view test-data/spades_before.fasta @ 0:f57f28bdd39b draft default tip

"planemo upload for repository https://github.com/phac-nml/galaxy_tools commit 6d09bbbbade6035f9acc0345bee9f4bb71cfc102"
author nml
date Thu, 19 Dec 2019 10:07:39 -0500
parents
children
line wrap: on
line source

>NODE_1_length_792_cov_31.561498
TTGCCGTATACACACTTTCCAGGCGTGCTCCTTCAGCCACTCGGACACCTCACCAAATTG
TCGCTCCAGCATTACTGGAACGGGCGCTAATGTAGGGAAATATCTTTTCTACGTCAATCA
ACTTTTTTAAAAAAAAGCGCGTTTATACAAACTTCCACCAATCTGTGGTTTTAATAAGCG
AAAACTGCTTTTTTTGCCCGCGCCGGGAAATTTGCTATGCTGCACATCCCGTTGAAAACG
CTGATAACAGGCGCAATCACATTCCGCACAATACTGCTCAGGAGATAACATGGAGATAAT
TTTTTATCACCCGACATTTAACACCGCCTGGTGGGTAAATGCGCTGGAGAAGGCTCTCCC
ACATGCGCGCGTTCGTGAATGGAAGGTCGGTGATAACAACCCCGCAGACTATGCGCTTGT
ATGGCAGCCCCCGGTTGAAATGCTGGCCGGAAGACGCTTAAAAGCCGTCTTTGCGCTGGG
CGCGGGGGTGGATGCAATTCTGAGTAAATTAAATGCGCATCCGGAAATGCTGGACGCCTC
CATTCCTCTATTCCGTCTGGAAGATACCGGAATGGGCCTGCAAATGCAGGAATATGCCGT
AAGTCAGGTATTACACTGGTTCCGTCGTTTCGATGATTATCAGGCGCTGAAAAATCAGGC
GCTATGGAAACCGTTGCCGGAATATACCCGCGAAGAGTTTAGCGTCGGTATCATGGGCGC
AGGGGTACTGGGCGCAAAAGTGGCAGAAAGTCTACAGGCGTGGGGGTTCCCGTTACGTTG