Mercurial > repos > onnodg > blast_annotations_processor
diff tests/test_blast_annotations_processor.py @ 0:a3989edf0a4a draft
planemo upload for repository https://github.com/Onnodg/Naturalis_NLOOR/tree/main/NLOOR_scripts/process_annotations_tool commit c944fd5685f295acba06679e85b67973c173b137
| author | onnodg |
|---|---|
| date | Tue, 14 Oct 2025 09:08:30 +0000 |
| parents | |
| children |
line wrap: on
line diff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tests/test_blast_annotations_processor.py Tue Oct 14 09:08:30 2025 +0000 @@ -0,0 +1,432 @@ +""" +Test suite for BLAST annotation processor. +""" + +import pytest +import os +import sys +import json +import pandas as pd +from pathlib import Path + +# Add the module to path for importing +sys.path.append(os.path.dirname(os.path.dirname(os.path.abspath(__file__)))) +from Stage_1_translated.NLOOR_scripts.process_annotations_tool.blast_annotations_processor import ( + process_single_file, + resolve_taxon_majority, + TAXONOMIC_LEVELS +) + + +class TestBlastAnnotationProcessor: + """Test class for BLAST annotation processor""" + + @pytest.fixture(scope="class") + def test_data_dir(self): + """Setup test data directory structure""" + base_dir = Path("test-data") + base_dir.mkdir(exist_ok=True) + + # Create subdirectories + for subdir in ["input", "expected", "output"]: + (base_dir / subdir).mkdir(exist_ok=True) + + return base_dir + + @pytest.fixture(scope="class") + def sample_files(self, test_data_dir): + """Create sample input files for testing""" + input_dir = test_data_dir / "input" + + # Sample annotated BLAST file + blast_content = """#Query ID #Subject #Subject accession #Subject Taxonomy ID #Identity percentage #Coverage #evalue #bitscore #Source #Taxonomy + read1(100) subject2 subject2 subject2 90.0 95 1e-45 180 database1 Bacteria / Firmicutes / Bacilli / Bacillales / Bacillaceae / Bacillus / Bacillus_subtilis +read1(100) subject1 subject1 subject1 95.889 100 1e-50 200 database1 Bacteria / Firmicutes / Bacilli / Bacillales / Bacillaceae / Bacillus / Bacillus_subtilis +read2(50) subject3 subject3 subject3 85.0 90 1e-40 160 database2 Bacteria / Proteobacteria / Gammaproteobacteria / Enterobacterales / Enterobacteriaceae / Escherichia / Escherichia_coli +read3(25) subject4 subject4 subject4 80.0 85 1e-35 140 database1 Archaea / Euryarchaeota / Methanobacteria / Methanobacteriales / Methanobacteriaceae / Methanobrevibacter / Methanobrevibacter_smithii +read4(25) subject4 subject4 subject4 80.0 85 1e-35 140 database1 Archaea / Euryarchaeota / Methanobacteria / Methanobacteriales / Methanobacteriaceae / Methanobrevibacter / Methanobrevibacter_blabla +read4(25) subject4 subject4 subject4 80.0 85 1e-40 140 database1 Archaea / Euryarchaeota / Methanobacteria / Methanobacteriales / Methanobacteriaceae / Methanobrevibacter / Methanobrevibacter_eclhi +read4(25) subject4 subject4 subject4 80.0 85 1e-35 140 database1 Archaea / Euryarchaeota / Methanobacteria / Methanobacteriales / Methanobacteriaceae / Methanobrevibacter / Methanobrevibacter_elchi +read4(25) subject4 subject4 subject4 90.0 87 1e-50 160 database1 Archaea / Euryarchaeota / Methanobacteria / Methanobacteriales / Methanobacteriaceae / Methanobrevibacter / Methanobrevibacter_smithii +""" + + # Sample unannotated FASTA file (headers must match BLAST q_id) + fasta_content = """>read1(100) count=100; +ATCGATCGATCGATCG +>read2(50) count=50; +GCTAGCTAGCTAGCTA +>read3(25) count=25; +TGACTGACTGACTGAC +>read4(25) count=25; +TGAAAAAAACACCAC +""" + + blast_file = input_dir / "test_blast.tabular" + fasta_file = input_dir / "test_sequences.fasta" + + with open(blast_file, 'w') as f: + f.write(blast_content) + with open(fasta_file, 'w') as f: + f.write(fasta_content) + + return { + 'blast': str(blast_file), + 'fasta': str(fasta_file) + } + + @pytest.fixture(scope="class") + def processed_output(self, test_data_dir, sample_files): + """Run the processor on sample files and return output paths""" + output_dir = test_data_dir / "output" + + # Create arguments object + class Args: + def __init__(self): + self.input_anno = sample_files['blast'] + self.input_unanno = sample_files['fasta'] + self.eval_plot = str(output_dir / "eval_plot.png") + self.taxa_output = str(output_dir / "taxa_output.txt") + self.circle_data = str(output_dir / "circle_data.json") + self.header_anno = str(output_dir / "header_anno.xlsx") + self.anno_stats = str(output_dir / "anno_stats.txt") + self.uncertain_threshold = 0.9 + self.eval_threshold = 1e-10 + self.use_counts = True + + args = Args() + + # Process the files + process_single_file(args.input_anno, args.input_unanno, args) + + return args + + def test_data_integrity_best_values(self, processed_output): + """ + Test 1: Data Integrity - Best Values Selection + + Verifies that for each read, the best e-value corresponds to the correct + bitscore, identity, coverage, and taxonomic annotation. + """ + # Read the Excel output to verify the best values are correctly selected + df = pd.read_excel(processed_output.header_anno, sheet_name='Individual_Reads') + print(df) + # For read1(100), verify best e-value (1e-50) corresponds to correct values + read1_row = df[df['header'].str.contains('read1')].iloc[0] + assert read1_row['bitscore'] == float(200), "best bitscore doesn't match" + assert read1_row['e_value'] == pytest.approx(1e-50, rel=1e-8, abs=1e-49), "Best e-value not correctly selected for read1" + assert read1_row['identity percentage'] == float(95.889), "Identity doesn't match best bitscore for read1" + assert 'Bacillus_subtilis' in read1_row['taxa'], "Taxa doesn't match best hit for read1" + + read4_row = df[df['header'].str.contains('read4')].iloc[0] + assert read4_row['bitscore'] == float(160), "best bitscore doesn't match" + assert 'Methanobrevibacter_smithii' in read4_row['taxa'], "Taxa doesn't match best hit for read1" + print("✓ Test 1 PASSED: Best values correctly associated for each read") + + def test_read_count_consistency(self, processed_output): + """ + Test 2: Read Count Consistency + + Verifies that read counts from FASTA headers are correctly preserved + and aggregated in all output files. + """ + # Check Excel output + df = pd.read_excel(processed_output.header_anno, sheet_name='Individual_Reads') + # Verify counts are correctly extracted and preserved + expected_counts = {'read1': 100, 'read2': 50, 'read3': 25, 'read4':25} + + skipped_reads = [] + + for read_name, expected_count in expected_counts.items(): + subset = df.loc[df['header'] == read_name] + if subset.empty: + skipped_reads.append(read_name) # remember we skip this read + continue + row = subset.iloc[0] + assert row['count'] == expected_count, f"Count mismatch for {read_name}" + + # Check annotation stats + with open(processed_output.anno_stats, 'r') as f: + stats_content = f.read() + # Total unique count should be 175 (100+50+25) + assert 'total_unique\t200' in stats_content, "Total unique count incorrect in stats" + if skipped_reads: + assert all(read not in df['header'].values for read in skipped_reads) + print("✓ Test 2 PASSED: Read counts consistent across all outputs") + + def test_lowest_common_ancester(self, processed_output): + """ + Test 3: Big Input Files + + Tests the functioning of lowest common ancestor selection with realistic inputfile sizes + """ + # Test the function directly with known conflicts + test_conflicts = { + 'Viridiplantae / Streptophyta / Magnoliopsida / Asterales / Asteraceae / Cicerbita / Cicerbita a': 10, + 'Viridiplantae / Streptophyta / Magnoliopsida / Asterales / Asteraceae / Cicerbita / Cicerbita b': 1, + 'Viridiplantae / Streptophyta / Magnoliopsida / Asterales / Asteraceae / Cicerbita / Cicerbita c': 1, + 'Viridiplantae / Streptophyta / Magnoliopsida / Asterales / Asteraceae / Cicerbita / Cicerbita d': 1, + 'Viridiplantae / Streptophyta / Magnoliopsida / Asterales / Asteraceae / Cicerbita / Cicerbita e': 1, + 'Viridiplantae / Streptophyta / Magnoliopsida / Asterales / Asteraceae / Ciceronia / Ciceronia a': 187, + 'Viridiplantae / Streptophyta / Magnoliopsida / Asterales / Asteraceae / Ciceronia / Ciceronia b': 2, + 'Viridiplantae / Streptophyta / Magnoliopsida / Asterales / Asteraceae / Ciceronia / Ciceronia c': 2, + 'Viridiplantae / Streptophyta / Magnoliopsida / Asterales / Asteraceae / Ciceronia / Ciceronia d': 2, + 'Viridiplantae / Streptophyta / Magnoliopsida / Asterales / Asteraceae / Ciceronia / Ciceronia e': 2, + 'Viridiplantae / Streptophyta / Magnoliopsida / Asterales / Asteraceae / Ciceronia / Ciceronia f': 12, + 'Viridiplantae / Streptophyta / Bryopsida / Funariales / Funariaceae / Funaria / Uncertain taxa': 6 + } + resolved_short, resolved_long = resolve_taxon_majority(test_conflicts, 0.9) + assert 'Ciceronia a' in resolved_short, "Conflict not resolved to uncertain taxa" + + test_90_precent_conflicts = { + 'Viridiplantae / Streptophyta / Magnoliopsida / Asterales / Asteraceae / Cicerbita / Cicerbita a': 90, + 'Viridiplantae / Streptophyta / Magnoliopsida / Asterales / Asteraceae / Cicerbita / Cicerbita b': 10, + 'Viridiplantae / Streptophyta / Bryopsida / Funariales / Funariaceae / Funaria / Uncertain taxa': 6 + } + resolved_short, resolved_long = resolve_taxon_majority(test_90_precent_conflicts, 0.9) + assert 'Cicerbita a' in resolved_short, "Conflict not resolved to uncertain taxa" + + print("✓ Test 3 PASSED: Lowest common ancestor works correctly") + + + def test_taxonomic_conflict_resolution(self, processed_output): + """ + Test 4: Taxonomic Conflict Resolution + + Tests the uncertainty threshold mechanism for resolving taxonomic conflicts. + Uses a controlled scenario where multiple hits have different taxa. + """ + # Test the function directly with known conflicts + test_conflicts = { + 'Bacteria / Firmicutes / Bacilli': 2, + 'Bacteria / Proteobacteria / Gammaproteobacteria': 1 + } + + resolved_short, resolved_long = resolve_taxon_majority(test_conflicts, 0.9) + + # With threshold 0.9, should resolve to most common (2/3 = 0.67 < 0.9, so uncertain) + assert 'Uncertain taxa' in resolved_short, "Conflict not resolved to uncertain taxa" + + # Test with higher confidence + test_high_confidence = { + 'Bacteria / Firmicutes / Bacilli': 9, + 'Bacteria / Proteobacteria / Gammaproteobacteria': 1 + } + + resolved_short, resolved_long = resolve_taxon_majority(test_high_confidence, 0.9) + assert 'Firmicutes' in resolved_short, "High confidence case not resolved correctly" + + print("✓ Test 4 PASSED: Taxonomic conflict resolution working correctly") + + def test_output_file_structures(self, processed_output): + """ + Test 5: Output File Structure Validation + + Verifies that all output files are created with correct structure and format. + """ + # Test Excel file structure + excel_file = processed_output.header_anno + assert os.path.exists(excel_file), "Excel output file not created" + + # Check both sheets exist + xl_file = pd.ExcelFile(excel_file) + expected_sheets = ['Individual_Reads', 'Merged_by_Taxa'] + assert all(sheet in xl_file.sheet_names for sheet in expected_sheets), "Missing Excel sheets" + + # Test Individual_Reads sheet structure + df_individual = pd.read_excel(excel_file, sheet_name='Individual_Reads') + expected_cols = ['header', 'e_value', 'identity percentage', 'coverage', + 'bitscore', 'count', 'source', 'taxa'] + assert all(col in df_individual.columns for col in expected_cols), "Missing columns in Individual_Reads" + + # Test taxa output structure + with open(processed_output.taxa_output, 'r') as f: + taxa_lines = f.readlines() + + # Should have header line and data lines + assert len(taxa_lines) > 2, "Taxa output too short" + assert 'percentage_rooted\tnumber_rooted' in taxa_lines[1], "Taxa output header incorrect" + + # Test circle data JSON structure + with open(processed_output.circle_data, 'r') as f: + circle_data = json.load(f) + + assert isinstance(circle_data, list), "Circle data should be a list" + assert len(circle_data) == len(TAXONOMIC_LEVELS), "Circle data should have entry per taxonomic level" + + print("✓ Test 5 PASSED: All output files have correct structure") + + def test_evalue_filtering(self, test_data_dir): + """ + Test 6: E-value Threshold Filtering + + Tests that hits above the e-value threshold are correctly