changeset 1:4a80a8ffb288 draft default tip

planemo upload for repository https://github.com/phac-nml/galaxy_tools commit 3051c6185128618cb9f137a10f45c248f6a6097f
author nml
date Fri, 02 Sep 2022 20:18:41 +0000
parents f57f28bdd39b
children
files spades_header_fixer.xml test-data/spades_before.fasta test-data/spades_before_1.fasta test-data/spades_before_2.fasta test-data/spades_header_fixed.fasta test-data/spades_header_fixed_1.fasta test-data/spades_header_fixed_2.fasta
diffstat 7 files changed, 68 insertions(+), 34 deletions(-) [+]
line wrap: on
line diff
--- a/spades_header_fixer.xml	Thu Dec 19 10:07:39 2019 -0500
+++ b/spades_header_fixer.xml	Fri Sep 02 20:18:41 2022 +0000
@@ -1,9 +1,9 @@
-<tool id="spades_header_fixer" name="SPAdes fasta header fixer" version="1.1.1">
+<tool id="spades_header_fixer" name="SPAdes fasta header fixer" version="1.1.2+galaxy0">
 	<description>Fixes Spades Fasta ids</description>
   <requirements>
       <requirement type="package" version="4.7.0">sed</requirement>
   </requirements>
-	<command >sed -r "s/>NODE(_[0-9]+)_(.*)/>${input.element_identifier}\1 \2/g" $input >$output</command>
+  <command >sed -r "s/>NODE(_[0-9]+)_(.*)|>contig/>${input.element_identifier}\1 \2/g" $input >$output</command>
 	<inputs>
 		<param name="input" type="data" format="fasta" label="Fix these fasta headers"/>
 		</inputs>
@@ -12,8 +12,12 @@
 	</outputs>
   <tests>
     <test>
-         <param name="input" value="spades_before.fasta" />
-         <output name="output" file="spades_header_fixed.fasta" ftype="fasta"/>
+         <param name="input" value="spades_before_1.fasta" />
+         <output name="output" file="spades_header_fixed_1.fasta" ftype="fasta"/>
+    </test>
+    <test>
+         <param name="input" value="spades_before_2.fasta" />
+         <output name="output" file="spades_header_fixed_2.fasta" ftype="fasta"/>
     </test>
   </tests>
 
--- a/test-data/spades_before.fasta	Thu Dec 19 10:07:39 2019 -0500
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,15 +0,0 @@
->NODE_1_length_792_cov_31.561498
-TTGCCGTATACACACTTTCCAGGCGTGCTCCTTCAGCCACTCGGACACCTCACCAAATTG
-TCGCTCCAGCATTACTGGAACGGGCGCTAATGTAGGGAAATATCTTTTCTACGTCAATCA
-ACTTTTTTAAAAAAAAGCGCGTTTATACAAACTTCCACCAATCTGTGGTTTTAATAAGCG
-AAAACTGCTTTTTTTGCCCGCGCCGGGAAATTTGCTATGCTGCACATCCCGTTGAAAACG
-CTGATAACAGGCGCAATCACATTCCGCACAATACTGCTCAGGAGATAACATGGAGATAAT
-TTTTTATCACCCGACATTTAACACCGCCTGGTGGGTAAATGCGCTGGAGAAGGCTCTCCC
-ACATGCGCGCGTTCGTGAATGGAAGGTCGGTGATAACAACCCCGCAGACTATGCGCTTGT
-ATGGCAGCCCCCGGTTGAAATGCTGGCCGGAAGACGCTTAAAAGCCGTCTTTGCGCTGGG
-CGCGGGGGTGGATGCAATTCTGAGTAAATTAAATGCGCATCCGGAAATGCTGGACGCCTC
