# HG changeset patch
# User omics
# Date 1583826323 14400
# Node ID 15174d0453f5487f872c410e3b388ddc9a93e05e

"planemo upload commit 7f2686c5c7a5afd898217565f1cee58996f9d285-dirty"

diff -r 000000000000 -r 15174d0453f5 count_gc.txt
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/count_gc.txt	Tue Mar 10 03:45:23 2020 -0400
@@ -0,0 +1,3 @@
+0.520
+0.600
+0.720
diff -r 000000000000 -r 15174d0453f5 fasta_gc.pl
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/fasta_gc.pl	Tue Mar 10 03:45:23 2020 -0400
@@ -0,0 +1,23 @@
+#!/usr/bin/perl -w
+
+# usage : perl toolExample.pl <FASTA file> <output file>
+
+open (IN, "<$ARGV[0]");
+open (OUT, ">$ARGV[1]");
+while (<IN>) {
+    chop;
+    if (m/^>/) {
+        s/^>//;
+        if ($. > 1) {
+            print OUT sprintf("%.3f", $gc/$length) . "\n";
+        }
+        $gc = 0;
+        $length = 0;
+    } else {
+        ++$gc while m/[gc]/ig;
+        $length += length $_;
+    }
+}
+print OUT sprintf("%.3f", $gc/$length) . "\n";
+close( IN );
+close( OUT );
\ No newline at end of file
diff -r 000000000000 -r 15174d0453f5 fasta_gc.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/fasta_gc.xml	Tue Mar 10 03:45:23 2020 -0400
@@ -0,0 +1,13 @@
+<tool id="fasta_gc" name="Fasta GC">
+  <description>For each sequence in a fasta</description>
+  <command>perl '$__tool_directory__/fasta_gc.pl' '$input' output.csv</command>
+  <inputs>
+    <param name="input" type="data" format="fasta" label="Fasta file"/>
+  </inputs>
+  <outputs>
+    <data name="output" format="tabular" from_work_dir="output.csv" />
+  </outputs>
+  <help>
+This tool computes GC content from a FASTA file.
+  </help>
+</tool>
\ No newline at end of file
diff -r 000000000000 -r 15174d0453f5 sample.fasta
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/sample.fasta	Tue Mar 10 03:45:23 2020 -0400
@@ -0,0 +1,6 @@
+>EAS54_6_R1_2_1_413_324
+CCCTTCTTGTCTTCAGCGTTTCTCC
+>EAS54_6_R1_2_1_540_792
+TTGGCAGGCCAAGGCCGATGGATCA
+>EAS54_6_R1_2_1_443_348
+GTTGCTTCTGGCGTGGGTGGGGGGG
diff -r 000000000000 -r 15174d0453f5 test-data/count_gc.txt
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/count_gc.txt	Tue Mar 10 03:45:23 2020 -0400
@@ -0,0 +1,3 @@
+0.520
+0.600
+0.720