with examples of the tier classification.') + help='Output xlsx file of mutation details.') parser.add_argument('--thresh', type=int, default=0, help='Integer threshold for displaying mutations. Only mutations occuring less than thresh times are displayed. Default of 0 displays all.') parser.add_argument('--phred', type=int, default=20, @@ -60,10 +55,6 @@ help='Integer threshold for assigning mutations at start and end of reads to lower tier. Default 10.') parser.add_argument('--chimera_correction', action="store_true", help='Count chimeric variants and correct the variant frequencies') - parser.add_argument('--softclipping_dist', type=int, default=15, - help='Count mutation as an artifact if mutation lies within this parameter away from the softclipping part of the read.') - parser.add_argument('--reads_threshold', type=float, default=1.0, - help='Float number which specifies the minimum percentage of softclipped reads in a family to be considered in the softclipping tiers. Default: 1.0, means all reads of a family have to be softclipped.') return parser @@ -81,14 +72,10 @@ json_file = args.inputJson sscs_json = args.sscsJson outfile = args.outputFile - outfile2 = args.outputFile2 - outfile3 = args.outputFile3 thresh = args.thresh phred_score = args.phred trim = args.trim chimera_correction = args.chimera_correction - thr = args.softclipping_dist - threshold_reads = args.reads_threshold if os.path.isfile(file1) is False: sys.exit("Error: Could not find '{}'".format(file1)) @@ -102,8 +89,6 @@ sys.exit("Error: phred is '{}', but only non-negative integers allowed".format(phred_score)) if trim < 0: sys.exit("Error: trim is '{}', but only non-negative integers allowed".format(thresh)) - if thr <= 0: - sys.exit("Error: trim is '{}', but only non-negative integers allowed".format(thr)) # load dicts with open(json_file, "r") as f: @@ -113,7 +98,6 @@ (mut_pos_dict, ref_pos_dict) = json.load(f) # read bam file - # pysam.index(file2) bam = pysam.AlignmentFile(file2, "rb") # create mut_dict @@ -121,21 +105,15 @@ mut_read_pos_dict = {} mut_read_dict = {} reads_dict = {} - mut_read_cigar_dict = {} i = 0 mut_array = [] - for count, variant in enumerate(VCF(file1)): - #if count == 2000: - # break + for variant in VCF(file1): chrom = variant.CHROM stop_pos = variant.start #chrom_stop_pos = str(chrom) + "#" + str(stop_pos) ref = variant.REF - if len(variant.ALT) == 0: - continue - else: - alt = variant.ALT[0] + alt = variant.ALT[0] chrom_stop_pos = str(chrom) + "#" + str(stop_pos) + "#" + ref + "#" + alt if len(ref) == len(alt): @@ -144,7 +122,6 @@ mut_dict[chrom_stop_pos] = {} mut_read_pos_dict[chrom_stop_pos] = {} reads_dict[chrom_stop_pos] = {} - mut_read_cigar_dict[chrom_stop_pos] = {} for pileupcolumn in bam.pileup(chrom, stop_pos - 1, stop_pos + 1, max_depth=100000000): if pileupcolumn.reference_pos == stop_pos: @@ -155,8 +132,8 @@ count_other = 0 count_lowq = 0 n = 0 - #print("unfiltered reads=", pileupcolumn.n, "filtered reads=", len(pileupcolumn.pileups), - # "difference= ", len(pileupcolumn.pileups) - pileupcolumn.n) + print("unfiltered reads=", pileupcolumn.n, "filtered reads=", len(pileupcolumn.pileups), + "difference= ", len(pileupcolumn.pileups) - pileupcolumn.n) for pileupread in pileupcolumn.pileups: n += 1 if not pileupread.is_del and not pileupread.is_refskip: @@ -172,13 +149,14 @@ else: mut_dict[chrom_stop_pos][tag][nuc] = 1 if tag not in mut_read_pos_dict[chrom_stop_pos]: - mut_read_pos_dict[chrom_stop_pos][tag] = [pileupread.query_position + 1] - reads_dict[chrom_stop_pos][tag] = [len(pileupread.alignment.query_sequence)] - mut_read_cigar_dict[chrom_stop_pos][tag] = [pileupread.alignment.cigarstring] + mut_read_pos_dict[chrom_stop_pos][tag] = np.array(pileupread.query_position) + 1 + reads_dict[chrom_stop_pos][tag] = len(pileupread.alignment.query_sequence) else: - mut_read_pos_dict[chrom_stop_pos][tag].append(pileupread.query_position + 1) - reads_dict[chrom_stop_pos][tag].append(len(pileupread.alignment.query_sequence)) - mut_read_cigar_dict[chrom_stop_pos][tag].append(pileupread.alignment.cigarstring) + mut_read_pos_dict[chrom_stop_pos][tag] = np.append( + mut_read_pos_dict[chrom_stop_pos][tag], pileupread.query_position + 1) + reads_dict[chrom_stop_pos][tag] = np.append( + reads_dict[chrom_stop_pos][tag], len(pileupread.alignment.query_sequence)) + if nuc == alt: count_alt += 1 if tag not in mut_read_dict: @@ -197,9 +175,10 @@ else: count_indel += 1 - #print("coverage at pos %s = %s, ref = %s, alt = %s, other bases = %s, N = %s, indel = %s, low quality = %s\n" % (pileupcolumn.pos, count_ref + count_alt, count_ref, count_alt, count_other, count_n, count_indel, count_lowq)) - #else: - # print("indels are currently not evaluated") + print("coverage at pos %s = %s, ref = %s, alt = %s, other bases = %s, N = %s, indel = %s, low quality = %s\n" % (pileupcolumn.pos, count_ref + count_alt, count_ref, count_alt, count_other, count_n, count_indel, count_lowq)) + else: + print("indels are currently not evaluated") + mut_array = np.array(mut_array) for read in bam.fetch(until_eof=True): if read.is_unmapped: @@ -219,10 +198,6 @@ # create pure_tags_dict pure_tags_dict = {} for key1, value1 in sorted(mut_dict.items()): - #if len(np.where(np.array(['#'.join(str(i) for i in z) - # for z in zip(mut_array[:, 0], mut_array[:, 1])]) == key1)[0]) == 0: - # continue - i = np.where(np.array(['#'.join(str(i) for i in z) for z in zip(mut_array[:, 0], mut_array[:, 1], mut_array[:, 2], mut_array[:, 3])]) == key1)[0][0] ref = mut_array[i, 2] @@ -246,16 +221,6 @@ else: pure_tags_dict_short = pure_tags_dict - # whole_array = [] - # for k in pure_tags_dict.values(): - # if len(k) != 0: - # keys = k.keys() - # if len(keys) > 1: - # for k1 in keys: - # whole_array.append(k1) - # else: - # whole_array.append(keys[0]) - # output summary with threshold workbook = xlsxwriter.Workbook(outfile) workbook2 = xlsxwriter.Workbook(outfile2) @@ -284,7 +249,6 @@ 'SSCS alt.ab', 'SSCS alt.ba', 'SSCS ref.ab', 'SSCS ref.ba', 'in phase', 'chimeric tag') ws1.write_row(0, 0, header_line) - counter_tier11 = 0 counter_tier12 = 0 counter_tier21 = 0 @@ -295,21 +259,12 @@ counter_tier32 = 0 counter_tier41 = 0 counter_tier42 = 0 - # if chimera_correction: - # counter_tier43 = 0 - counter_tier51 = 0 - counter_tier52 = 0 - counter_tier53 = 0 - counter_tier54 = 0 - counter_tier55 = 0 - counter_tier6 = 0 - + counter_tier5 = 0 row = 1 tier_dict = {} chimera_dict = {} for key1, value1 in sorted(mut_dict.items()): counts_mut = 0 - chimeric_tag_list = [] chimeric_tag = {} if key1 in pure_tags_dict_short.keys(): i = np.where(np.array(['#'.join(str(i) for i in z) @@ -317,12 +272,10 @@ ref = mut_array[i, 