Mercurial > repos > miller-lab > genome_diversity

comparison extract_primers.xml @ 21:d6b961721037

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
Miller Lab Devshed version 4c04e35b18f6
author Richard Burhans <burhans@bx.psu.edu>
date Mon, 05 Nov 2012 12:44:17 -0500
parents 8ae67e9fb6ff
children
comparison
equal deleted inserted replaced
20:8a4b8efbc82c 21:d6b961721037
9 "--scaffold_col=$scaf_col" "--pos_col=$pos_col" "--species=$species" 9 "--scaffold_col=$scaf_col" "--pos_col=$pos_col" "--species=$species"
10 #end if 10 #end if
11 </command> 11 </command>
12 12
13 <inputs> 13 <inputs>
14 <param format="tabular" name="input" type="data" label="Selected SNPS dataset"/> 14 <param format="tabular" name="input" type="data" label="SNP dataset"/>
15 <conditional name="override_metadata"> 15 <conditional name="override_metadata">
16 <param name="choice" type="select" format="integer" label="choose columns"> 16 <param name="choice" type="select" format="integer" label="Choose columns" help="Datasets in gd_snp format have the columns in the metadata, all others need the columns chosen." >
17 <option value="0" selected="true">No, get columns from metadata</option> 17 <option value="0" selected="true">No, get columns from metadata</option>
18 <option value="1" >Yes, choose columns</option> 18 <option value="1" >Yes, choose columns</option>
19 </param> 19 </param>
20 <when value="0" /> 20 <when value="0" />
21 <when value="1"> 21 <when value="1">
44 </tests> 44 </tests>
45 45
46 46
47 <help> 47 <help>
48 48
49 **Dataset formats**
50
51 The input dataset is in tabular_ format and must contain a scaffold or
52 chromosome column and a position column. The output dataset is in text_
53 format as described below.
54 (`Dataset missing?`_)
55
56 .. _tabular: ./static/formatHelp.html#tab
57 .. _text: ./static/formatHelp.html#text
58 .. _Dataset missing?: ./static/formatHelp.html
59
60 -----
61
49 **What it does** 62 **What it does**
50 63
51 This tool extracts primers for SNPs in the dataset using the Primer3 program. 64 This tool extracts primers for SNPs in the dataset using the Primer3 program
52 The first line of output for a given SNP reports the name of the assembled 65 (Steve Rozen and Helen J. Skaletsky, 2000).
53 contig, the SNP's position in the contig, the two variant nucleotides, and 66 The first line of output for a given SNP reports the name of the assembled
54 Primer3's "pair penalty". The next line, if not blank, names restriction 67 contig, the SNP's position in the contig, the two variant nucleotides, and
55 enzymes (from the user-adjustable list) that differentially cut at that 68 Primer3's "pair penalty". The next line, if not blank, names restriction
56 site, but do not cut at any other position between and including the 69 enzymes (from the user-adjustable list) that differentially cut at that
57 primer positions. The next lines show the SNP's flanking regions, with 70 site, but do not cut at any other position between and including the
58 the SNP position indicated by "n", including the primer positions and an 71 primer positions. The next lines show the SNP's flanking regions, with
59 additional 3 nucleotides. 72 the SNP position indicated by "n", including the primer positions and an
73 additional 3 nucleotides.
74 <!-- is this precomputed?? how, where is the user-adjustable list? -->
60 75
61 ----- 76 -----
62 77
63 **Example** 78 **Example**
64 79
65 - input file:: 80 - input (gd_snp format)::
66 81
67 chr5_30800874_30802049 734 G A chr5 30801606 A 24 0 99 4 11 97 Y 496 0.502 0.033 0.215 6 82 chr5_30800874_30802049 734 G A chr5 30801606 A 24 0 99 4 11 97 Y 496 0.502 0.033 0.215 6
68 chr8_55117827_55119487 994 A G chr8 55118815 G 25 0 102 4 11 96 Y 22 0.502 0.025 2.365 1 83 chr8_55117827_55119487 994 A G chr8 55118815 G 25 0 102 4 11 96 Y 22 0.502 0.025 2.365 1
69 chr9_100484836_100485311 355 C T chr9 100485200 T 27 0 108 6 17 100 Y 190 0.512 0.880 2.733 4 84 chr9_100484836_100485311 355 C T chr9 100485200 T 27 0 108 6 17 100 Y 190 0.512 0.880 2.733 4
70 chr12_3635530_3637738 2101 T C chr12 3637630 T 25 0 102 4 13 93 Y 169 0.554 0.024 0.366 4 85 chr12_3635530_3637738 2101 T C chr12 3637630 T 25 0 102 4 13 93 Y 169 0.554 0.024 0.366 4
86 etc.
71 87
72 - output file:: 88 - output::
73 89
74 chr5_30800874_30802049 734 G A 0.352964 90 chr5_30800874_30802049 734 G A 0.352964
75 BglII,MboI,Sau3AI,Tru9I,XhoII 91 BglII,MboI,Sau3AI,Tru9I,XhoII
76 1 CTGAAGGTGAGCAGGATTCAGGAGACAGAAAACAAAGCCCAGGCCTGCCCAAGGTGGAAA 92 1 CTGAAGGTGAGCAGGATTCAGGAGACAGAAAACAAAGCCCAGGCCTGCCCAAGGTGGAAA
77 >>>>>>>>>>>>>>>>>>>> 93 >>>>>>>>>>>>>>>>>>>>