Mercurial > repos > nate > nate_test
comparison defuse.xml @ 2:999746fc92ba default tip
Uploaded
| author | nate |
|---|---|
| date | Thu, 10 Nov 2011 09:56:05 -0500 |
| parents | |
| children |
comparison
equal
deleted
inserted
replaced
| 1:ad220f659249 | 2:999746fc92ba |
|---|---|
| 1 <tool id="defuse" name="DeFuse" version="1.1"> | |
| 2 <description>identify fusion transcripts</description> | |
| 3 <requirements> | |
| 4 <requirement type="binary"></requirement> | |
| 5 </requirements> | |
| 6 <command interpreter="perl"> | |
| 7 ## Find the defuse.pl in the galaxy tool path | |
| 8 #import Cheetah.FileUtils | |
| 9 #set $toolpath = '/'.join([$__root_dir__,'tools','defuse']) | |
| 10 #set $defuse = $Cheetah.FileUtils.findFiles($toolpath,['defuse.pl'],[],['tools','external','include','em','data'])[0] | |
| 11 $defuse | |
| 12 -c `cp $defuse_config $config_txt; echo $defuse_config` | |
| 13 -d `mkdir -p data_dir; ln -s $left_pairendreads data_dir/reads_1.fastq; ln -s $right_pairendreads data_dir/reads_2.fastq; echo data_dir` | |
| 14 -o output_dir -p 8 | |
| 15 </command> | |
| 16 <inputs> | |
| 17 <param name="left_pairendreads" type="data" format="fastq" label="left part of read pairs" help="The left and right reads pairs must be in the same order, and not have any unpaired reads. (FASTQ interlacer will pair reads and remove the unpaired. FASTQ de-interlacer will separate the result into left and right reads.)"/> | |
| 18 <param name="right_pairendreads" type="data" format="fastq" label="right part of read pairs" help="In the same order as the left reads"/> | |
| 19 <conditional name="refGenomeSource"> | |
| 20 <param name="genomeSource" type="select" label="Will you select a built-in DeFuse Reference Dataset, or supply a configuration from your history" help=""> | |
| 21 <option value="indexed">Use a built-in DeFuse Reference Dataset</option> | |
| 22 <option value="history">Use a configuration from your history that specifies the DeFuse Reference Dataset</option> | |
| 23 </param> | |
| 24 <when value="indexed"> | |
| 25 <param name="index" type="select" label="Select a Reference Dataset" help="if your genome of interest is not listed - contact Galaxy team"> | |
| 26 <options from_file="defuse.loc"> | |
| 27 <column name="name" index="1"/> | |
| 28 <column name="value" index="2"/> | |
| 29 <filter type="sort_by" column="0" /> | |
| 30 <validator type="no_options" message="No indexes are available" /> | |
| 31 </options> | |
| 32 </param> | |
| 33 <conditional name="defuse_param"> | |
| 34 <param name="settings" type="select" label="Defuse parameter settings" help=""> | |
| 35 <option value="preSet">Default settings</option> | |
| 36 <option value="full">Full parameter list</option> | |
| 37 </param> | |
| 38 <when value="preSet" /> | |
| 39 <when value="full"> | |
| 40 <param name="max_insert_size" type="integer" value="500" optional="true" label="Bowtie max_insert_size" /> | |
| 41 <param name="dna_concordant_length" type="integer" value="2000" optional="true" label="Minimum gene fusion range dna_concordant_length" /> | |
| 42 <param name="discord_read_trim" type="integer" value="50" optional="true" label="Trim length for discordant reads discord_read_trim" help="(split reads are not trimmed)" /> | |
| 43 <param name="clustering_precision" type="float" value=".95" optional="true" label="Filter clustering_precision"> | |
| 44 <validator type="in_range" message="Choose a value between .1 and 1.0" min=".1" max="1"/> | |
| 45 </param> | |
| 46 <param name="span_count_threshold" type="integer" value="5" optional="true" label="Filter span_count_threshold" /> | |
| 47 <param name="split_count_threshold" type="integer" value="3" optional="true" label="Filter split_count_threshold" /> | |
| 48 <param name="percent_identity_threshold" type="float" value=".90" optional="true" label="Filter percent_identity_threshold"> | |
| 49 <validator type="in_range" message="Choose a value between .1 and 1.0" min=".1" max="1"/> | |
| 50 </param> | |
| 51 <param name="max_dist_pos" type="integer" value="600" optional="true" label="Filter max_dist_pos" /> | |
| 52 <param name="num_dist_genes" type="integer" value="500" optional="true" label="Filter num_dist_genes" /> | |
| 53 <param name="split_min_anchor" type="integer" value="4" optional="true" label="Filter split_min_anchor" /> | |