2] alt = mut_array[i, 3] dcs_median = cvrg_dict[key1][2] - whole_array = pure_tags_dict_short[key1].keys() + whole_array = list(pure_tags_dict_short[key1].keys()) tier_dict[key1] = {} - values_tier_dict = [("tier 1.1", 0), ("tier 1.2", 0), ("tier 2.1", 0), ("tier 2.2", 0), ("tier 2.3", 0), ("tier 2.4", 0), ("tier 3.1", 0), - ("tier 3.2", 0), ("tier 4.1", 0), ("tier 4.2", 0), ("tier 5.1", 0), ("tier 5.2", 0), ("tier 5.3", 0), ("tier 5.4", 0), ("tier 5.5", 0), - ("tier 6", 0)] + values_tier_dict = [("tier 1.1", 0), ("tier 1.2", 0), ("tier 2.1", 0), ("tier 2.2", 0), ("tier 2.3", 0), ("tier 2.4", 0), ("tier 3.1", 0), ("tier 3.2", 0), ("tier 4.1", 0), ("tier 4.2", 0), ("tier 5", 0)] for k, v in values_tier_dict: tier_dict[key1][k] = v @@ -351,15 +304,11 @@ total1 = sum(mut_dict[key1][key2[:-5] + '.ab.1'].values()) if 'na' in mut_dict[key1][key2[:-5] + '.ab.1'].keys(): na1 = mut_dict[key1][key2[:-5] + '.ab.1']['na'] - # na1f = na1/total1 else: - # na1 = na1f = 0 na1 = 0 if 'lowQ' in mut_dict[key1][key2[:-5] + '.ab.1'].keys(): lowq1 = mut_dict[key1][key2[:-5] + '.ab.1']['lowQ'] - # lowq1f = lowq1 / total1 else: - # lowq1 = lowq1f = 0 lowq1 = 0 if ref in mut_dict[key1][key2[:-5] + '.ab.1'].keys(): ref1 = mut_dict[key1][key2[:-5] + '.ab.1'][ref] @@ -394,15 +343,11 @@ total2 = sum(mut_dict[key1][key2[:-5] + '.ab.2'].values()) if 'na' in mut_dict[key1][key2[:-5] + '.ab.2'].keys(): na2 = mut_dict[key1][key2[:-5] + '.ab.2']['na'] - # na2f = na2 / total2 else: - # na2 = na2f = 0 na2 = 0 if 'lowQ' in mut_dict[key1][key2[:-5] + '.ab.2'].keys(): lowq2 = mut_dict[key1][key2[:-5] + '.ab.2']['lowQ'] - # lowq2f = lowq2 / total2 else: - # lowq2 = lowq2f = 0 lowq2 = 0 if ref in mut_dict[key1][key2[:-5] + '.ab.2'].keys(): ref2 = mut_dict[key1][key2[:-5] + '.ab.2'][ref] @@ -437,15 +382,11 @@ total3 = sum(mut_dict[key1][key2[:-5] + '.ba.1'].values()) if 'na' in mut_dict[key1][key2[:-5] + '.ba.1'].keys(): na3 = mut_dict[key1][key2[:-5] + '.ba.1']['na'] - # na3f = na3 / total3 else: - # na3 = na3f = 0 na3 = 0 if 'lowQ' in mut_dict[key1][key2[:-5] + '.ba.1'].keys(): lowq3 = mut_dict[key1][key2[:-5] + '.ba.1']['lowQ'] - # lowq3f = lowq3 / total3 else: - # lowq3 = lowq3f = 0 lowq3 = 0 if ref in mut_dict[key1][key2[:-5] + '.ba.1'].keys(): ref3 = mut_dict[key1][key2[:-5] + '.ba.1'][ref] @@ -476,15 +417,11 @@ total4 = sum(mut_dict[key1][key2[:-5] + '.ba.2'].values()) if 'na' in mut_dict[key1][key2[:-5] + '.ba.2'].keys(): na4 = mut_dict[key1][key2[:-5] + '.ba.2']['na'] - # na4f = na4 / total4 else: - # na4 = na4f = 0 na4 = 0 if 'lowQ' in mut_dict[key1][key2[:-5] + '.ba.2'].keys(): lowq4 = mut_dict[key1][key2[:-5] + '.ba.2']['lowQ'] - # lowq4f = lowq4 / total4 else: - # lowq4 = lowq4f = 0 lowq4 = 0 if ref in mut_dict[key1][key2[:-5] + '.ba.2'].keys(): ref4 = mut_dict[key1][key2[:-5] + '.ba.2'][ref] @@ -513,38 +450,19 @@ read_pos1 = read_pos2 = read_pos3 = read_pos4 = -1 read_len_median1 = read_len_median2 = read_len_median3 = read_len_median4 = 0 - cigars_dcs1 = cigars_dcs2 = cigars_dcs3 = cigars_dcs4 = [] - pos_read1 = pos_read2 = pos_read3 = pos_read4 = [] - end_read1 = end_read2 = end_read3 = end_read4 = [] + if key2[:-5] + '.ab.1' in mut_read_pos_dict[key1].keys(): - read_pos1 = np.median(np.array(mut_read_pos_dict[key1][key2[:-5] + '.ab.1'])) - read_len_median1 = np.median(np.array(reads_dict[key1][key2[:-5] + '.ab.1'])) - cigars_dcs1 = mut_read_cigar_dict[key1][key2[:-5] + '.ab.1'] - #print(mut_read_cigar_dict[key1][key2[:-5] + '.ab.1']) - pos_read1 = mut_read_pos_dict[key1][key2[:-5] + '.ab.1'] - #print(cigars_dcs1) - end_read1 = reads_dict[key1][key2[:-5] + '.ab.1'] + read_pos1 = np.median(mut_read_pos_dict[key1][key2[:-5] + '.ab.1']) + read_len_median1 = np.median(reads_dict[key1][key2[:-5] + '.ab.1']) if key2[:-5] + '.ab.2' in mut_read_pos_dict[key1].keys(): - read_pos2 = np.median(np.array(mut_read_pos_dict[key1][key2[:-5] + '.ab.2'])) - read_len_median2 = np.median(np.array(reads_dict[key1][key2[:-5] + '.ab.2'])) - cigars_dcs2 = mut_read_cigar_dict[key1][key2[:-5] + '.ab.2'] - pos_read2 = mut_read_pos_dict[key1][key2[:-5] + '.ab.2'] - end_read2 = reads_dict[key1][key2[:-5] + '.ab.2'] + read_pos2 = np.median(mut_read_pos_dict[key1][key2[:-5] + '.ab.2']) + read_len_median2 = np.median(reads_dict[key1][key2[:-5] + '.ab.2']) if key2[:-5] + '.ba.1' in mut_read_pos_dict[key1].keys(): - read_pos3 = np.median(np.array(mut_read_pos_dict[key1][key2[:-5] + '.ba.1'])) - read_len_median3 = np.median(np.array(reads_dict[key1][key2[:-5] + '.ba.1'])) - cigars_dcs3 = mut_read_cigar_dict[key1][key2[:-5] + '.ba.1'] - pos_read3 = mut_read_pos_dict[key1][key2[:-5] + '.ba.1'] - end_read3 = reads_dict[key1][key2[:-5] + '.ba.1'] + read_pos3 = np.median(mut_read_pos_dict[key1][key2[:-5] + '.ba.1']) + read_len_median3 = np.median(reads_dict[key1][key2[:-5] + '.ba.1']) if key2[:-5] + '.ba.2' in mut_read_pos_dict[key1].keys(): - read_pos4 = np.median(np.array(mut_read_pos_dict[key1][key2[:-5] + '.ba.2'])) - read_len_median4 = np.median(np.array(reads_dict[key1][key2[:-5] + '.ba.2'])) - #print(mut_read_cigar_dict[key1][key2[:-5] + '.ba.2']) - cigars_dcs4 = mut_read_cigar_dict[key1][key2[:-5] + '.ba.2'] - - pos_read4 = mut_read_pos_dict[key1][key2[:-5] + '.ba.2'] - #print(cigars_dcs4) - end_read4 = reads_dict[key1][key2[:-5] + '.ba.2'] + read_pos4 = np.median(mut_read_pos_dict[key1][key2[:-5] + '.ba.2']) + read_len_median4 = np.median(reads_dict[key1][key2[:-5] + '.ba.2']) used_keys.append(key2[:-5]) counts_mut += 1 @@ -577,222 +495,14 @@ trimmed = False contradictory = False - softclipped_mutation_allMates = False - softclipped_mutation_oneOfTwoMates = False - softclipped_mutation_oneOfTwoSSCS = False - softclipped_mutation_oneMate = False - softclipped_mutation_oneMateOneSSCS = False - print() - print(key1, cigars_dcs1, cigars_dcs4, cigars_dcs2, cigars_dcs3) - dist_start_read1 = dist_start_read2 = dist_start_read3 = dist_start_read4 = [] - dist_end_read1 = dist_end_read2 = dist_end_read3 = dist_end_read4 = [] - ratio_dist_start1 = ratio_dist_start2 = ratio_dist_start3 = ratio_dist_start4 = False - ratio_dist_end1 = ratio_dist_end2 = ratio_dist_end3 = ratio_dist_end4 = False - # mate 1 - SSCS ab - softclipped_idx1 = [True if re.search(r"^[0-9]+S", string) or re.search(r"S$", string) else False for string in cigars_dcs1] - ratio1 = safe_div(sum(softclipped_idx1), float(len(softclipped_idx1))) >= threshold_reads - - if any(ij is True for ij in softclipped_idx1): - softclipped_both_ends_idx1 = [True if (re.search(r"^[0-9]+S", string) and re.search(r"S$", string)) else False for string in cigars_dcs1] - softclipped_start1 = [int(string.split("S")[0]) if re.search(r"^[0-9]+S", string) else -1 for string