-CATTCCTCTATTCCGTCTGGAAGATACCGGAATGGGCCTGCAAATGCAGGAATATGCCGT
-AAGTCAGGTATTACACTGGTTCCGTCGTTTCGATGATTATCAGGCGCTGAAAAATCAGGC
-GCTATGGAAACCGTTGCCGGAATATACCCGCGAAGAGTTTAGCGTCGGTATCATGGGCGC
-AGGGGTACTGGGCGCAAAAGTGGCAGAAAGTCTACAGGCGTGGGGGTTCCCGTTACGTTG
-
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/spades_before_1.fasta	Fri Sep 02 20:18:41 2022 +0000
@@ -0,0 +1,15 @@
+>NODE_1_length_792_cov_31.561498
+TTGCCGTATACACACTTTCCAGGCGTGCTCCTTCAGCCACTCGGACACCTCACCAAATTG
+TCGCTCCAGCATTACTGGAACGGGCGCTAATGTAGGGAAATATCTTTTCTACGTCAATCA
+ACTTTTTTAAAAAAAAGCGCGTTTATACAAACTTCCACCAATCTGTGGTTTTAATAAGCG
+AAAACTGCTTTTTTTGCCCGCGCCGGGAAATTTGCTATGCTGCACATCCCGTTGAAAACG
+CTGATAACAGGCGCAATCACATTCCGCACAATACTGCTCAGGAGATAACATGGAGATAAT
+TTTTTATCACCCGACATTTAACACCGCCTGGTGGGTAAATGCGCTGGAGAAGGCTCTCCC
+ACATGCGCGCGTTCGTGAATGGAAGGTCGGTGATAACAACCCCGCAGACTATGCGCTTGT
+ATGGCAGCCCCCGGTTGAAATGCTGGCCGGAAGACGCTTAAAAGCCGTCTTTGCGCTGGG
+CGCGGGGGTGGATGCAATTCTGAGTAAATTAAATGCGCATCCGGAAATGCTGGACGCCTC
+CATTCCTCTATTCCGTCTGGAAGATACCGGAATGGGCCTGCAAATGCAGGAATATGCCGT
+AAGTCAGGTATTACACTGGTTCCGTCGTTTCGATGATTATCAGGCGCTGAAAAATCAGGC
+GCTATGGAAACCGTTGCCGGAATATACCCGCGAAGAGTTTAGCGTCGGTATCATGGGCGC
+AGGGGTACTGGGCGCAAAAGTGGCAGAAAGTCTACAGGCGTGGGGGTTCCCGTTACGTTG
+
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/spades_before_2.fasta	Fri Sep 02 20:18:41 2022 +0000
@@ -0,0 +1,15 @@
+>contig00001 len=272039 cov=11.6 corr=0 origname=NODE_1_length_272039_cov_11.639952 sw=shovill-spades/1.0.4 date=20211013
+TTGCCGTATACACACTTTCCAGGCGTGCTCCTTCAGCCACTCGGACACCTCACCAAATTG
+TCGCTCCAGCATTACTGGAACGGGCGCTAATGTAGGGAAATATCTTTTCTACGTCAATCA
+ACTTTTTTAAAAAAAAGCGCGTTTATACAAACTTCCACCAATCTGTGGTTTTAATAAGCG
+AAAACTGCTTTTTTTGCCCGCGCCGGGAAATTTGCTATGCTGCACATCCCGTTGAAAACG
+CTGATAACAGGCGCAATCACATTCCGCACAATACTGCTCAGGAGATAACATGGAGATAAT
+TTTTTATCACCCGACATTTAACACCGCCTGGTGGGTAAATGCGCTGGAGAAGGCTCTCCC
+ACATGCGCGCGTTCGTGAATGGAAGGTCGGTGATAACAACCCCGCAGACTATGCGCTTGT
+ATGGCAGCCCCCGGTTGAAATGCTGGCCGGAAGACGCTTAAAAGCCGTCTTTGCGCTGGG
+CGCGGGGGTGGATGCAATTCTGAGTAAATTAAATGCGCATCCGGAAATGCTGGACGCCTC
+CATTCCTCTATTCCGTCTGGAAGATACCGGAATGGGCCTGCAAATGCAGGAATATGCCGT
+AAGTCAGGTATTACACTGGTTCCGTCGTTTCGATGATTATCAGGCGCTGAAAAATCAGGC
+GCTATGGAAACCGTTGCCGGAATATACCCGCGAAGAGTTTAGCGTCGGTATCATGGGCGC
+AGGGGTACTGGGCGCAAAAGTGGCAGAAAGTCTACAGGCGTGGGGGTTCCCGTTACGTTG
+
--- a/test-data/spades_header_fixed.fasta	Thu Dec 19 10:07:39 2019 -0500
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,15 +0,0 @@
->spades_before.fasta_1 length_792_cov_31.561498
-TTGCCGTATACACACTTTCCAGGCGTGCTCCTTCAGCCACTCGGACACCTCACCAAATTG
-TCGCTCCAGCATTACTGGAACGGGCGCTAATGTAGGGAAATATCTTTTCTACGTCAATCA
-ACTTTTTTAAAAAAAAGCGCGTTTATACAAACTTCCACCAATCTGTGGTTTTAATAAGCG
-AAAACTGCTTTTTTTGCCCGCGCCGGGAAATTTGCTATGCTGCACATCCCGTTGAAAACG