| 54 <param name="max_concordant_ratio" type="float" value="0.1" optional="true" label="Filter max_concordant_ratio"> | |
| 55 <validator type="in_range" message="Choose a value between 0.0 and 1.0" min="0" max="1"/> | |
| 56 </param> | |
| 57 <param name="splice_bias" type="integer" value="10" optional="true" label="Filter splice_bias" /> | |
| 58 <param name="probability_threshold" type="float" value="0.50" optional="true" label="Filter probability_threshold"> | |
| 59 <validator type="in_range" message="Choose a value between 0.0 and 1.0" min="0" max="1"/> | |
| 60 </param> | |
| 61 <param name="covariance_sampling_density" type="float" value="0.01" optional="true" label="covariance_sampling_density"> | |
| 62 <help>Position density when calculating covariance</help> | |
| 63 <validator type="in_range" message="Choose a value between 0.0 and 1.0" min="0" max="1"/> | |
| 64 </param> | |
| 65 <param name="denovo_assembly" type="select" label="denovo_assembly" help=""> | |
| 66 <option value="">Use Default</option> | |
| 67 <option value="no">no</option> | |
| 68 <option value="yes">yes</option> | |
| 69 </param> | |
| 70 <!-- | |
| 71 <param name="positive_controls" type="data" format="txt" optional=true label="Defuse positive_controls" help=""/> | |
| 72 --> | |
| 73 </when> <!-- full --> | |
| 74 </conditional> <!-- defuse_param --> | |
| 75 </when> | |
| 76 <when value="history"> | |
| 77 <param name="config" type="data" format="txt" label="Defuse Config file" help=""/> | |
| 78 </when> <!-- history --> | |
| 79 </conditional> <!-- refGenomeSource --> | |
| 80 </inputs> | |
| 81 <configfiles> | |
| 82 <configfile name="defuse_config"> | |
| 83 #import ast | |
| 84 #if $refGenomeSource.genomeSource == "history": | |
| 85 #include raw $refGenomeSource.config.__str__ | |
| 86 #else | |
| 87 #set $ref_dict = dict($ast.literal_eval($refGenomeSource.index.value)) | |
| 88 # | |
| 89 # Configuration file for defuse | |
| 90 # | |
| 91 # At a minimum, change all values enclused by [] | |
| 92 # | |
| 93 | |
| 94 # Directory where the defuse code was unpacked | |
| 95 ## Default location in the tool/defuse directory | |
| 96 # source_directory = ${__root_dir__}/tools/defuse | |
| 97 source_directory = #slurp | |
| 98 #try | |
| 99 $ref_dict['source_directory'] | |
| 100 #except | |
| 101 #try | |
| 102 ## Try to find the defuse source dir in the galaxy tool path | |
| 103 #import Cheetah.FileUtils | |
| 104 #set $toolpath = '/'.join([$__root_dir__,'tools','defuse']) | |
| 105 #set $defuse = $Cheetah.FileUtils.findFiles($toolpath,['defuse.pl'],[],['tools','external','include','em','data'])[0] | |
| 106 $defuse.replace('/scripts/defuse.pl','') | |
| 107 #except | |
| 108 ${__root_dir__}/tools/defuse/defuse | |
| 109 #end try | |
| 110 #end try | |
| 111 | |
| 112 # Directory where you want your dataset | |
| 113 dataset_directory = #slurp | |
| 114 #try | |
| 115 $ref_dict['dataset_directory'] | |
| 116 #except | |
| 117 /project/db/genomes/Hsapiens/hg19/defuse | |
| 118 #end try | |
| 119 | |
| 120 # Input genome and gene models | |
| 121 gene_models = #slurp | |
| 122 #try | |
| 123 $ref_dict['gene_models'] | |
| 124 #except | |
| 125 \$(dataset_directory)/Homo_sapiens.GRCh37.62.gtf | |
| 126 #end try | |
| 127 genome_fasta = #slurp | |
| 128 #try | |
| 129 $ref_dict['genome_fasta'] | |
| 130 #except | |
| 131 \$(dataset_directory)/Homo_sapiens.GRCh37.62.dna.chromosome.fa | |
| 132 #end try | |
| 133 | |
| 134 # Repeat table from ucsc genome browser | |
| 135 repeats_filename = #slurp | |
| 136 #try | |
| 137 $ref_dict['repeats_filename'] | |
| 138 #except | |
| 139 \$(dataset_directory)/rmsk.txt | |
| 140 #end try | |
| 141 | |
| 142 # EST info downloaded from ucsc genome browser | |
| 143 est_fasta = #slurp | |
| 144 #try | |
| 145 $ref_dict['est_fasta'] | |
| 146 #except | |
| 147 \$(dataset_directory)/est.fa | |
| 148 #end try | |
| 149 est_alignments = #slurp | |
| 150 #try | |
| 151 $ref_dict['est_alignments'] | |
| 152 #except | |
| 153 \$(dataset_directory)/intronEst.txt | |
| 154 #end try | |
| 155 | |
| 156 # Unigene clusters downloaded from ncbi | |
| 157 unigene_fasta = #slurp | |
| 158 #try | |
| 159 $ref_dict['unigene_fasta'] | |
| 160 #except | |
| 161 \$(dataset_directory)/Hs.seq.uniq | |
| 162 #end try | |
| 163 | |
| 164 # Paths to external tools | |