in cigars_dcs1] - softclipped_end1 = [int(re.split("[A-Z]", str(string))[-2]) if re.search(r"S$", string) else -1 for string in cigars_dcs1] - dist_start_read1 = [(pos - soft) if soft != -1 else thr + 1000 for soft, pos in zip(softclipped_start1, pos_read1)] - dist_end_read1 = [(length_read - pos - soft) if soft != -1 else thr + 1000 for soft, pos, length_read in zip(softclipped_end1, pos_read1, end_read1)] - - # if read at both ends softclipped --> select end with smallest distance between mut position and softclipping - if any(ij is True for ij in softclipped_both_ends_idx1): - print(softclipped_both_ends_idx1) - for nr, indx in enumerate(softclipped_both_ends_idx1): - if indx: - if dist_start_read1[nr] <= dist_end_read1[nr]: - dist_end_read1[nr] = thr + 1000 # use dist of start and set start to very large number - else: - dist_start_read1[nr] = thr + 1000 # use dist of end and set start to very large number - ratio_dist_start1 = safe_div(sum([True if x <= thr else False for x in dist_start_read1]), float(sum(softclipped_idx1))) >= threshold_reads - ratio_dist_end1 = safe_div(sum([True if x <= thr else False for x in dist_end_read1]), float(sum(softclipped_idx1))) >= threshold_reads - print(key1, "mate1 ab", dist_start_read1, dist_end_read1, cigars_dcs1, ratio1, ratio_dist_start1, ratio_dist_end1) - - # mate 1 - SSCS ba - softclipped_idx4 = [True if re.search(r"^[0-9]+S", string) or re.search(r"S$", string) else False for string in cigars_dcs4] - ratio4 = safe_div(sum(softclipped_idx4), float(len(softclipped_idx4))) >= threshold_reads - if any(ij is True for ij in softclipped_idx4): - softclipped_both_ends_idx4 = [True if (re.search(r"^[0-9]+S", string) and re.search(r"S$", string)) else False for string in cigars_dcs4] - softclipped_start4 = [int(string.split("S")[0]) if re.search(r"^[0-9]+S", string) else -1 for string in cigars_dcs4] - softclipped_end4 = [int(re.split("[A-Z]", str(string))[-2]) if re.search(r"S$", string) else -1 for string in cigars_dcs4] - dist_start_read4 = [(pos - soft) if soft != -1 else thr + 1000 for soft, pos in zip(softclipped_start4, pos_read4)] - dist_end_read4 = [(length_read - pos - soft) if soft != -1 else thr + 1000 for soft, pos, length_read in zip(softclipped_end4, pos_read4, end_read4)] - - # if read at both ends softclipped --> select end with smallest distance between mut position and softclipping - if any(ij is True for ij in softclipped_both_ends_idx4): - print(softclipped_both_ends_idx4) - for nr, indx in enumerate(softclipped_both_ends_idx4): - if indx: - if dist_start_read4[nr] <= dist_end_read4[nr]: - dist_end_read4[nr] = thr + 1000 # use dist of start and set start to very large number - else: - dist_start_read4[nr] = thr + 1000 # use dist of end and set start to very large number - ratio_dist_start4 = safe_div(sum([True if x <= thr else False for x in dist_start_read4]), float(sum(softclipped_idx4))) >= threshold_reads - ratio_dist_end4 = safe_div(sum([True if x <= thr else False for x in dist_end_read4]), float(sum(softclipped_idx4))) >= threshold_reads - print(key1, "mate1 ba", dist_start_read4, dist_end_read4,cigars_dcs4, ratio4, ratio_dist_start4, ratio_dist_end4) - - # mate 2 - SSCS ab - softclipped_idx2 = [True if re.search(r"^[0-9]+S", string) or re.search(r"S$", string) else False for string in cigars_dcs2] - #print(sum(softclipped_idx2)) - ratio2 = safe_div(sum(softclipped_idx2), float(len(softclipped_idx2))) >= threshold_reads - if any(ij is True for ij in softclipped_idx2): - softclipped_both_ends_idx2 = [True if (re.search(r"^[0-9]+S", string) and re.search(r"S$", string)) else False for string in cigars_dcs2] - softclipped_start2 = [int(string.split("S")[0]) if re.search(r"^[0-9]+S", string) else -1 for string in cigars_dcs2] - softclipped_end2 = [int(re.split("[A-Z]", str(string))[-2]) if re.search(r"S$", string) else -1 for string in cigars_dcs2] - dist_start_read2 = [(pos - soft) if soft != -1 else thr + 1000 for soft, pos in zip(softclipped_start2, pos_read2)] - dist_end_read2 = [(length_read - pos - soft) if soft != -1 else thr + 1000 for soft, pos, length_read in zip(softclipped_end2, pos_read2, end_read2)] - - # if read at both ends softclipped --> select end with smallest distance between mut position and softclipping - if any(ij is True for ij in softclipped_both_ends_idx2): - print(softclipped_both_ends_idx2) - for nr, indx in enumerate(softclipped_both_ends_idx2): - if indx: - if dist_start_read2[nr] <= dist_end_read2[nr]: - dist_end_read2[nr] = thr + 1000 # use dist of start and set start to very large number - else: - dist_start_read2[nr] = thr + 1000 # use dist of end and set start to very large number - ratio_dist_start2 = safe_div(sum([True if x <= thr else False for x in dist_start_read2]), float(sum(softclipped_idx2))) >= threshold_reads - #print(ratio_dist_end2) - #print([True if x <= thr else False for x in ratio_dist_end2]) - ratio_dist_end2 = safe_div(sum([True if x <= thr else False for x in dist_end_read2]), float(sum(softclipped_idx2))) >= threshold_reads - print(key1, "mate2 ab", dist_start_read2, dist_end_read2,cigars_dcs2, ratio2, ratio_dist_start2, ratio_dist_end2) - - # mate 2 - SSCS ba - softclipped_idx3 = [True if re.search(r"^[0-9]+S", string) or re.search(r"S$", string) else False for string in cigars_dcs3] - ratio3 = safe_div(sum(softclipped_idx3), float(len(softclipped_idx3))) >= threshold_reads - if any(ij is True for ij in softclipped_idx3): - softclipped_both_ends_idx3 = [True if (re.search(r"^[0-9]+S", string) and re.search(r"S$", string)) else False for string in cigars_dcs3] - softclipped_start3 = [int(string.split("S")[0]) if re.search(r"^[0-9]+S", string) else -1 for string in cigars_dcs3] - softclipped_end3 = [int(re.split("[A-Z]", str(string))[-2]) if re.search(r"S$", string) else -1 for string in cigars_dcs3] - dist_start_read3 = [(pos - soft) if soft != -1 else thr + 1000 for soft, pos in zip(softclipped_start3, pos_read3)] - dist_end_read3 = [(length_read - pos - soft) if soft != -1 else thr + 1000 for soft, pos, length_read in zip(softclipped_end3, pos_read3, end_read3)] - - # if read at both ends softclipped --> select end with smallest distance between mut position and softclipping - if any(ij is True for ij in softclipped_both_ends_idx3): - print(softclipped_both_ends_idx3) - for nr, indx in enumerate(softclipped_both_ends_idx3): - if indx: - if dist_start_read3[nr] <= dist_end_read3[nr]: - dist_end_read3[nr] = thr + 1000 # use dist of start and set start to a larger number than thresh - else: - dist_start_read3[nr] = thr + 1000 # use dist of end and set start to very large number - #print([True if x <= thr else False for x in