comparison single_fastq_filtering.xml @ 0:a4cd8608ef6b draft

Uploaded

0:a4cd8608ef6b

<tool id="single_fastq_filtering" name="Preprocessing of fastq reads">
  <description>
    Preprocessing of fastq files
    including trimming, quality filtering, cutadapt filtering and sampling
  </description>
  <requirements>
    <requirement type="package">blast</requirement>
    <requirement type="package">cutadapt</requirement>
    <requirement type="package">bioconductor-shortread</requirement>
    <requirement type="package">r-optparse</requirement>
  </requirements>
  <command interpreter="bash">
    single_fastq_filtering_wrapper.sh -a ${A} -o ${output} -c ${cut_off} -p ${percent_above} -N ${max_n} -G ${png_output}

    #if $sampling.sequence_sampling :
    -n $sampling.sample_size
    #end if

    #if $trimming.sequence_trimming :
    -e $trimming.trim_end -s $trimming.trim_start
    #end if

    #if $cutadapt.use_custom :
    -C "${cutadapt.custom_options}"
    #end if

    #if $similarity_filtering.include :
    -F "${similarity_filtering.filter_database}"
    #end if


  </command>

  <inputs>
    <param format="fastq,fastq.gz" type="data" name="A" label="reads in fastq format" />
    <conditional name="sampling">
      <param name="sequence_sampling" type="boolean" truevalue="true" falsevalue="false" checked="False" label="Sequence sampling"/>
	    <when value="false">
        <!-- do nothing here -->
      </when>
      <when value="true">
   		  <param name="sample_size" type="integer" label="Sample size(number of reads" help="How many sequence reads should be in resulting dataset" value="500000" min="0"/>
      </when>
    </conditional>

    <param type="integer" name="cut_off" label="Quality cut-off" value="10" min="0" help="see below how to correctly set quality cut-off" />
    <param type="integer" name="percent_above" label="percent above cutoff" value="95" min="0"
           help="Percent of bases in sequence that must have quality equal to / higher than cut-off value" />

    <conditional name="trimming">
      <param name="sequence_trimming" type="boolean" truevalue="true" falsevalue="false" checked="False" label="Trim sequences"/>
      <when value="false">
        <!-- do nothing here -->
      </when>      
      <when value="true">
        <param type="integer" name="trim_start" label="trimming - start position" value="1" min="1"
               help="sequences are trimmed at specified start" />
        <param type="integer" name="trim_end" label="trimming - end position" value="100" min="1"
               help="sequences are trimmed to specified end position, shorted sequences are discarded" />
      </when>      

    </conditional>
   	<param name="max_n" type="integer" label="maximum Ns" help="Maximum number of Ns in sequence" value="0" min="0" max="10"/>

    <conditional name="cutadapt">
      <param name="use_custom" type="boolean" truevalue="true" falsevalue="false" checked="False" label="Do you want to use custom cutadapt options"/>
	    <when value="false">
        <!-- do nothing here -->
      </when>
      <when value="true">
   		  <param name="custom_options" type="text" area="True" size="8x30"  label="Cutadapt custom options" help="Consult cutadapt for usage" value="">
          <sanitizer sanitize="False"/>
          </param>>
      </when>
    </conditional>

    <conditional name="similarity_filtering">
	    <param name="include" type="boolean" truevalue="true" falsevalue="false" checked="False" label="Use similarity search filtering"/>
	    <when value="false">
        <!-- do nothing here -->
      </when>
      <when value="true">

   		  <param name="filter_database" format="fasta" type="data" label="Sequence filter database" help="Provide DNA sequences in fasta format. Sequence reads which has at least 90% similarity over 90% of length to sequence in filter database will be removed. This is suitable option if you want to remove organele DNA or contamination"/>
      </when>
    </conditional>

  </inputs>


  <outputs>
    <data format="fasta" name="output" label="filtered fasta reads from datasets ${A.hid}"/>
    <data format="png" name="png_output" label="nucleotide composition after filtering of ${A.hid}"/>"
  </outputs>

  <tests>
    <test>
      <param name="A" value="ERR215189_1_part.fastq.gz" />
      <param name="max_n" value="0"/>
      <param name="cut_off" value="10" />
      <param name="percent_above" value="95" />
      <output name="output" value="single_output.fasta" />
      <output name="png_output" value="single_output.png" />
    </test>
  </tests>

  <help>
**What it does**

This tool is designed to perform preprocessing of fastq file. Input files can be
in GNU zipped archive (.gz extension). Reads are filtered based on the quality,
presence of N bases and adapters. All reads which pass the quality filter fill
be writen into output files. If sampling is specified, only sample of sequences
will be returned.

Cutadapt us run with this options::

    --anywhere='AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT'
    --anywhere='AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT'
    --anywhere='GATCGGAAGAGCACACGTCTGAACTCCAGTCAC'
    --anywhere='ATCTCGTATGCCGTCTTCTGCTTG'
    --anywhere='CAAGCAGAAGACGGCATACGAGAT'
    --anywhere='GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC'
    --error-rate=0.05
    --times=1 --overlap=15 --discard


**Order of fastq files processing**

1. Trimming (optional)       
#. Filter by quality      
#. Cutadapt filtering 
#. Sampling (optional)         
#. Interlacing two fasta files

**Quality setting cut-off**

To correctly set quality cut-off, you need to know how the quality is encoded in your fastq file, default
filtering which is suitable for Sanger and Illumina 1.8 encoding is shown below::


      Default filtering cut-off
                |   
                |
                V
      SSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSS.....................................................
      ..........................XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX......................
      ...............................IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII......................
      .................................JJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJ......................
      LLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLL....................................................
      !"#$%&amp;'()*+,-./0123456789:;&lt;=&gt;?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~
      |                         |    |        |                              |                     |
     33                        59   64       73                            104                   126
      0........................26...31.......40                                
                               -5....0........9.............................40 
                                     0........9.............................40 
                                        3.....9.............................40 
      0.2......................26...31........41                              
    
     S - Sanger        Phred+33,  raw reads typically (0, 40)
     X - Solexa        Solexa+64, raw reads typically (-5, 40)
     I - Illumina 1.3+ Phred+64,  raw reads typically (0, 40)
     J - Illumina 1.5+ Phred+64,  raw reads typically (3, 40)
         with 0=unused, 1=unused, 2=Read Segment Quality Control Indicator (bold) 
         (Note: See discussion above).
     L - Illumina 1.8+ Phred+33,  raw reads typically (0, 41)
    
  </help>    
</tool>