| 165 bowtie_bin = #slurp | |
| 166 #try | |
| 167 $ref_dict['bowtie_bin'] | |
| 168 #except | |
| 169 /soft/bowtie/0.12.7/bowtie | |
| 170 #end try | |
| 171 bowtie_build_bin = #slurp | |
| 172 #try | |
| 173 $ref_dict['bowtie_build_bin'] | |
| 174 #except | |
| 175 /soft/bowtie/0.12.7/bowtie-build | |
| 176 #end try | |
| 177 blat_bin = #slurp | |
| 178 #try | |
| 179 $ref_dict['blat_bin'] | |
| 180 #except | |
| 181 /soft/blat/34/bin/blat | |
| 182 #end try | |
| 183 fatotwobit_bin = #slurp | |
| 184 #try | |
| 185 $ref_dict['fatotwobit_bin'] | |
| 186 #except | |
| 187 /soft/blat/34/bin/faToTwoBit | |
| 188 #end try | |
| 189 r_bin = #slurp | |
| 190 #try | |
| 191 $ref_dict['r_bin'] | |
| 192 #except | |
| 193 /project/sdml-sles11-weblocal/R-2.12.1/bin/R | |
| 194 #end try | |
| 195 rscript_bin = #slurp | |
| 196 #try | |
| 197 $ref_dict['rscript_bin'] | |
| 198 #except | |
| 199 /project/sdml-sles11-weblocal/R-2.12.1/bin/Rscript | |
| 200 #end try | |
| 201 | |
| 202 #raw | |
| 203 # Dataset files | |
| 204 dataset_prefix = $(dataset_directory)/defuse | |
| 205 chromosome_prefix = $(dataset_prefix).dna.chromosomes | |
| 206 exons_fasta = $(dataset_prefix).exons.fa | |
| 207 cds_fasta = $(dataset_prefix).cds.fa | |
| 208 cdna_regions = $(dataset_prefix).cdna.regions | |
| 209 cdna_fasta = $(dataset_prefix).cdna.fa | |
| 210 reference_fasta = $(dataset_prefix).reference.fa | |
| 211 rrna_fasta = $(dataset_prefix).rrna.fa | |
| 212 ig_gene_list = $(dataset_prefix).ig.gene.list | |
| 213 repeats_regions = $(dataset_directory)/repeats.regions | |
| 214 est_split_fasta1 = $(dataset_directory)/est.1.fa | |
| 215 est_split_fasta2 = $(dataset_directory)/est.2.fa | |
| 216 est_split_fasta3 = $(dataset_directory)/est.3.fa | |
| 217 est_split_fasta4 = $(dataset_directory)/est.4.fa | |
| 218 est_split_fasta5 = $(dataset_directory)/est.5.fa | |
| 219 est_split_fasta6 = $(dataset_directory)/est.6.fa | |
| 220 est_split_fasta7 = $(dataset_directory)/est.7.fa | |
| 221 est_split_fasta8 = $(dataset_directory)/est.8.fa | |
| 222 est_split_fasta9 = $(dataset_directory)/est.9.fa | |
| 223 | |
| 224 # Fasta files with bowtie indices for prefiltering reads for concordantly mapping pairs | |
| 225 prefilter1 = $(unigene_fasta) | |
| 226 | |
| 227 # deFuse scripts and tools | |
| 228 scripts_directory = $(source_directory)/scripts | |
| 229 tools_directory = $(source_directory)/tools | |
| 230 data_directory = $(source_directory)/data | |
| 231 #end raw | |
| 232 | |
| 233 # Path to samtools, 0.1.8 is compiled for you, use other versions at your own risk | |
| 234 samtools_bin = #slurp | |
| 235 #try | |
| 236 $ref_dict['samtools_bin'] | |
| 237 #except | |
| 238 \$(source_directory)/external/samtools-0.1.8/samtools | |
| 239 #end try | |
| 240 | |
| 241 # Bowtie parameters | |
| 242 bowtie_threads = #slurp | |
| 243 #try | |
| 244 $ref_dict['bowtie_threads'] | |
| 245 #except | |
| 246 1 | |
| 247 #end try | |
| 248 bowtie_quals = #slurp | |
| 249 #try | |
| 250 $ref_dict['bowtie_quals'] | |
| 251 #except | |
| 252 --phred33-quals | |
| 253 #end try | |
| 254 max_insert_size = #slurp | |
| 255 #if $refGenomeSource.defuse_param.settings == "full" and $refGenomeSource.defuse_param.max_insert_size.__str__ != "": | |
| 256 $refGenomeSource.defuse_param.max_insert_size | |
| 257 #else | |
| 258 #try | |
| 259 $ref_dict['max_insert_size'] | |
| 260 #except | |
| 261 500 | |
| 262 #end try | |
| 263 #end if | |
| 264 | |
| 265 # Parameters for building the dataset | |
| 266 chromosomes = #slurp | |
| 267 #try | |
| 268 $ref_dict.chromosomes | |
| 269 #except | |
| 270 1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,X,Y,MT | |
| 271 #end try | |
| 272 mt_chromosome = #slurp | |
| 273 #try | |
| 274 $ref_dict['mt_chromosome'] | |
| 275 #except | |
| 276 MT | |
| 277 #end try | |
| 278 gene_sources = #slurp | |
| 279 #try | |
| 280 $ref_dict['gene_sources'] | |
| 281 #except | |
| 282 IG_C_gene,IG_D_gene,IG_J_gene,IG_V_gene,processed_transcript,protein_coding | |
| 283 #end try | |
| 284 ig_gene_sources = #slurp | |
| 285 #try | |
| 286 $ref_dict['ig_gene_sources'] | |
| 287 #except | |
| 288 IG_C_gene,IG_D_gene,IG_J_gene,IG_V_gene,IG_pseudogene | |
| 289 #end try | |
| 290 rrna_gene_sources = #slurp | |
| 291 #try | |
| 292 $ref_dict['rrna_gene_sources'] | |
| 293 #except | |