filtered out. + """ + input_dir = test_data_dir / "input" + output_dir = test_data_dir / "output" + + # Create test file with mix of good and bad e-values + blast_content_mixed = """#Query ID #Subject #Subject accession #Subject Taxonomy ID #Identity percentage #Coverage #evalue #bitscore #Source #Taxonomy + read1(100) subject1 95.0 100 50 75 1e-50 200 database1 Viridiplantae / Streptophyta / Magnoliopsida / Fagales / Juglandaceae / Uncertain taxa / Uncertain taxa +read1(100) subject2 90.0 95 45 70 1e-5 180 database1 Viridiplantae / Streptophyta / Magnoliopsida / Rosales / Rosaceae / Sorbus / Sorbus aucuparia +read2(50) subject3 85.0 90 40 65 1e-3 160 database2 Viridiplantae / Streptophyta / Magnoliopsida / Solanales / Solanaceae / Uncertain taxa / Uncertain taxa +""" + + fasta_content = """>read1(100) count=100; +ATCG +>read2(50) count=50; +GCTA +""" + + blast_file = "Stage_1_translated/NLOOR_scripts/process_annotations_tool/test-data/sorted_test.tabular" + fasta_file = "Stage_1_translated/NLOOR_scripts/process_annotations_tool/test-data/sorted_test.fasta" + + with open(blast_file, 'w') as f: + f.write(blast_content_mixed) + with open(fasta_file, 'w') as f: + f.write(fasta_content) + + # Process with strict e-value threshold + class Args: + def __init__(self): + self.input_anno = str(blast_file) + self.input_unanno = str(fasta_file) + self.header_anno = str(output_dir / "evalue_test.xlsx") + self.eval_plot = None + self.taxa_output = None + self.circle_data = None + self.anno_stats = None + self.uncertain_threshold = 0.9 + self.eval_threshold = 1e-10 # Very strict threshold + self.use_counts = True + + args = Args() + process_single_file(args.input_anno, args.input_unanno, args) + + # Check that only the 1e-50 hit remains + df = pd.read_excel(args.header_anno, sheet_name='Individual_Reads') + + # Should only have read1 (with 1e-50), read2 should be filtered out + assert len(df) == 1, f"Expected 1 read after filtering, got {len(df)}" + assert df.iloc[0]['e_value'] == pytest.approx(1e-50, rel=1e-8, abs=1e-12), "Wrong hit survived e-value filtering" + + print("✓ Test 6 PASSED: E-value filtering working correctly") + + def test_header_synchronization(self, test_data_dir): + """ + Test 7: Header Synchronization Between Files + + Tests that the processor correctly handles mismatched headers between + annotated and unannotated files. + """ + input_dir = test_data_dir / "input" + output_dir = test_data_dir / "output" + + # Create mismatched files + blast_content = """#Query ID #Subject #Subject accession #Subject Taxonomy ID #Identity percentage #Coverage #evalue #bitscore #Source #Taxonomy +read1(100) source=NCBI sequenceID=KR738003 superkingdom=Eukaryota kingdom=Viridiplantae phylum=Streptophyta subphylum=Streptophytina class=Magnoliopsida subclass=NA infraclass=NA order=Malvales suborder=NA infraorder=NA superfamily=NA family=Malvaceae genus=Hibiscus species=Hibiscus trionum markercode=trnL lat=0.304 lon=36.87 source=NCBI N/A 100.000 100 7.35e-30 54.7 Viridiplantae / Streptophyta / Magnoliopsida / Malvales / Malvaceae / Hibiscus / Hibiscus trionum +read1(100) source=NCBI sequenceID=KR738670 superkingdom=Eukaryota kingdom=Viridiplantae phylum=Streptophyta subphylum=Streptophytina class=Magnoliopsida subclass=NA infraclass=NA order=Malvales suborder=NA infraorder=NA superfamily=NA family=Malvaceae genus=Hibiscus species=Hibiscus trionum markercode=trnL lat=0.304 lon=36.87 source=NCBI N/A 100.000 100 7.35e-14 54.7 Viridiplantae / Streptophyta / Magnoliopsida / Malvales / Malvaceae / Hibiscus / Hibiscus trionum +read3(25) source=NCBI sequenceID=KR737595 superkingdom=Eukaryota kingdom=Viridiplantae phylum=Streptophyta subphylum=Streptophytina class=Magnoliopsida subclass=NA infraclass=NA order=Malvales suborder=NA infraorder=NA superfamily=NA family=Malvaceae genus=Hibiscus species=Hibiscus trionum markercode=trnL lat=0.304 lon=36.87 source=NCBI N/A 97.561 87 1.68e-14 71.3 Viridiplantae / Streptophyta / Magnoliopsida / Malvales / Malvaceae / Hibiscus / Hibiscus trionum +""" + + fasta_content = """>read1(100) count=100; +ATCG +>read2(50) merged_sample={}; count=1011; direction=right; seq_b_insertion=0; sminR=40.0; ali_length=53; seq_b_deletion=248; seq_a_deletion=248; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=0; seq_b_single=0; +gggcaatcctgagccaagtgactggagttcagataggtgcagagactcaatgg +>read3(25) merged_sample={}; count=179; direction=right; sminR=40.0; ali_length=49; seq_b_deletion=252; seq_a_deletion=252; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=0; seq_b_single=0; +gggcaatcctgagccaactggagttcagataggtgcagagactcaatgg +""" + + blast_file = input_dir / "test_sync.tabular" + fasta_file = input_dir / "test_sync.fasta" + + with open(blast_file, 'w') as f: + f.write(blast_content) + with open(fasta_file, 'w') as f: + f.write(fasta_content) + + class Args: + def __init__(self): + self.input_anno = blast_file + self.input_unanno = fasta_file + self.header_anno = "Stage_1_translated/NLOOR_scripts/process_annotations_tool/test-data/sync_test.xlsx" + self.eval_plot = None + self.taxa_output = None + self.circle_data = None + self.anno_stats = str(output_dir / "sync_stats.txt") + self.uncertain_threshold = 0.9 + self.eval_threshold = 1e-10 + self.use_counts = True + + args = Args() + process_single_file(args.input_anno, args.input_unanno, args) + # Check that processing handled the mismatch correctly + df = pd.read_excel(args.header_anno, sheet_name='Individual_Reads') + extracted = df['header'].str.extract(r'(read\d+)') + # final list + headers = extracted[0].tolist() + # Should have read1 and read3, read2 should be skipped + assert 'read1' in headers, "read1 should be present" + assert 'read3' in headers, "read3 should be present" + + print("✓ Test 7 PASSED: Header synchronization handled correctly") + + def test_excel_merged_vs_individual(self, processed_output): + """ + Test 8: Excel Merged vs Individual Sheet Consistency + + Verifies that the merged sheet correctly aggregates data from the individual sheet. + """ + df_individual = pd.read_excel(processed_output.header_anno, sheet_name='Individual_Reads') + df_merged = pd.read_excel(processed_output.header_anno, sheet_name='Merged_by_Taxa') + + # Count unique taxa in individual sheet + individual_taxa = df_individual['taxa'].nunique() + + # Should match number of rows in merged sheet + assert len(df_merged) == individual_taxa, "Merged sheet doesn't match unique taxa count" + + # Check that counts are properly aggregated + # For taxa with multiple reads, counts should be summed + for _, merged_row in df_merged.iterrows(): + taxa = merged_row['taxa'] + individual_rows = df_individual[df_individual['taxa'] == taxa] + + expected_count = individual_rows['count'].sum() + actual_count = merged_row['count'] + + assert actual_count == expected_count, f"Count mismatch for taxa {taxa}: expected {expected_count}, got {actual_count}" + + print("✓ Test 8 PASSED: Excel merged sheet correctly aggregates individual data") + + def test_annotation_statistics_accuracy(self, processed_output, sample_files): + """ + Test 9: Annotation Statistics Accuracy + + Verifies that calculated annotation statistics match the actual data. + """ + # Read stats file + stats = {} + with open(processed_output.anno_stats, 'r') as f: + lines = f.readlines()[1:] # Skip header + for line in lines: + key, value = line.strip().split('\t') + try: + stats[key] = float(value) + except ValueError: + stats[key] = value + + # Manual verification + assert stats['total_sequences'] == 4.0, "Total sequences count incorrect" + assert stats['annotated_sequences'] == 3.0, "Annotated sequences count incorrect" + assert stats['total_unique'] == 200, "Total unique count incorrect" + assert stats['unique_annotated'] == 150, "Unique annotated count incorrect" + assert stats['percentage_annotated'] == 75.0, "Percentage annotated incorrect" + assert stats['percentage_unique_annotated'] == 75.0, "Percentage unique annotated incorrect" + + print("✓ Test 9 PASSED: Annotation statistics are accurate") + + + +if __name__ == "__main__": + # Run all tests in this file + pytest.main([__file__]) \ No newline at end of file
