Mercurial > repos > petr-novak > re_utils
diff paired_fastq_filtering.xml @ 22:58807b35777a draft
planemo upload commit 20bdf879b52796d3fb251a20807191ff02084d3c-dirty
| author | petr-novak |
|---|---|
| date | Wed, 02 Aug 2023 11:31:12 +0000 |
| parents | 768883847008 |
| children | 36c418bca8b2 |
line wrap: on
line diff
--- a/paired_fastq_filtering.xml Thu Jul 27 09:46:13 2023 +0000 +++ b/paired_fastq_filtering.xml Wed Aug 02 11:31:12 2023 +0000 @@ -1,184 +1,212 @@ <tool id="paired_fastq_filtering" name="Preprocessing of FASTQ paired-end reads"> - <stdio> - <exit_code range="1:" level="fatal" description="Error" /> - </stdio> - <description> - Preprocessing of paired-end reads in FASTQ format - including trimming, quality filtering, cutadapt filtering and interlacing. Broken - pairs are discarded. - </description> - <requirements> - <requirement type="package">blast</requirement> - <requirement type="package">cutadapt</requirement> - <requirement type="package">bioconductor-shortread</requirement> - <requirement type="package">r-optparse</requirement> - </requirements> - <command interpreter="bash"> - paired_fastq_filtering_wrapper.sh -a ${A} -b ${B} -o ${paired} -c ${cut_off} -p ${percent_above} -N ${max_n} $rename -G ${png_output} + <stdio> + <exit_code range="1:" level="fatal" description="Error" version="1.0.0.3"/> + </stdio> + <description> + Preprocessing of paired-end reads in FASTQ format + including trimming, quality filtering, cutadapt filtering and interlacing. Broken + pairs are discarded. + </description> + <requirements> + <requirement type="package">blast</requirement> + <requirement type="package">cutadapt</requirement> + <requirement type="package">bioconductor-shortread</requirement> + <requirement type="package">r-optparse</requirement> + </requirements> + <required_files> + <include type="literal" path="paired_fastq_filtering_wrapper.sh"/> + <include type="literal" path="paired_fastq_filtering.R"/> + <include type="literal" path="fasta_interlacer.py"/> + </required_files> + <command> + bash '$__tool_directory__'/paired_fastq_filtering_wrapper.sh -a ${A} -b ${B} -o + ${paired} -c ${cut_off} -p ${percent_above} -N ${max_n} $rename -G ${png_output} - #if $sampling.sequence_sampling : - -n $sampling.sample_size - #end if + #if $sampling.sequence_sampling : + -n $sampling.sample_size + #end if - #if $trimming.sequence_trimming : - -e $trimming.trim_end -s $trimming.trim_start - #end if + #if $trimming.sequence_trimming : + -e $trimming.trim_end -s $trimming.trim_start + #end if - #if $cutadapt.use_custom : - -C "${cutadapt.custom_options}" - #end if + #if $cutadapt.use_custom : + -C "${cutadapt.custom_options}" + #end if - #if $similarity_filtering.include : - -F "${similarity_filtering.filter_database}" - #end if + #if $similarity_filtering.include : + -F "${similarity_filtering.filter_database}" + #end if - </command> + </command> - <inputs> - <param format="fastq,fastq.gz" type="data" name="A" label="Left-hand reads" /> + <inputs> + <param format="fastq,fastq.gz" type="data" name="A" label="Left-hand reads"/> - <param format="fastq,fastq.gz" type="data" name="B" label="Right-hand reads" /> + <param format="fastq,fastq.gz" type="data" name="B" label="Right-hand reads"/> - <conditional name="sampling"> - <param name="sequence_sampling" type="boolean" truevalue="true" falsevalue="false" checked="False" label="Read sampling"/> - <when value="false"> - <!-- do nothing here --> - </when> - <when value="true"> - <param name="sample_size" type="integer" label="Sample size (number of pairs)" help="How many read pairs should be sampled" value="500000" min="0"/> - </when> - </conditional> + <conditional name="sampling"> + <param name="sequence_sampling" type="boolean" truevalue="true" + falsevalue="false" checked="False" label="Read sampling"/> + <when value="false"> + <!-- do nothing here --> + </when> + <when value="true"> + <param name="sample_size" type="integer" + label="Sample size (number of pairs)" + help="How many read pairs should be sampled" value="500000" + min="0"/> + </when> + </conditional> - <param type="integer" name="cut_off" label="Quality cutoff" value="10" min="0" help="See below how to correctly set the quality cutoff" /> - <param type="integer" name="percent_above" label="Percent above cutoff" value="95" min="0" - help="Percentage of bases in the read that must have quality equal to or higher than the cutoff value" /> + <param type="integer" name="cut_off" label="Quality cutoff" value="10" min="0" + help="See below how to correctly set the quality cutoff"/> + <param type="integer" name="percent_above" label="Percent above cutoff" value="95" + min="0" + help="Percentage of bases in the read that must have quality equal to or higher than the cutoff value"/> - <conditional name="trimming"> - <param name="sequence_trimming" type="boolean" truevalue="true" falsevalue="false" checked="False" label="Trim reads"/> - <when value="false"> - <!