| 294 Mt_rRNA,rRNA,rRNA_pseudogene | |
| 295 #end try | |
| 296 | |
| 297 # Blat sequences per job | |
| 298 num_blat_sequences = #slurp | |
| 299 #try | |
| 300 $ref_dict['num_blat_sequences'] | |
| 301 #except | |
| 302 10000 | |
| 303 #end try | |
| 304 | |
| 305 # Minimum gene fusion range | |
| 306 dna_concordant_length = #slurp | |
| 307 #if $refGenomeSource.defuse_param.settings == "full" and $refGenomeSource.defuse_param.dna_concordant_length.__str__ != "": | |
| 308 $refGenomeSource.defuse_param.dna_concordant_length | |
| 309 #else | |
| 310 #try | |
| 311 $ref_dict['dna_concordant_length'] | |
| 312 #except | |
| 313 2000 | |
| 314 #end try | |
| 315 #end if | |
| 316 | |
| 317 # Trim length for discordant reads (split reads are not trimmed) | |
| 318 discord_read_trim = #slurp | |
| 319 #if $refGenomeSource.defuse_param.settings == "full" and $refGenomeSource.defuse_param.discord_read_trim.__str__ != "": | |
| 320 $refGenomeSource.defuse_param.discord_read_trim | |
| 321 #else | |
| 322 #try | |
| 323 $ref_dict['discord_read_trim'] | |
| 324 #except | |
| 325 50 | |
| 326 #end try | |
| 327 #end if | |
| 328 | |
| 329 # Filtering parameters | |
| 330 clustering_precision = #slurp | |
| 331 #if $refGenomeSource.defuse_param.settings == "full" and $refGenomeSource.defuse_param.clustering_precision.__str__ != "" | |
| 332 $refGenomeSource.defuse_param.clustering_precision | |
| 333 #else | |
| 334 #try | |
| 335 $ref_dict['clustering_precision'] | |
| 336 #except | |
| 337 0.95 | |
| 338 #end try | |
| 339 #end if | |
| 340 span_count_threshold = #slurp | |
| 341 #if $refGenomeSource.defuse_param.settings == "full" and $refGenomeSource.defuse_param.span_count_threshold.__str__ != "" | |
| 342 $refGenomeSource.defuse_param.span_count_threshold | |
| 343 #else | |
| 344 #try | |
| 345 $ref_dict['span_count_threshold'] | |
| 346 #except | |
| 347 5 | |
| 348 #end try | |
| 349 #end if | |
| 350 split_count_threshold = #slurp | |
| 351 #if $refGenomeSource.defuse_param.settings == "full" and $refGenomeSource.defuse_param.split_count_threshold.__str__ != "" | |
| 352 $refGenomeSource.defuse_param.split_count_threshold | |
| 353 #else | |
| 354 #try | |
| 355 $ref_dict['split_count_threshold'] | |
| 356 #except | |
| 357 3 | |
| 358 #end try | |
| 359 #end if | |
| 360 percent_identity_threshold = #slurp | |
| 361 #if $refGenomeSource.defuse_param.settings == "full" and $refGenomeSource.defuse_param.percent_identity_threshold.__str__ != "" | |
| 362 $refGenomeSource.defuse_param.percent_identity_threshold | |
| 363 #else | |
| 364 #try | |
| 365 $ref_dict['percent_identity_threshold'] | |
| 366 #except | |
| 367 0.90 | |
| 368 #end try | |
| 369 #end if | |
| 370 max_dist_pos = #slurp | |
| 371 #if $refGenomeSource.defuse_param.settings == "full" and $refGenomeSource.defuse_param.max_dist_pos.__str__ != "" | |
| 372 $refGenomeSource.defuse_param.max_dist_pos | |
| 373 #else | |
| 374 #try | |
| 375 $ref_dict['max_dist_pos'] | |
| 376 #except | |
| 377 600 | |
| 378 #end try | |
| 379 #end if | |
| 380 num_dist_genes = #slurp | |
| 381 #if $refGenomeSource.defuse_param.settings == "full" and $refGenomeSource.defuse_param.num_dist_genes.__str__ != "" | |
| 382 $refGenomeSource.defuse_param.num_dist_genes | |
| 383 #else | |
| 384 #try | |
| 385 $ref_dict['num_dist_genes'] | |
| 386 #except | |
| 387 500 | |
| 388 #end try | |
| 389 #end if | |
| 390 split_min_anchor = #slurp | |
| 391 #if $refGenomeSource.defuse_param.settings == "full" and $refGenomeSource.defuse_param.split_min_anchor.__str__ != "" | |
| 392 $refGenomeSource.defuse_param.split_min_anchor | |
| 393 #else | |
| 394 #try | |
| 395 $ref_dict['split_min_anchor'] | |
| 396 #except | |
| 397 4 | |
| 398 #end try | |
| 399 #end if | |
| 400 max_concordant_ratio = #slurp | |
| 401 #if $refGenomeSource.defuse_param.settings == "full" and $refGenomeSource.defuse_param.max_concordant_ratio.__str__ != "" | |
| 402 $refGenomeSource.defuse_param.max_concordant_ratio | |
| 403 #else | |
| 404 #try | |
| 405 $ref_dict['max_concordant_ratio'] | |
| 406 #except | |
| 407 0.1 | |
| 408 #end try | |
| 409 #end if | |
| 410 splice_bias = #slurp | |
| 411 #if $refGenomeSource.defuse_param.settings == "full" and $refGenomeSource.defuse_param.splice_bias.__str__ != "" | |
| 412 $refGenomeSource.defuse_param.splice_bias | |
| 413 #else | |