-CTGATAACAGGCGCAATCACATTCCGCACAATACTGCTCAGGAGATAACATGGAGATAAT
-TTTTTATCACCCGACATTTAACACCGCCTGGTGGGTAAATGCGCTGGAGAAGGCTCTCCC
-ACATGCGCGCGTTCGTGAATGGAAGGTCGGTGATAACAACCCCGCAGACTATGCGCTTGT
-ATGGCAGCCCCCGGTTGAAATGCTGGCCGGAAGACGCTTAAAAGCCGTCTTTGCGCTGGG
-CGCGGGGGTGGATGCAATTCTGAGTAAATTAAATGCGCATCCGGAAATGCTGGACGCCTC
-CATTCCTCTATTCCGTCTGGAAGATACCGGAATGGGCCTGCAAATGCAGGAATATGCCGT
-AAGTCAGGTATTACACTGGTTCCGTCGTTTCGATGATTATCAGGCGCTGAAAAATCAGGC
-GCTATGGAAACCGTTGCCGGAATATACCCGCGAAGAGTTTAGCGTCGGTATCATGGGCGC
-AGGGGTACTGGGCGCAAAAGTGGCAGAAAGTCTACAGGCGTGGGGGTTCCCGTTACGTTG
-
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/spades_header_fixed_1.fasta	Fri Sep 02 20:18:41 2022 +0000
@@ -0,0 +1,15 @@
+>spades_before_1.fasta_1 length_792_cov_31.561498
+TTGCCGTATACACACTTTCCAGGCGTGCTCCTTCAGCCACTCGGACACCTCACCAAATTG
+TCGCTCCAGCATTACTGGAACGGGCGCTAATGTAGGGAAATATCTTTTCTACGTCAATCA
+ACTTTTTTAAAAAAAAGCGCGTTTATACAAACTTCCACCAATCTGTGGTTTTAATAAGCG
+AAAACTGCTTTTTTTGCCCGCGCCGGGAAATTTGCTATGCTGCACATCCCGTTGAAAACG
+CTGATAACAGGCGCAATCACATTCCGCACAATACTGCTCAGGAGATAACATGGAGATAAT
+TTTTTATCACCCGACATTTAACACCGCCTGGTGGGTAAATGCGCTGGAGAAGGCTCTCCC
+ACATGCGCGCGTTCGTGAATGGAAGGTCGGTGATAACAACCCCGCAGACTATGCGCTTGT
+ATGGCAGCCCCCGGTTGAAATGCTGGCCGGAAGACGCTTAAAAGCCGTCTTTGCGCTGGG
+CGCGGGGGTGGATGCAATTCTGAGTAAATTAAATGCGCATCCGGAAATGCTGGACGCCTC
+CATTCCTCTATTCCGTCTGGAAGATACCGGAATGGGCCTGCAAATGCAGGAATATGCCGT
+AAGTCAGGTATTACACTGGTTCCGTCGTTTCGATGATTATCAGGCGCTGAAAAATCAGGC
+GCTATGGAAACCGTTGCCGGAATATACCCGCGAAGAGTTTAGCGTCGGTATCATGGGCGC
+AGGGGTACTGGGCGCAAAAGTGGCAGAAAGTCTACAGGCGTGGGGGTTCCCGTTACGTTG
+
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/spades_header_fixed_2.fasta	Fri Sep 02 20:18:41 2022 +0000
@@ -0,0 +1,15 @@
+>spades_before_2.fasta 00001 len=272039 cov=11.6 corr=0 origname=NODE_1_length_272039_cov_11.639952 sw=shovill-spades/1.0.4 date=20211013
+TTGCCGTATACACACTTTCCAGGCGTGCTCCTTCAGCCACTCGGACACCTCACCAAATTG
+TCGCTCCAGCATTACTGGAACGGGCGCTAATGTAGGGAAATATCTTTTCTACGTCAATCA
+ACTTTTTTAAAAAAAAGCGCGTTTATACAAACTTCCACCAATCTGTGGTTTTAATAAGCG
+AAAACTGCTTTTTTTGCCCGCGCCGGGAAATTTGCTATGCTGCACATCCCGTTGAAAACG
+CTGATAACAGGCGCAATCACATTCCGCACAATACTGCTCAGGAGATAACATGGAGATAAT
+TTTTTATCACCCGACATTTAACACCGCCTGGTGGGTAAATGCGCTGGAGAAGGCTCTCCC
+ACATGCGCGCGTTCGTGAATGGAAGGTCGGTGATAACAACCCCGCAGACTATGCGCTTGT
+ATGGCAGCCCCCGGTTGAAATGCTGGCCGGAAGACGCTTAAAAGCCGTCTTTGCGCTGGG
+CGCGGGGGTGGATGCAATTCTGAGTAAATTAAATGCGCATCCGGAAATGCTGGACGCCTC
+CATTCCTCTATTCCGTCTGGAAGATACCGGAATGGGCCTGCAAATGCAGGAATATGCCGT
+AAGTCAGGTATTACACTGGTTCCGTCGTTTCGATGATTATCAGGCGCTGAAAAATCAGGC
+GCTATGGAAACCGTTGCCGGAATATACCCGCGAAGAGTTTAGCGTCGGTATCATGGGCGC
+AGGGGTACTGGGCGCAAAAGTGGCAGAAAGTCTACAGGCGTGGGGGTTCCCGTTACGTTG
+