dist_start_read3]) - ratio_dist_start3 = safe_div(sum([True if x <= thr else False for x in dist_start_read3]), float(sum(softclipped_idx3))) >= threshold_reads - ratio_dist_end3 = safe_div(sum([True if x <= thr else False for x in dist_end_read3]), float(sum(softclipped_idx3))) >= threshold_reads - print(key1, "mate2 ba", dist_start_read3, dist_end_read3,cigars_dcs3, ratio3, ratio_dist_start3, ratio_dist_end3) - - if ((all(float(ij) >= 0.5 for ij in [alt1ff, alt4ff]) & # contradictory variant - all(float(ij) == 0. for ij in [alt2ff, alt3ff])) | - (all(float(ij) >= 0.5 for ij in [alt2ff, alt3ff]) & - all(float(ij) == 0. for ij in [alt1ff, alt4ff]))): + if ((all(float(ij) >= 0.5 for ij in [alt1ff, alt4ff]) & all(float(ij) == 0. for ij in [alt2ff, alt3ff])) | (all(float(ij) >= 0.5 for ij in [alt2ff, alt3ff]) & all(float(ij) == 0. for ij in [alt1ff, alt4ff]))): alt1ff = 0 alt4ff = 0 alt2ff = 0 alt3ff = 0 trimmed = False contradictory = True - # softclipping tiers - # information of both mates available --> all reads for both mates and SSCS are softclipped - elif (ratio1 & ratio4 & ratio2 & ratio3 & - (ratio_dist_start1 | ratio_dist_end1) & (ratio_dist_start4 | ratio_dist_end4) & (ratio_dist_start2 | ratio_dist_end2) & (ratio_dist_start3 | ratio_dist_end3) & - all(float(ij) > 0. for ij in [alt1ff, alt2ff, alt3ff, alt4ff])): # all mates available - # if distance between softclipping and mutation is at start or end of the read smaller than threshold - softclipped_mutation_allMates = True - softclipped_mutation_oneOfTwoMates = False - softclipped_mutation_oneOfTwoSSCS = False - softclipped_mutation_oneMate = False - softclipped_mutation_oneMateOneSSCS = False - alt1ff = 0 - alt4ff = 0 - alt2ff = 0 - alt3ff = 0 - trimmed = False - contradictory = False - print(key1, "softclipped_mutation_allMates", softclipped_mutation_allMates) - # information of both mates available --> only one mate softclipped - elif (((ratio1 & ratio4 & (ratio_dist_start1 | ratio_dist_end1) & (ratio_dist_start4 | ratio_dist_end4)) | - (ratio2 & ratio3 & (ratio_dist_start2 | ratio_dist_end2) & (ratio_dist_start3 | ratio_dist_end3))) & - all(float(ij) > 0. for ij in [alt1ff, alt2ff, alt3ff, alt4ff])): # all mates available - # if distance between softclipping and mutation is at start or end of the read smaller than threshold - softclipped_mutation_allMates = False - softclipped_mutation_oneOfTwoMates = True - softclipped_mutation_oneOfTwoSSCS = False - softclipped_mutation_oneMate = False - softclipped_mutation_oneMateOneSSCS = False - alt1ff = 0 - alt4ff = 0 - alt2ff = 0 - alt3ff = 0 - trimmed = False - contradictory = False - print(key1, "softclipped_mutation_oneOfTwoMates", softclipped_mutation_oneOfTwoMates) - # information of both mates available --> only one mate softclipped - elif (((ratio1 & (ratio_dist_start1 | ratio_dist_end1)) | (ratio4 & (ratio_dist_start4 | ratio_dist_end4))) & - ((ratio2 & (ratio_dist_start2 | ratio_dist_end2)) | (ratio3 & (ratio_dist_start3 | ratio_dist_end3))) & - all(float(ij) > 0. for ij in [alt1ff, alt2ff, alt3ff, alt4ff])): # all mates available - # if distance between softclipping and mutation is at start or end of the read smaller than threshold - softclipped_mutation_allMates = False - softclipped_mutation_oneOfTwoMates = False - softclipped_mutation_oneOfTwoSSCS = True - softclipped_mutation_oneMate = False - softclipped_mutation_oneMateOneSSCS = False - alt1ff = 0 - alt4ff = 0 - alt2ff = 0 - alt3ff = 0 - trimmed = False - contradictory = False - print(key1, "softclipped_mutation_oneOfTwoSSCS", softclipped_mutation_oneOfTwoSSCS, [alt1ff, alt2ff, alt3ff, alt4ff]) - # information of one mate available --> all reads of one mate are softclipped - elif ((ratio1 & ratio4 & (ratio_dist_start1 | ratio_dist_end1) & (ratio_dist_start4 | ratio_dist_end4) & - all(float(ij) < 0. for ij in [alt2ff, alt3ff]) & all(float(ij) > 0. for ij in [alt1ff, alt4ff])) | - (ratio2 & ratio3 & (ratio_dist_start2 | ratio_dist_end2) & (ratio_dist_start3 | ratio_dist_end3) & - all(float(ij) < 0. for ij in [alt1ff, alt4ff]) & all(float(ij) > 0. for ij in [alt2ff, alt3ff]))): # all mates available - # if distance between softclipping and mutation is at start or end of the read smaller than threshold - #if ((((len(dist_start_read1) > 0 | len(dist_end_read1) > 0 ) & all(ij <= thr or nm <= thr for ij, nm in zip(dist_start_read1, dist_end_read1))) & - # ((len(dist_start_read4) > 0 | len(dist_end_read4) > 0 ) & all(ij <= thr or nm <= thr for ij, nm in zip(dist_start_read4, dist_end_read4)))) | - # (((len(dist_start_read2) > 0 | len(dist_end_read2) > 0 ) & all(ij <= thr or nm <= thr for ij, nm in zip(dist_start_read2, dist_end_read2))) & - # ((len(dist_start_read3) > 0 | len(dist_end_read3) > 0 ) & all(ij <= thr or nm <= thr for ij, nm in zip(dist_start_read3, dist_end_read3))))): - softclipped_mutation_allMates = False - softclipped_mutation_oneOfTwoMates = False - softclipped_mutation_oneOfTwoSSCS = False - softclipped_mutation_oneMate = True - softclipped_mutation_oneMateOneSSCS = False - alt1ff = 0 - alt4ff = 0 - alt2ff = 0 - alt3ff = 0 - trimmed = False - contradictory = False - print(key1, "softclipped_mutation_oneMate", softclipped_mutation_oneMate) - # information of one mate available --> only one SSCS is softclipped - elif ((((ratio1 & (ratio_dist_start1 | ratio_dist_end1)) | (ratio4 & (ratio_dist_start4 | ratio_dist_end4))) & - (all(float(ij) < 0. for ij in [alt2ff, alt3ff]) & all(float(ij) > 0. for ij in [alt1ff, alt4ff]))) | - (((ratio2 & (ratio_dist_start2 | ratio_dist_end2)) | (ratio3 & (ratio_dist_start3 | ratio_dist_end3))) & - (all(float(ij) < 0. for ij in [alt1ff, alt4ff]) & all(float(ij) < 0. for ij in [alt2ff, alt3ff])))): # all mates available - # if distance between softclipping and mutation is at start or end of the read smaller than threshold - #if ((all(ij <= thr or nm <= thr for ij, nm in zip(dist_start_read1, dist_end_read1)) | - # all(ij <= thr or nm <= thr for ij, nm in zip(dist_start_read4, dist_end_read4))) | - # (all(ij <= thr or nm <= thr for ij, nm in zip(dist_start_read2, dist_end_read2)) | - # all(ij <= thr or nm <= thr for ij, nm in zip(dist_start_read3, dist_end_read3)))): - softclipped_mutation_allMates = False - softclipped_mutation_oneOfTwoMates = False - softclipped_mutation_oneOfTwoSSCS = False - softclipped_mutation_oneMate = False - softclipped_mutation_oneMateOneSSCS = True - alt1ff = 0 - alt4ff = 0 - alt2ff = 0 - alt3ff = 0 - trimmed = False - contradictory = False - print(key1, "softclipped_mutation_oneMateOneSSCS", softclipped_mutation_oneMateOneSSCS) - else: if ((read_pos1 >= 0) and ((read_pos1 <= trim) | (abs(read_len_median1 - read_pos1) <= trim))): beg1 = total1new @@ -825,69 +535,47 @@ details2 = (total2, total3, total2new, total3new, ref2, ref3, alt2, alt3, ref2f, ref3f, alt2f, alt3f, na2, na3, lowq2, lowq3, beg2, beg3) # assign tiers - if ((all(int(ij) >= 3 for ij in [total1new, total4new]) & - all(float(ij) >= 0.75 for ij in [alt1ff, alt4ff])) | - (all(int(ij) >= 3 for ij in [total2new, total3new]) & - all(float(ij) >= 0.75 for ij in [alt2ff, alt3ff]))): + if ((all(int(ij) >= 3 for ij in [total1new, total4new]) & all(float(ij) >= 0.75 for ij in [alt1ff, alt4ff])) | (all(int(ij) >= 3 for ij in [total2new, total3new]) & all(float(ij) >= 0.75 for ij in [alt2ff, alt3ff]))): tier = "1.1" counter_tier11 += 1 tier_dict[key1]["tier 1.1"] += 1 - elif (all(int(ij) >= 1 for ij in [total1new, total2new, total3new, total4new]) & - any(int(ij) >= 3 for ij in [total1new, total4new]) & - any(int(ij) >= 3 for ij in [total2new, total3new]) & - all(float(ij) >= 0.75 for ij in [alt1ff, alt2ff, alt3ff, alt4ff])): + elif (all(int(ij) >= 1 for ij in [total1new, total2new, total3new, total4new]) & any(int(ij) >= 3 for ij in [total1new, total4new]) + & any(int(ij) >= 3 for ij in [total2new, total3new]) & all(float(ij) >= 0.75 for ij in [alt1ff, alt2ff, alt3ff, alt4ff])): tier = "1.2" counter_tier12 += 1 tier_dict[key1]["tier 1.2"] += 1 - elif ((all(int(ij) >= 1 for ij in [total1new, total4new]) & - any(int(ij) >= 3 for ij in [total1new, total4new]) & - all(float(ij) >= 0.75 for ij in [alt1ff, alt4ff])) | - (all(int(ij) >= 1 for ij in [total2new, total3new]) & - any(int(ij) >= 3 for ij in [total2new, total3new]) & - all(float(ij) >= 0.75 for ij in [alt2ff, alt3ff]))): + elif ((all(int(ij) >= 1 for ij in [total1new, total4new]) & any(int(ij) >= 3 for ij in [total1new, total4new]) & all(float(ij) >= 0.75 for ij in [alt1ff, alt4ff])) + | (all(int(ij) >= 1 for ij in [total2new, total3new]) & any(int(ij) >= 3 for ij in [total2new, total3new]) & all(float(ij) >= 0.75 for ij in [alt2ff, alt3ff]))): tier = "2.1" counter_tier21 += 1 tier_dict[key1]["tier 2.1"] += 1 - elif (all(int(ij) >= 1 for ij in [total1new, total2new, total3new, total4new]) & - all(float(ij) >= 0.75 for ij in [alt1ff, alt2ff, alt3ff, alt4ff])): + elif (all(int(ij) >= 1 for ij in [total1new, total2new, total3new, total4new]) & all(float(ij) >= 0.75 for ij in [alt1ff, alt2ff, alt3ff, alt4ff])): tier = "2.2" counter_tier22 += 1 tier_dict[key1]["tier 2.2"] += 1 - elif ((all(int(ij) >= 1 for ij in [total1new, total4new]) & - any(int(ij) >= 3 for ij in [total2new, total3new]) & - all(float(ij) >= 0.75 for ij in [alt1ff, alt4ff]) & - any(float(ij) >= 0.75 for ij in [alt2ff, alt3ff])) | - (all(int(ij) >= 1 for ij in [total2new, total3new]) & - any(int(ij) >= 3 for ij in [total1new, total4new]) & - all(float(ij) >= 0.75 for ij in [alt2ff, alt3ff]) & - any(float(ij) >= 0.75 for ij in [alt1ff, alt4ff]))): + elif ((all(int(ij) >= 1 for ij in [total1new, total4new]) & any(int(ij) >= 3 for ij in [total2new, total3new]) & all(float(ij) >= 0.75 for ij in [alt1ff, alt4ff]) & any(float(ij) >= 0.75 for ij in [alt2ff, alt3ff])) + | (all(int(ij) >= 1 for ij in [total2new, total3new]) & any(int(ij) >= 3 for ij in [total1new, total4new]) & all(float(ij) >= 0.75 for ij in [alt2ff, alt3ff]) & any(float(ij) >= 0.75 for ij in [alt1ff, alt4ff]))): tier = "2.3" counter_tier23 += 1 tier_dict[key1]["tier 2.3"] += 1 - elif ((all(int(ij) >= 1 for ij in [total1new, total4new]) & - all(float(ij) >= 0.75 for ij in [alt1ff, alt4ff])) | - (all(int(ij) >= 1 for ij in [total2new, total3new]) & - all(float(ij) >= 0.75 for ij in [alt2ff, alt3ff]))): + elif ((all(int(ij) >= 1 for ij in [total1new, total4new]) & all(float(ij) >= 0.75 for ij in [alt1ff, alt4ff])) + | (all(int(ij) >= 1 for ij in [total2new, total3new]) & all(float(ij) >= 0.75 for ij in [alt2ff, alt3ff]))): tier = "2.4" counter_tier24 += 1 tier_dict[key1]["tier 2.4"] += 1 - elif ((len(pure_tags_dict_short[key1]) > 1) & - (all(float(ij) >= 0.5 for ij in [alt1ff, alt4ff]) | - all(float(ij) >= 0.5 for ij in [alt2ff, alt3ff]))): + elif ((len(pure_tags_dict_short[key1]) > 1) & (all(float(ij) >= 0.5 for ij in [alt1ff, alt4ff]) | all(float(ij) >= 0.5 for ij in [alt2ff, alt3ff]))): tier = "3.1" counter_tier31 += 1 tier_dict[key1]["tier 3.1"] += 1 - elif ((all(int(ij) >= 1 for ij in [total1new, total4new]) & - all(float(ij) >= 0.5 for ij in [alt1ff, alt4ff])) | - (all(int(ij) >= 1 for ij in [total2new, total3new]) & - all(float(ij) >= 0.5 for ij in [alt2ff, alt3ff]))): + elif ((all(int(ij) >= 1 for ij in [total1new, total4new]) & all(float(ij) >= 0.5 for ij in [alt1ff, alt4ff])) + | (all(int(ij) >= 1 for ij in [total2new, total3new]) & all(float(ij) >= 0.5 for ij in [alt2ff, alt3ff]))): tier = "3.2" counter_tier32 += 1 tier_dict[key1]["tier 3.2"] += 1 @@ -902,38 +590,13 @@ counter_tier42 += 1 tier_dict[key1]["tier 4.2"] += 1 - elif softclipped_mutation_allMates: - tier = "5.1" - counter_tier51 += 1 - tier_dict[key1]["tier 5.1"] += 1 - - elif softclipped_mutation_oneOfTwoMates: - tier = "5.2" - counter_tier52 += 1 - tier_dict[key1]["tier 5.2"] += 1 - - elif softclipped_mutation_oneOfTwoSSCS: - tier = "5.3" - counter_tier53 += 1 - tier_dict[key1]["tier 5.3"] += 1 - - elif softclipped_mutation_oneMate: - tier = "5.4" - counter_tier54 += 1 - tier_dict[key1]["tier 5.4"] += 1 - - elif softclipped_mutation_oneMateOneSSCS: - tier = "5.5" - counter_tier55 += 1 - tier_dict[key1]["tier 5.5"] += 1 - else: - tier = "6" - counter_tier6 += 1 - tier_dict[key1]["tier 6"] += 1 + tier = "5" + counter_tier5 += 1 + tier_dict[key1]["tier 5"] += 1 chrom, pos, ref_a, alt_a = re.split(r'\#', key1) - var_id = '-'.join([chrom, str(int(pos)+1), ref, alt]) + var_id = '-'.join([chrom, str(int(pos) + 1), ref, alt]) sample_tag = key2[:-5] array2 = np.unique(whole_array) # remove duplicate sequences to decrease running time # exclude identical tag from array2, to prevent comparison to itself @@ -962,14 +625,14 @@ half1_mate2 = array2_half2 half2_mate2 = array2_half # calculate HD of "a" in the tag to all "a's" or "b" in the tag to all "b's" - dist = np.array([sum(itertools.imap(operator.ne, half1_mate1, c)) for c in half1_mate2]) + dist = np.array([sum(map(operator.ne, half1_mate1, c)) for c in half1_mate2]) min_index = np.where(dist == dist.min()) # get index of min HD # get all "b's" of the tag or all "a's" of the tag with minimum HD min_tag_half2 = half2_mate2[min_index] min_tag_array2 = array2[min_index] # get whole tag with min HD min_value = dist.min() # calculate HD of "b" to all "b's" or "a" to all "a's" - dist_second_half = np.array([sum(itertools.imap(operator.ne, half2_mate1, e)) + dist_second_half = np.array([sum(map(operator.ne, half2_mate1, e)) for