| 414 #try | |
| 415 $ref_dict['splice_bias'] | |
| 416 #except | |
| 417 10 | |
| 418 #end try | |
| 419 #end if | |
| 420 denovo_assembly = #slurp | |
| 421 #if $refGenomeSource.defuse_param.settings == "full" and $refGenomeSource.defuse_param.denovo_assembly.__str__ != "" | |
| 422 $refGenomeSource.defuse_param.denovo_assembly | |
| 423 #else | |
| 424 #try | |
| 425 $ref_dict['denovo_assembly'] | |
| 426 #except | |
| 427 no | |
| 428 #end try | |
| 429 #end if | |
| 430 probability_threshold = #slurp | |
| 431 #if $refGenomeSource.defuse_param.settings == "full" and $refGenomeSource.defuse_param.probability_threshold.__str__ != "" | |
| 432 $refGenomeSource.defuse_param.probability_threshold | |
| 433 #else | |
| 434 #try | |
| 435 $ref_dict['probability_threshold'] | |
| 436 #except | |
| 437 0.50 | |
| 438 #end try | |
| 439 #end if | |
| 440 positive_controls = \$(data_directory)/controls.txt | |
| 441 | |
| 442 # Position density when calculating covariance | |
| 443 covariance_sampling_density = #slurp | |
| 444 #if $refGenomeSource.defuse_param.settings == "full" and $refGenomeSource.defuse_param.covariance_sampling_density.__str__ != "" | |
| 445 $refGenomeSource.defuse_param.covariance_sampling_density | |
| 446 #else | |
| 447 #try | |
| 448 $ref_dict['covariance_sampling_density'] | |
| 449 #except | |
| 450 0.01 | |
| 451 #end try | |
| 452 #end if | |
| 453 | |
| 454 | |
| 455 # Number of reads for each job in split | |
| 456 reads_per_job = 1000000 | |
| 457 | |
| 458 # Number of regions for each breakpoint sequence job in split | |
| 459 regions_per_job = 20 | |
| 460 | |
| 461 #raw | |
| 462 # If you have command line 'mail' and wish to be notified | |
| 463 # mailto = andrew.mcpherson@gmail.com | |
| 464 | |
| 465 # Remove temp files | |
| 466 remove_job_files = yes | |
| 467 remove_job_temp_files = yes | |
| 468 | |
| 469 # Converting to fastq | |
| 470 # Fastq converter config format 1 for reads stored in separate files for each end | |
| 471 # data_lane_rexex_N is a perl regex which stores the lane id in $1 | |
| 472 # data_end_regex_N is a perl regex which stores the end, 1 or 2, in $1 | |
| 473 # data_compress_regex_N is a perl regex which stores the compression extension in $1 | |
| 474 # data_convert_N is the associated conversion utility that takes data at stdin and outputs fastq at stdout | |
| 475 # Fastq converter config format 2 for reads stored in separate files for each end | |
| 476 # data_lane_regex_N is a perl regex which stores the lane id in $1 | |
| 477 # data_compress_regex_N is a perl regex which stores the compression extension in $1 | |
| 478 # data_end1_converter_N is the associated conversion utility that takes data at stdin and outputs fastq for end 1 at stdout | |
| 479 # data_end2_converter_N is the associated conversion utility that takes data at stdin and outputs fastq for end 2 at stdout | |
| 480 | |
| 481 data_lane_regex_1 = ^(.+)_[12]_export\.txt.*$ | |
| 482 data_end_regex_1 = ^.+_([12])_export\.txt.*$ | |
| 483 data_compress_regex_1 = ^.+_[12]_export\.txt(.*)$ | |
| 484 data_converter_1 = $(scripts_directory)/fq_all2std.pl export2std | |
| 485 | |
| 486 data_lane_regex_2 = ^(.+)_[12]_concat_qseq\.txt.*$ | |
| 487 data_end_regex_2 = ^.+_([12])_concat_qseq\.txt.*$ | |
| 488 data_compress_regex_2 = ^.+_[12]_concat_qseq\.txt(.*)$ | |
| 489 data_converter_2 = $(scripts_directory)/qseq2fastq.pl | |
| 490 | |
| 491 data_lane_regex_3 = ^(.+)\.bam.*$ | |
| 492 data_compress_regex_3 = ^.+\.bam(.*)$ | |
| 493 data_end1_converter_3 = samtools view - | filter_sam_mate.pl 1 | sam_to_fastq.pl | |
| 494 data_end2_converter_3 = samtools view - | filter_sam_mate.pl 2 | sam_to_fastq.pl | |
| 495 | |
| 496 data_lane_regex_4 = ^(.+).[12].fastq.*$ | |
| 497 data_end_regex_4 = ^.+.([12]).fastq.*$ | |
| 498 data_compress_regex_4 = ^.+.[12].fastq(.*)$ | |
| 499 data_converter_4 = cat | |
| 500 #end raw | |
| 501 | |
| 502 #end if | |
| 503 | |
| 504 </configfile> | |
| 505 </configfiles> | |
| 506 <outputs> | |
| 507 <data format="txt" name="config_txt" label="${tool.name} on ${on_string}: config.txt"/> | |
| 508 <data format="txt" name="defuse_log" label="${tool.name} on ${on_string}: defuse.log" from_work_dir="output_dir/log/defuse.log"/> | |
| 509 <data format="tabular" name="results_tsv" label="${tool.name} on ${on_string}: results.tsv" from_work_dir="output_dir/results.tsv"/> | |