-- do nothing here --> - </when> - <when value="true"> - <param type="integer" name="trim_start" label="Start position" value="1" min="1" - help="Reads are trimmed at the specified start" /> - <param type="integer" name="trim_end" label="End position" value="100" min="1" - help="Reads are trimmed to the specified end position, shorted sequences are discarded" /> - </when> + <conditional name="trimming"> + <param name="sequence_trimming" type="boolean" truevalue="true" + falsevalue="false" checked="False" label="Trim reads"/> + <when value="false"> + <!-- do nothing here --> + </when> + <when value="true"> + <param type="integer" name="trim_start" label="Start position" value="1" + min="1" + help="Reads are trimmed at the specified start"/> + <param type="integer" name="trim_end" label="End position" value="100" + min="1" + help="Reads are trimmed to the specified end position, shorted sequences are discarded"/> + </when> - </conditional> - <param name="max_n" type="integer" label="Maximum Ns" help="Maximal number of Ns allowed in reads" value="0" min="0" max="10"/> + </conditional> + <param name="max_n" type="integer" label="Maximum Ns" + help="Maximal number of Ns allowed in reads" value="0" min="0" max="10"/> + + <conditional name="cutadapt"> + <param name="use_custom" type="boolean" truevalue="true" falsevalue="false" + checked="False" label="Custom cutadapt options"/> + <when value="false"> + <!-- do nothing here --> + </when> + <when value="true"> + <param name="custom_options" type="text" area="True" size="8x30" + label="Custom options" help="Consult cutadapt for usage" value=""> + <sanitizer sanitize="False"/> + </param> + > + </when> + </conditional> - <conditional name="cutadapt"> - <param name="use_custom" type="boolean" truevalue="true" falsevalue="false" checked="False" label="Custom cutadapt options"/> - <when value="false"> - <!-- do nothing here --> - </when> - <when value="true"> - <param name="custom_options" type="text" area="True" size="8x30" label="Custom options" help="Consult cutadapt for usage" value=""> - <sanitizer sanitize="False"/> - </param>> - </when> - </conditional> + <conditional name="similarity_filtering"> + <param name="include" type="boolean" truevalue="true" falsevalue="false" + checked="False" label="Use similarity search filtering"/> + <when value="false"> + <!-- do nothing here --> + </when> + <when value="true"> - <conditional name="similarity_filtering"> - <param name="include" type="boolean" truevalue="true" falsevalue="false" checked="False" label="Use similarity search filtering"/> - <when value="false"> - <!-- do nothing here --> - </when> - <when value="true"> - - <param name="filter_database" format="fasta" type="data" label="Sequence filter database" help="Provide DNA sequences in FASTA format. Reads that have at least 90% similarity over 90% of their length to sequence in the filter database will be removed. This option is suitable for removing organellar or other contaminating sequences."/> - </when> - </conditional> + <param name="filter_database" format="fasta" type="data" + label="Sequence filter database" + help="Provide DNA sequences in FASTA format. Reads that have at least 90% similarity over 90% of their length to sequence in the filter database will be removed. This option is suitable for removing organellar or other contaminating sequences."/> + </when> + </conditional> - <param name="rename" type="boolean" truevalue="-R" falsevalue="" checked="True" label="Rename reads" help="By default, original read names are used. In case your reads do not follow proper naming scheme to label paired-end mates, use this option. All read pairs must be complete!"/> - </inputs> + <param name="rename" type="boolean" truevalue="-R" falsevalue="" checked="True" + label="Rename reads" + help="By default, original read names are used. In case your reads do not follow proper naming scheme to label paired-end mates, use this option. All read pairs must be complete!"