e in min_tag_half2]) dist2 = dist_second_half.max() @@ -980,14 +643,7 @@ if min_value == 0 or dist2 == 0: min_tags_list_zeros.append(tag) chimera_tags.append(max_tag) - # chimeric = True - # else: - # chimeric = False - # if mate_b is False: - # text = "pos {}: sample tag: {}; HD a = {}; HD b' = {}; similar tag(s): {}; chimeric = {}".format(pos, sample_tag, min_value, dist2, list(max_tag), chimeric) - # else: - # text = "pos {}: sample tag: {}; HD a' = {}; HD b = {}; similar tag(s): {}; chimeric = {}".format(pos, sample_tag, dist2, min_value, list(max_tag), chimeric) i += 1 chimera_tags = [x for x in chimera_tags if x != []] chimera_tags_new = [] @@ -1027,19 +683,19 @@ {'type': 'formula', 'criteria': '=OR($B${}="1.1", $B${}="1.2")'.format(row + 1, row + 1), 'format': format1, - 'multi_range': 'L{}:M{} T{}:U{} B{}'.format(row + 1, row + 2, row + 1, row + 2, row + 1, row + 2)}) + 'multi_range': 'L{}:M{} T{}:U{} B{}'.format(row + 1, row + 2, row + 1, row + 2, row + 1)}) ws1.conditional_format('L{}:M{}'.format(row + 1, row + 2), {'type': 'formula', 'criteria': '=OR($B${}="2.1", $B${}="2.2", $B${}="2.3", $B${}="2.4")'.format(row + 1, row + 1, row + 1, row + 1), 'format': format3, - 'multi_range': 'L{}:M{} T{}:U{} B{}'.format(row + 1, row + 2, row + 1, row + 2, row + 1, row + 2)}) + 'multi_range': 'L{}:M{} T{}:U{} B{}'.format(row + 1, row + 2, row + 1, row + 2, row + 1)}) ws1.conditional_format('L{}:M{}'.format(row + 1, row + 2), {'type': 'formula', 'criteria': '=$B${}>="3"'.format(row + 1), 'format': format2, - 'multi_range': 'L{}:M{} T{}:U{} B{}'.format(row + 1, row + 2, row + 1, row + 2, row + 1, row + 2)}) + 'multi_range': 'L{}:M{} T{}:U{} B{}'.format(row + 1, row + 2, row + 1, row + 2, row + 1)}) + row += 3 - row += 3 if chimera_correction: chimeric_dcs_high_tiers = 0 chimeric_dcs = 0 @@ -1052,17 +708,18 @@ else: chimeric_dcs_high_tiers += high_tiers chimera_dict[key1] = (chimeric_dcs, chimeric_dcs_high_tiers) + # sheet 2 if chimera_correction: header_line2 = ('variant ID', 'cvrg', 'AC alt (all tiers)', 'AF (all tiers)', 'chimeras in AC alt (all tiers)', 'chimera-corrected cvrg', 'chimera-corrected AF (all tiers)', 'cvrg (tiers 1.1-2.4)', 'AC alt (tiers 1.1-2.4)', 'AF (tiers 1.1-2.4)', 'chimeras in AC alt (tiers 1.1-2.4)', 'chimera-corrected cvrg (tiers 1.1-2.4)', 'chimera-corrected AF (tiers 1.1-2.4)', 'AC alt (orginal DCS)', 'AF (original DCS)', - 'tier 1.1', 'tier 1.2', 'tier 2.1', 'tier 2.2', 'tier 2.3', 'tier 2.4', - 'tier 3.1', 'tier 3.2', 'tier 4.1', 'tier 4.2', 'tier 5.1', 'tier 5.2', 'tier 5.3', 'tier 5.4', 'tier 5.5', 'tier 6', 'AF 1.1-1.2', 'AF 1.1-2.1', 'AF 1.1-2.2', - 'AF 1.1-2.3', 'AF 1.1-2.4', 'AF 1.1-3.1', 'AF 1.1-3.2', 'AF 1.1-4.1', 'AF 1.1-4.2', 'AF 1.1-5.1', 'AF 1.1-5.2', 'AF 1.1-5.3', 'AF 1.1-5.4', 'AF 1.1-5.5', 'AF 1.1-6') + 'tier 1.1', 'tier 1.2', 'tier 2.1', 'tier 2.2', 'tier 2.3', 'tier 2.4', + 'tier 3.1', 'tier 3.2', 'tier 4.1', 'tier 4.2', 'tier 5', 'AF 1.1-1.2', 'AF 1.1-2.1', 'AF 1.1-2.2', + 'AF 1.1-2.3', 'AF 1.1-2.4', 'AF 1.1-3.1', 'AF 1.1-3.2', 'AF 1.1-4.1', 'AF 1.1-4.2', 'AF 1.1-5') else: header_line2 = ('variant ID', 'cvrg', 'AC alt (all tiers)', 'AF (all tiers)', 'cvrg (tiers 1.1-2.4)', 'AC alt (tiers 1.1-2.4)', 'AF (tiers 1.1-2.4)', 'AC alt (orginal DCS)', 'AF (original DCS)', 'tier 1.1', 'tier 1.2', 'tier 2.1', 'tier 2.2', 'tier 2.3', 'tier 2.4', - 'tier 3.1', 'tier 3.2', 'tier 4.1', 'tier 4.2', 'tier 5.1', 'tier 5.2', 'tier 5.3', 'tier 5.4', 'tier 5.5', 'tier 6', 'AF 1.1-1.2', 'AF 1.1-2.1', 'AF 1.1-2.2', - 'AF 1.1-2.3', 'AF 1.1-2.4', 'AF 1.1-3.1', 'AF 1.1-3.2', 'AF 1.1-4.1', 'AF 1.1-4.2', 'AF 1.1-5.1', 'AF 1.1-5.2', 'AF 1.1-5.3', 'AF 1.1-5.4', 'AF 1.1-5.5', 'AF 1.1-6') + 'tier 3.1', 'tier 3.2', 'tier 4.1', 'tier 4.2', 'tier 5', 'AF 1.1-1.2', 'AF 1.1-2.1', 'AF 1.1-2.2', + 'AF 1.1-2.3', 'AF 1.1-2.4', 'AF 1.1-3.1', 'AF 1.1-3.2', 'AF 1.1-4.1', 'AF 1.1-4.2', 'AF 1.1-5') ws2.write_row(0, 0, header_line2) row = 0 @@ -1078,7 +735,7 @@ alt_count = cvrg_dict[key1][1] cvrg = ref_count + alt_count - var_id = '-'.join([chrom, str(int(pos)+1), ref, alt]) + var_id = '-'.join([chrom, str(int(pos) + 1), ref, alt]) lst = [var_id, cvrg] used_tiers = [] cum_af = [] @@ -1088,8 +745,6 @@ if len(used_tiers) > 1: cum = safe_div(sum(used_tiers), cvrg) cum_af.append(cum) - if sum(used_tiers) == 0: # skip mutations that are filtered by the VA in the first place - continue lst.extend([sum(used_tiers), safe_div(sum(used_tiers), cvrg)]) if chimera_correction: chimeras_all = chimera_dict[key1][0] @@ -1114,21 +769,20 @@ lst = tuple(lst) ws2.write_row(row + 1, 0, lst) if chimera_correction: - ws2.conditional_format('P{}:Q{}'.format(row + 2, row + 2), {'type': 'formula', 'criteria': '=$P$1="tier 1.1"', 'format': format12, 'multi_range': 'P{}:Q{} P1:Q1'.format(row + 2, row + 2)}) - ws2.conditional_format('R{}:U{}'.format(row + 2, row + 2), {'type': 'formula', 'criteria': '=$R$1="tier 2.1"', 'format': format32, 'multi_range': 'R{}:U{} R1:U1'.format(row + 2, row + 2)}) - ws2.conditional_format('V{}:AE{}'.format(row + 2, row + 2), {'type': 'formula', 'criteria': '=$V$1="tier 3.1"', 'format': format22, 'multi_range': 'V{}:AE{} V1:AE1'.format(row + 2, row + 2)}) + ws2.conditional_format('P{}:Q{}'.format(row + 2, row + 2), {'type': 'formula', 'criteria': '=$P$1="tier 1.1"', 'format': format1, 'multi_range': 'P{}:Q{} P1:Q1'.format(row + 2, row + 2)}) + ws2.conditional_format('R{}:U{}'.format(row + 2, row + 2), {'type': 'formula', 'criteria': '=$R$1="tier 2.1"', 'format': format3, 'multi_range': 'R{}:U{} R1:U1'.format(row + 2, row + 2)}) + ws2.conditional_format('V{}:Z{}'.format(row + 2, row + 2), {'type': 'formula', 'criteria': '=$V$1="tier 3.1"', 'format': format2, 'multi_range': 'V{}:Z{} V1:Z1'.format(row + 2, row + 2)}) else: - ws2.conditional_format('J{}:K{}'.format(row + 2, row + 2), {'type': 'formula', 'criteria': '=$J$1="tier 1.1"', 'format': format12, 'multi_range': 'J{}:K{} J1:K1'.format(row + 2, row + 2)}) - ws2.conditional_format('L{}:O{}'.format(row + 2, row + 2), {'type': 'formula', 'criteria': '=$L$1="tier 2.1"', 'format': format32, 'multi_range': 'L{}:O{} L1:O1'.format(row + 2, row + 2)}) - ws2.conditional_format('P{}:Y{}'.format(row + 2, row + 2), {'type': 'formula', 'criteria': '=$P$1="tier 3.1"', 'format': format22, 'multi_range': 'P{}:Y{} P1:Y1'.format(row + 2, row + 2)}) + ws2.conditional_format('J{}:K{}'.format(row + 2, row + 2), {'type': 'formula', 'criteria': '=$J$1="tier 1.1"', 'format': format1, 'multi_range': 'J{}:K{} J1:K1'.format(row + 2, row + 2)}) + ws2.conditional_format('L{}:O{}'.format(row + 2, row + 2), {'type': 'formula', 'criteria': '=$L$1="tier 2.1"', 'format': format3, 'multi_range': 'L{}:O{} L1:O1'.format(row + 2, row + 2)}) + ws2.conditional_format('P{}:T{}'.format(row + 2, row + 2), {'type': 'formula', 'criteria': '=$P$1="tier 3.1"', 'format': format2, 'multi_range': 'P{}:T{} P1:T1'.format(row + 2, row + 2)}) row += 1 # sheet 3 sheet3 = [("tier 1.1", counter_tier11), ("tier 1.2", counter_tier12), ("tier 2.1", counter_tier21), ("tier 2.2", counter_tier22), ("tier 2.3", counter_tier23), ("tier 2.4", counter_tier24), ("tier 3.1", counter_tier31), ("tier 3.2", counter_tier32), ("tier 4.1", counter_tier41), - ("tier 4.2", counter_tier42), ("tier 5.1", counter_tier51), ("tier 5.2", counter_tier52), - ("tier 5.3", counter_tier53), ("tier 5.4", counter_tier54), ("tier 5.5", counter_tier55), ("tier 6", counter_tier6)] + ("tier 4.2", counter_tier42), ("tier 5", counter_tier5)] header = ("tier", "count") ws3.write_row(0, 0, header) @@ -1148,21 +802,7 @@ 'criteria': '=$A${}>="3"'.format(i + 2), 'format': format2}) - description_tiers = [("Tier 1.1", "both ab and ba SSCS present (>75% of the sites with alternative base) and minimal FS>=3 for both SSCS in at least one mate"), ("", ""), - ("Tier 1.2", "both ab and ba SSCS present (>75% of the sites with alt. base) and mate pair validation (min. FS=1) and minimal FS>=3 for at least one of the SSCS"), - ("Tier 2.1", "both ab and ba SSCS present (>75% of the sites with alt. base) and minimal FS>=3 for at least one of the SSCS in at least one mate"), - ("Tier 2.2", "both ab and ba SSCS present (>75% of the sites with alt. base) and mate pair validation (min. FS=1)"), - ("Tier 2.3", "both ab and ba SSCS present (>75% of the sites with alt. base) and minimal FS=1 for both SSCS in one mate and minimal FS>=3 for at least one of the SSCS in the other mate"), - ("Tier 2.4", "both ab and ba SSCS present (>75% of the sites with alt. base) and minimal FS=1 for both SSCS in at least one mate"), - ("Tier 3.1", "both ab and ba SSCS present (>50% of the sites with alt. base) and recurring mutation on this position"), - ("Tier 3.2", "both ab and ba SSCS present (>50% of the sites with alt. base) and minimal FS>=1 for both SSCS in at least one mate"), - ("Tier 4.1", "variants at the start or end of the reads"), ("Tier 4.2", "mates with contradictory information"), - ("Tier 5.1", "variant is close to softclipping in both mates"), - ("Tier 5.2", "variant is close to softclipping in one of the mates"), - ("Tier 5.3", "variant is close to softclipping in one of the SSCS of both mates"), - ("Tier 5.4", "variant is close to softclipping in one mate (no information of second mate"), - ("Tier 5.5", "variant is close to softclipping in one of the SSCS (no information of the second mate"), - ("Tier 6", "remaining variants")] + description_tiers = [("Tier 1.1", "both ab and ba SSCS present (>75% of the sites with alternative base) and minimal FS>=3 for both SSCS in at least one mate"), ("", ""), ("Tier 1.2", "both ab and ba SSCS present (>75% of the sites with alt. base) and mate pair validation (min. FS=1) and minimal FS>=3 for at least one of the SSCS"), ("Tier 2.1", "both ab and ba SSCS present (>75% of the sites with alt. base) and minimal FS>=3 for at least one of the SSCS in at least one mate"), ("Tier 2.2", "both ab and ba SSCS present (>75% of the sites with alt. base) and mate pair validation (min. FS=1)"), ("Tier 2.3", "both ab and ba SSCS present (>75% of the sites with alt. base) and minimal FS=1 for both SSCS in one mate and minimal FS>=3 for at least one of the SSCS in the other mate"), ("Tier 2.4", "both ab and ba SSCS present (>75% of the sites with alt. base) and minimal FS=1 for both SSCS in at least one mate"), ("Tier 3.1", "both ab and ba SSCS present (>50% of the sites with alt. base) and recurring mutation on this position"), ("Tier 3.2", "both ab and ba SSCS present (>50% of the sites with alt. base) and minimal FS>=1 for both SSCS in at least one mate"), ("Tier 4.1", "variants at the start or end of the reads"), ("Tier 4.2", "mates with contradictory information"), ("Tier 5", "remaining variants")] examples_tiers = [[("Chr5:5-20000-11068-C-G", "1.1", "AAAAAGATGCCGACTACCTT", "ab1.ba2", "254", "228", "287", "288", "289", "3", "6", "3", "6", "0", "0", "3", "6", "0", "0", "1", "1", "0", "0", "0", "0", "0", "0", "4081", "4098", "5", "10", "", ""), @@ -1228,15 +868,14 @@ ("", "", "TTTTTAAGAATAACCCACAC", "ab2.ba1", "100", "112", "140", "145", "263", "7", "12", "7", "12", "7", "12", "0", "0", "1", "1", "0", "0", "0", "0", "0", "0", "0", "0", "1", "1", "5348", "5350", "", "")], - [("" * 34), ("" * 34)], [("" * 34), ("" * 34)], [("" * 34), ("" * 34)], [("" * 34), ("" * 34)], [("" * 34), ("" * 34)], - [("Chr5:5-20000-13983-G-C", "6", "ATGTTGTGAATAACCCACAC", "ab1.ba2", None, "186", None, "276", "269", + [("Chr5:5-20000-13983-G-C", "5", "ATGTTGTGAATAACCCACAC", "ab1.ba2", None, "186", None, "276", "269", "0", "6", "0", "6", "0", "0", "0", "6", "0", "0", "0", "1", "0", "0", "0", "0", "0", "0", "1", "1", "5348", "5350", "", ""), ("", "", "ATGTTGTGAATAACCCACAC", "ab2.ba1", None, None, None, None, "269", "0", "0", "0", "0", "0", "0", "0", "0", None, None, None, None, "0", "0", "0", "0", "0", "0", "1", "1", "5348", "5350", "", "")]] - start_row = 20 + start_row = 15 ws3.write(start_row, 0, "Description of tiers with examples") ws3.write_row(start_row + 1, 0, header_line) row = 0 @@ -1245,16 +884,16 @@ ex = examples_tiers[i] for k in range(len(ex)): ws3.write_row(start_row + 2 + row + i + k + 2, 0, ex[k]) - ws3.conditional_format('L{}:M{}'.format(start_row + 2 + row + i + k + 2, start_row + 2 + row + i + k + 3), {'type': 'formula', 'criteria': '=OR($B${}="1.1", $B${}="1.2")'.format(start_row + 2 + row + i + k + 2, start_row + 2 + row + i + k + 2), 'format': format13, 'multi_range': 'L{}:M{} T{}:U{} B{}'.format(start_row + 2 + row + i + k + 2, start_row + 2 + row + i + k + 3, start_row + 2 + row + i + k + 2, start_row + 2 + row + i + k + 3, start_row + 2 + row + i + k + 2, start_row + 2 + row + i + k + 3)}) + ws3.conditional_format('L{}:M{}'.format(start_row + 2 + row + i + k + 2, start_row + 2 + row + i + k + 3), {'type': 'formula', 'criteria': '=OR($B${}="1.1", $B${}="1.2")'.format(start_row + 2 + row + i + k + 2, start_row + 2 + row + i + k + 2), 'format': format1, 'multi_range': 'L{}:M{} T{}:U{} B{}'.format(start_row + 2 + row + i + k + 2, start_row + 2 + row + i + k + 3, start_row + 2 + row + i + k + 2, start_row + 2 + row + i + k + 3, start_row + 2 + row + i + k + 2)}) ws3.conditional_format('L{}:M{}'.format(start_row + 2 + row + i + k + 2, start_row + 2 + row + i + k + 3), {'type': 'formula', 'criteria': '=OR($B${}="2.1",$B${}="2.2", $B${}="2.3", $B${}="2.4")'.format(start_row + 2 + row + i + k + 2, start_row + 2 + row + i + k + 2, start_row + 2 + row + i + k + 2, start_row + 2 + row + i + k + 2), - 'format': format33, - 'multi_range': 'L{}:M{} T{}:U{} B{}'.format(start_row + 2 + row + i + k + 2, start_row + 2 + row + i + k + 3, start_row + 2 + row + i + k + 2, start_row + 2 + row + i + k + 3, start_row + 2 + row + i + k + 2, start_row + 2 + row + i + k + 3)}) + 'format': format3, + 'multi_range': 'L{}:M{} T{}:U{} B{}'.format(start_row + 2 + row + i + k + 2, start_row + 2 + row + i + k + 3, start_row + 2 + row + i + k + 2, start_row + 2 + row + i + k + 3, start_row + 2 + row + i + k + 2)}) ws3.conditional_format('L{}:M{}'.format(start_row + 2 + row + i + k + 2, start_row + 2 + row + i + k + 3), {'type': 'formula', 'criteria': '=$B${}>="3"'.format(start_row + 2 + row + i + k + 2), - 'format': format23, - 'multi_range': 'L{}:M{} T{}:U{} B{}'.format(start_row + 2 + row + i + k + 2, start_row + 2 + row + i + k + 3, start_row + 2 + row + i + k + 2, start_row + 2 + row + i + k + 3, start_row + 2 + row + i + k + 2, start_row + 2 + row + i + k + 3)}) + 'format': format2, + 'multi_range': 'L{}:M{} T{}:U{} B{}'.format(start_row + 2 + row + i + k + 2, start_row + 2 + row + i + k + 3, start_row + 2 + row + i + k + 2, start_row + 2 + row + i + k + 3, start_row + 2 + row + i + k + 2)}) row += 3 workbook.close() workbook2.close() @@ -1263,4 +902,3 @@ if __name__ == '__main__': sys.exit(read2mut(sys.argv)) -
--- a/read2mut.xml Thu Feb 04 09:01:43 2021 +0000 +++ b/read2mut.xml Mon Feb 15 21:53:24 2021 +0000 @@ -1,16 +1,12 @@ <?xml version="1.0" encoding="UTF-8"?> -<tool id="read2mut" name="Call specific mutations in reads:" version="2.1.0" profile="19.01"> +<tool id="read2mut" name="Call specific mutations in reads:" version="2.0.1" profile="19.01"> <description>Looks for reads with mutation at known positions and calculates frequencies and stats.</description> <macros> <import>va_macros.xml</import> </macros> - <requirements> - <requirement type="package" version="2.7">python</requirement> - <requirement type="package" version="1.4.0">matplotlib</requirement> - <requirement type="package" version="0.15">pysam</requirement> + <expand macro="requirements"> <requirement type="package" version="1.1.0">xlsxwriter</requirement> - <requirement type="package" version="0.11.6">cyvcf2</requirement> - </requirements> + </expand> <command><![CDATA[ ln -s '$file2' bam_input.bam && ln -s '${file2.metadata.bam_index}' bam_input.bam.bai && @@ -23,11 +19,7 @@ --phred '$phred' --trim '$trim' $chimera_correction - --softclipping_dist '$softclipping_dist' - --reads_threshold '$reads_threshold' --outputFile '$output_xlsx' - --outputFile2 '$output_xlsx2' - --outputFile3 '$output_xlsx3' ]]> </command> <inputs> @@ -39,13 +31,9 @@ <param name="phred" type="integer" label="Phred quality score threshold" min="0" max="41" value="20" help="Integer threshold for Phred quality score. Only reads higher than this threshold are considered. Default = 20."/> <param name="trim" type="integer" label="Trimming threshold" value="10" help="Integer threshold for assigning mutations at start and end of reads to lower tier. Default 10."/> <param name="chimera_correction" type="boolean" label="Apply chimera correction?" truevalue="--chimera_correction" falsevalue="" checked="False" help="Count chimeric variants and correct the variant frequencies."/> - <param name="softclipping_dist" type="integer" label="Distance between artifact and softclipping of the reads" min="1" value="15" help="Count mutation as an artifact if mutation lies within this parameter away from the softclipping part of the reads. Default = 20"/> -<param name="reads_threshold" type="float" label="Minimum percentage of softclipped reads in a family" min="0.0" max="1.0" value="1.0" help="Float number which specifies the minimum percentage of softclipped reads in a family to be considered in the softclipping tiers. Default: 1.0, means all reads of a family have to be softclipped."/> </inputs> <outputs> - <data name="output_xlsx" format="xlsx" label="${tool.name} on ${on_string}: XLSX summary"/> - <data name="output_xlsx2" format="xlsx" label="${tool.name} on ${on_string}: XLSX allele frequencies"/> - <data name="output_xlsx3" format="xlsx" label="${tool.name} on ${on_string}: XLSX tiers"/> + <data name="output_xlsx" format="xlsx" label="${tool.name} on ${on_string}: XLSX"/> </outputs> <tests> <test> @@ -56,12 +44,8 @@ <param name="thresh" value="0"/> <param name="phred" value="20"/> <param name="trim" value="10"/> - <param name="chimera_correction"/> - <param name="softclipping_dist" value="15"/> - <param name="reads_threshold" value="1.0"/> - <output name="output_xlsx" file="Variant_Analyzer_summary_test.xlsx" decompress="true" lines_diff="10"/> - <output name="output_xlsx2" file="Variant_Analyzer_allele_frequencies_test.xlsx" decompress="true" lines_diff="10"/> - <output name="output_xlsx3" file="Variant_Analyzer_tiers_test.xlsx" decompress="true" lines_diff="10"/> + <param name="chimera_correction" value="True"/> + <output name="output_xlsx" file="Variant_Analyzer_test.xlsx" decompress="true" lines_diff="2"/> </test> </tests> <help> <![CDATA[ @@ -90,7 +74,7 @@ **Output** -The output are three XLSX files containing frequencies stats for DCS mutations based +The output is an XLSX file containing frequencies stats for DCS mutations based on information from the raw reads. In addition to that a tier based classification is provided based on the amout of support for a true variant call.
--- a/va_macros.xml Thu Feb 04 09:01:43 2021 +0000 +++ b/va_macros.xml Mon Feb 15 21:53:24 2021 +0000 @@ -1,13 +1,21 @@ <macros> <xml name="citation"> - <citations> - <citation type="bibtex"> - @misc{duplex, - author = {Povysil, Gundula and Heinzl, Monika and Salazar, Renato and Stoler, Nicholas and Nekrutenko, Anton and Tiemann-Boege, Irene}, - year = {2019}, - title = {{Variant Analyzer: a quality control for variant calling in duplex sequencing data (manuscript)}} - } - </citation> - </citations> -</xml> + <citations> + <citation type="bibtex"> + @misc{duplex, + author = {Povysil, Gundula and Heinzl, Monika and Salazar, Renato and Stoler, Nicholas and Nekrutenko, Anton and Tiemann-Boege, Irene}, + year = {2020}, + title = {{Increased yields of duplex sequencing data by a series of quality control tools (manuscript)}} + } + </citation> + </citations> + </xml> + <xml name="requirements"> + <requirements> + <requirement type="package" version="3.1.2">matplotlib</requirement> + <requirement type="package" version="0.15">pysam</requirement> + <requirement type="package" version="0.11.6">cyvcf2</requirement> + <yield/> + </requirements> + </xml> </macros> \ No newline at end of file