| 510 <data format="tabular" name="results_filtered_tsv" label="${tool.name} on ${on_string}: results.filtered.tsv" from_work_dir="output_dir/results.filtered.tsv"/> | |
| 511 <data format="tabular" name="results_classify_tsv" label="${tool.name} on ${on_string}: results.classify.tsv" from_work_dir="output_dir/results.classify.tsv"/> | |
| 512 </outputs> | |
| 513 <tests> | |
| 514 </tests> | |
| 515 <help> | |
| 516 **DeFuse** | |
| 517 | |
| 518 DeFuse_ is a software package for gene fusion discovery using RNA-Seq data. The software uses clusters of discordant paired end alignments to inform a split read alignment analysis for finding fusion boundaries. The software also employs a number of heuristic filters in an attempt to reduce the number of false positives and produces a fully annotated output for each predicted fusion. | |
| 519 | |
| 520 Journal reference: http://www.ploscompbiol.org/article/info%3Adoi%2F10.1371%2Fjournal.pcbi.1001138 | |
| 521 | |
| 522 .. _DeFuse: http://sourceforge.net/apps/mediawiki/defuse/index.php?title=Main_Page | |
| 523 | |
| 524 ------ | |
| 525 | |
| 526 **Inputs** | |
| 527 | |
| 528 DeFuse requires 2 fastq files for paried reads, one with the left mate of the paired reads, and a second fastq with the the right mate of the paired reads (**with reads in the same order as in the first fastq dataset**). | |
| 529 | |
| 530 If your fastq files have reads in different orders or include unpaired reads, you can preprocess them with **FASTQ interlacer** to create a single interlaced fastq dataset with only the paired reads and input that to **FASTQ de-interlacer** to separate the reads into a left fastq and right fastq. | |
| 531 | |
| 532 DeFuse uses a Reference Dataset to search for gene fusions. The Reference Dataset is generated from the following sources in DeFuse_Version_0.4_: | |
| 533 - genome_fasta from Ensembl | |
| 534 - gene_models from Ensembl | |
| 535 - repeats_filename from UCSC RepeatMasker rmsk.txt | |
| 536 - est_fasta from UCSC | |
| 537 - est_alignments from UCSC intronEst.txt | |
| 538 - unigene_fasta from NCBI | |
| 539 | |
| 540 .. _DeFuse_Version_0.4: http://sourceforge.net/apps/mediawiki/defuse/index.php?title=DeFuse_Version_0.4.2 | |
| 541 | |
| 542 ------ | |
| 543 | |
| 544 **Outputs** | |
| 545 | |
| 546 The galaxy history will contain 5 outputs: the config.txt file that provides DeFuse with its parameters, the defuse.log which details what DeFuse has done and can be useful in determining any errors, and the 3 results files that defuse generates. | |
| 547 | |
| 548 DeFuse generates 3 results files: results.txt, results.filtered.txt, and results.classify.txt. All three files have the same format, though results.classify.txt has a probability column from the application of the classifier to results.txt, and results.filtered.txt has been filtered according to the threshold probability as set in config.txt. | |
| 549 | |
| 550 The file format is tab delimited with one prediction per line, and the following fields per prediction (not necessarily in this order): | |
| 551 | |
| 552 - **Identification** | |
| 553 - cluster_id : random identifier assigned to each prediction | |
| 554 - library_name : library name given on the command line of defuse | |
| 555 - gene1 : ensembl id of gene 1 | |
| 556 - gene2 : ensembl id of gene 2 | |
| 557 - gene_name1 : name of gene 1 | |
| 558 - gene_name2 : name of gene 2 | |
| 559 - **Evidence** | |
| 560 - break_predict : breakpoint prediction method, denovo or splitr, that is considered most reliable | |
| 561 - concordant_ratio : proportion of spanning reads considered concordant by blat | |
| 562 - denovo_min_count : minimum kmer count across denovo assembled sequence | |
| 563 - denovo_sequence : fusion sequence predicted by debruijn based denovo sequence assembly | |
| 564 - denovo_span_pvalue : p-value, lower values are evidence the prediction is a false positive | |
| 565 - gene_align_strand1 : alignment strand for spanning read alignments to gene 1 | |
| 566 - gene_align_strand2 : alignment strand for spanning read alignments to gene 2 | |
| 567 - min_map_count : minimum of the number of genomic mappings for each spanning read | |
| 568 - max_map_count : maximum of the number of genomic mappings for each spanning read | |
| 569 - mean_map_count : average of the number of genomic mappings for each spanning read | |
| 570 - num_multi_map : number of spanning reads that map to more than one genomic location | |
| 571 - span_count : number of spanning reads supporting the fusion | |
| 572 - span_coverage1 : coverage of spanning reads aligned to gene 1 as a proportion of expected coverage | |
| 573 - span_coverage2 : coverage of spanning reads aligned to gene 2 as a proportion of expected coverage | |
| 574 - span_coverage_min : minimum of span_coverage1 and span_coverage2 | |
| 575 - span_coverage_max : maximum of span_coverage1 and span_coverage2 | |
| 576 - splitr_count : number of split reads supporting the prediction | |
| 577 - splitr_min_pvalue : p-value, lower values are evidence the prediction is a false positive | |
| 578 - splitr_pos_pvalue : p-value, lower values are evidence the prediction is a false positive | |
| 579 - splitr_sequence : fusion sequence predicted by split reads | |
| 580 - splitr_span_pvalue : p-value, lower values are evidence the prediction is a false positive | |
| 581 - **Annotation** | |
| 582 - adjacent : fusion between adjacent genes | |
| 583 - altsplice : fusion likely the product of alternative splicing between adjacent genes | |
| 584 - break_adj_entropy1 : di-nucleotide entropy of the 40 nucleotides adjacent to the fusion splice in gene 1 | |
| 585 - break_adj_entropy2 : di-nucleotide entropy of the 40 nucleotides adjacent to the fusion splice in gene 2 | |
| 586 - break_adj_entropy_min : minimum of break_adj_entropy1 and break_adj_entropy2 | |
| 587 - breakpoint_homology : number of nucleotides at the fusion splice that align equally well to gene 1 or gene 2 | |
| 588 - breakseqs_estislands_percident : maximum percent identity of fusion sequence alignments to est islands | |
| 589 - cdna_breakseqs_percident : maximum percent identity of fusion sequence alignments to cdna | |
| 590 - deletion : fusion produced by a genomic deletion | |
| 591 - est_breakseqs_percident : maximum percent identity of fusion sequence alignments to est | |
| 592 - eversion : fusion produced by a genomic eversion | |
| 593 - exonboundaries : fusion splice at exon boundaries | |
| 594 - expression1 : expression of gene 1 as number of concordant pairs aligned to exons | |
| 595 - expression2 : expression of gene 2 as number of concordant pairs aligned to exons | |
| 596 - gene_chromosome1 : chromosome of gene 1 | |
| 597 - gene_chromosome2 : chromosome of gene 2 | |
| 598 - gene_end1 : end position for gene 1 | |
| 599 - gene_end2 : end position for gene 2 | |
| 600 - gene_location1 : location of breakpoint in gene 1 | |
| 601 - gene_location2 : location of breakpoint in gene 2 | |
| 602 - gene_start1 : start of gene 1 | |
| 603 - gene_start2 : start of gene 2 | |
| 604 - gene_strand1 : strand of gene 1 | |
| 605 - gene_strand2 : strand of gene 2 | |
| 606 - genome_breakseqs_percident : maximum percent identity of fusion sequence alignments to genome | |
| 607 - genomic_break_pos1 : genomic position in gene 1 of fusion splice / breakpoint | |
| 608 - genomic_break_pos2 : genomic position in gene 2 of fusion splice / breakpoint | |
| 609 - genomic_strand1 : genomic strand in gene 1 of fusion splice / breakpoint, retained sequence upstream on this strand, breakpoint is downstream | |
| 610 - genomic_strand2 : genomic strand in gene 2 of fusion splice / breakpoint, retained sequence upstream on this strand, breakpoint is downstream | |
| 611 - interchromosomal : fusion produced by an interchromosomal translocation | |
| 612 - interrupted_index1 : ratio of coverage before and after the fusion splice / breakpoint in gene 1 | |
| 613 - interrupted_index2 : ratio of coverage before and after the fusion splice / breakpoint in gene 2 | |
| 614 - inversion : fusion produced by genomic inversion | |
| 615 - orf : fusion combines genes in a way that preserves a reading frame | |
| 616 - probability : probability produced by classification using adaboost and example positives/negatives (only given in results.classified.txt) | |
| 617 - read_through : fusion involving adjacent potentially resulting from co-transcription rather than genome rearrangement | |
| 618 - repeat_proportion1 : proportion of the spanning reads in gene 1 that span a repeat region | |
| 619 - repeat_proportion2 : proportion of the spanning reads in gene 2 that span a repeat region | |
| 620 - max_repeat_proportion : max of repeat_proportion1 and repeat_proportion2 | |
| 621 - splice_score : number of nucleotides similar to GTAG at fusion splice | |
| 622 - num_splice_variants : number of potential splice variants for this gene pair | |
| 623 - splicing_index1 : number of concordant pairs in gene 1 spanning the fusion splice / breakpoint, divided by number of spanning reads supporting the fusion with gene 2 | |
| 624 - splicing_index2 : number of concordant pairs in gene 2 spanning the fusion splice / breakpoint, divided by number of spanning reads supporting the fusion with gene 1 | |
| 625 | |
| 626 | |
| 627 **Example** | |
| 628 | |
| 629 results.tsv:: | |
| 630 | |
| 631 cluster_id splitr_sequence splitr_count splitr_span_pvalue splitr_pos_pvalue splitr_min_pvalue adjacent altsplice break_adj_entropy1 break_adj_entropy2 break_adj_entropy_min break_predict breakpoint_homology breakseqs_estislands_percident cdna_breakseqs_percident concordant_ratio deletion est_breakseqs_percident eversion exonboundaries expression1 expression2 gene1 gene2 gene_align_strand1 gene_align_strand2 gene_chromosome1 gene_chromosome2 gene_end1 gene_end2 gene_location1 gene_location2 gene_name1 gene_name2 gene_start1 gene_start2 gene_strand1 gene_strand2 genome_breakseqs_percident genomic_break_pos1 genomic_break_pos2 genomic_strand1 genomic_strand2 interchromosomal interrupted_index1 interrupted_index2 inversion library_name max_map_count max_repeat_proportion mean_map_count min_map_count num_multi_map num_splice_variants orf read_through repeat_proportion1 repeat_proportion2 span_count span_coverage1 span_coverage2 span_coverage_max span_coverage_min splice_score splicing_index1 splicing_index2 | |
| 632 1169 GCTTACTGTATGCCAGGCCCCAGAGGGGCAACCACCCTCTAAAGAGAGCGGCTCCTGCCTCCCAGAAAGCTCACAGACTGTGGGAGGGAAACAGGCAGCAGGTGAAGATGCCAAATGCCAGGATATCTGCCCTGTCCTTGCTTGATGCAGCTGCTGGCTCCCACGTTCTCCCCAGAATCCCCTCACACTCCTGCTGTTTTCTCTGCAGGTTGGCAGAGCCCCATGAGGGCAGGGCAGCCACTTTGTTCTTGGGCGGCAAACCTCCCTGGGCGGCACGGAAACCACGGTGAGAAGGGGGCAGGTCGGGCACGTGCAGGGACCACGCTGCAGG|TGTACCCAACAGCTCCGAAGAGACAGCGACCATCGAGAACGGGCCATGATGACGATGGCGGTTTTGTCGAAAAGAAAAGGGGGAAATGTGGGGAAAAGCAAGAGAGATCAGATTGTTACTGTGTCTGTGTAGAAAGAAGTAGACATGGGAGACTCCATTTTGTTCTGTACTAAGAAAAATTCTTCTGCCTTGAGATTCGGTGACCCCACCCCCAACCCCGTGCTCTCTGAAACATGTGCTGTGTCCACTCAGGGTTGAATGGATTAAGGGCGGTGCGAGACGTGCTTT 2 0.000436307890680442 0.110748295953850 0.0880671602973091 N Y 3.19872427442695 3.48337348351473 3.19872427442695 splitr 0 0 0 0 Y 0 N N 0 0 ENSG00000105549 ENSG00000213753 + - 19 19 376013 59111168 intron upstream THEG AC016629.2 361750 59084870 - + 0 375099 386594 + - N 8.34107429512245 - N output_dir 82 0.677852348993289 40.6666666666667 1 11 1 N N 0.361271676300578 0.677852348993289 12 0.758602776578432 0.569678713445872 0.758602776578432 0.569678713445872 2 0.416666666666667 - | |
| 633 3596 TGGGGGTTGAGGCTTCTGTTCCCAGGTTCCATGACCTCAGAGGTGGCTGGTGAGGTTATGACCTTTGCCCTCCAGCCCTGGCTTAAAACCTCAGCCCTAGGACCTGGTTAAAGGAAGGGGAGATGGAGCTTTGCCCCGACCCCCCCCCGTTCCCCTCACCTGTCAGCCCGAGCTGGGCCAGGGCCCCTAGGTGGGGAACTGGGCCGGGGGGCGGGCACAAGCGGAGGTGGTGCCCCCAAAAGGGCTCCCGGTGGGGTCTTGCTGAGAAGGTGAGGGGTTCCCGGGGCCGCAGCAGGTGGTGGTGGAGGAGCCAAGCGGCTGTAGAGCAAGGGGTGAGCAGGTTCCAGACCGTAGAGGCGGGCAGCGGCCACGGCCCCGGGTCCAGTTAGCTCCTCACCCGCCTCATAGAAGCGGGGTGGCCTTGCCAGGCGTGGGGGTGCTGCC|TTCCTTGGATGTGGTAGCCGTTTCTCAGGCTCCCTCTCCGGAATCGAACCCTGATTCCCCGTCACCCGTGGTCACCATGGTAGGCACGGCGACTACCATCGAAAGTTGATAGGGCAGACGTTCGAATGGGTCGTCGCCGCCACGGGGGGCGTGCGATCAGCCCGAGGTTATCTAGAGTCACCAAAGCCGCCGGCGCCCGCCCCCCGGCCGGGGCCGGAGAGGGGCTGACCGGGTTGGTTTTGATCTGATAAATGCACGCATCCCCCCCGCGAAGGGGGTCAGCGCCCGTCGGCATGTATTAGCTCTAGAATTACCACAGTTATCCAAGTAGGAGAGGAGCGAGCGACCAAAGGAACCATAACTGATTTAATGAGCCATTCGCAGTTTCACTGTACCGGCCGTGCGTACTTAGACATGCATGGCTTAATCTTTGAGACAAGCATATGCTACTGGCAGG 250 7.00711162298275e-72 0.00912124762512338 0.00684237452309549 N N 3.31745197152461 3.47233119514066 3.31745197152461 splitr 7 0.0157657657657656 0 0 N 0.0135135135135136 N N 0 0 ENSG00000156860 ENSG00000212932 - + 16 21 30682131 48111157 coding upstream FBRS RPL23AP4 30670289 48110676 + + 0.0157657657657656 30680678 9827473 - + Y - - N output_dir 2 1 1.11111111111111 1 1 1 N N 0 1 9 0.325530693397641 0.296465452915709 0.325530693397641 0.296465452915709 2 - - | |
| 634 | |
| 635 </help> | |
| 636 </tool> |