/> + </inputs> - <outputs> - <data format="fasta" name="paired" label="Interlaced paired reads from datasets ${A.hid} and ${B.hid} "/> - <data format="png" name="png_output" label="Nucleotide composition after filtering of ${A.hid} and ${B.hid} "/>" - </outputs> + <outputs> + <data format="fasta" name="paired" + label="Interlaced paired reads from datasets ${A.hid} and ${B.hid} "/> + <data format="png" name="png_output" + label="Nucleotide composition after filtering of ${A.hid} and ${B.hid} "/>" + </outputs> - <tests> - <test> - <param name="A" value="ERR215189_1_part.fastq.gz" /> - <param name="B" value="ERR215189_2_part.fastq.gz" /> - <param name="max_n" value="0"/> - <param name="cut_off" value="10" /> - <param name="percent_above" value="95" /> - <output name="output" value="paired_output.fasta" /> - <output name="png_output" value="paired_output.png" /> - </test> - </tests> + <tests> + <test> + <param name="A" value="ERR215189_1_part.fastq.gz"/> + <param name="B" value="ERR215189_2_part.fastq.gz"/> + <param name="max_n" value="0"/> + <param name="cut_off" value="10"/> + <param name="percent_above" value="95"/> + <output name="output" value="paired_output.fasta"/> + <output name="png_output" value="paired_output.png"/> + </test> + </tests> - <help> -**What it does** + <help> + **What it does** -This tool is designed to make memory efficient preprocessing of two -fastq files. Output of this file can be used as input of RepeatExplorer clustering. -Input files can be in GNU zipped archive (.gz extension). -Reads are filtered based on the quality, presence of N bases and -adapters. Two input fastq files are procesed in parallel. Only complete pair -are kept. As the input files are process in chunks, it is required that -pair reads are complete and in the same order in both input files. All -reads which pass the quality filter fill be writen into output files. -If sampling is specified, only sample of sequences will be -returned. Cutadapt us run with this options:: + This tool is designed to make memory efficient preprocessing of two + fastq files. Output of this file can be used as input of RepeatExplorer + clustering. + Input files can be in GNU zipped archive (.gz extension). + Reads are filtered based on the quality, presence of N bases and + adapters. Two input fastq files are procesed in parallel. Only complete pair + are kept. As the input files are process in chunks, it is required that + pair reads are complete and in the same order in both input files. All + reads which pass the quality filter fill be writen into output files. + If sampling is specified, only sample of sequences will be + returned. Cutadapt us run with this options:: - --anywhere='AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT' - --anywhere='AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT' - --anywhere='GATCGGAAGAGCACACGTCTGAACTCCAGTCAC' - --anywhere='ATCTCGTATGCCGTCTTCTGCTTG' - --anywhere='CAAGCAGAAGACGGCATACGAGAT' - --anywhere='GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC' - --error-rate=0.05 - --times=1 --overlap=15 --discard + --anywhere='AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT' + --anywhere='AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT' + --anywhere='GATCGGAAGAGCACACGTCTGAACTCCAGTCAC' + --anywhere='ATCTCGTATGCCGTCTTCTGCTTG' + --anywhere='CAAGCAGAAGACGGCATACGAGAT' + --anywhere='GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC' + --error-rate=0.05 + --times=1 --overlap=15 --discard -**Order of fastq files processing** + **Order of fastq files processing** -1. Trimming (optional) -#. Filter by quality -#. Discard single reads, keep complete pairs -#. Cutadapt filtering -#. Discard single reads, keep complete pairs -#. Sampling (optional) -#. Interlacing two fasta files + 1. Trimming (optional) + #. Filter by quality + #. Discard single reads, keep complete pairs + #. Cutadapt filtering + #. Discard single reads, keep complete pairs + #. Sampling (optional) + #. Interlacing two fasta files -**Quality setting cutoff** + **Quality setting cutoff** -To correctly set quality cutoff, you need to know how the quality is encoded in your fastq file, default -filtering which is suitable for Sanger and Illumina 1.8 encoding is shown below:: + To correctly set quality cutoff, you need to know how the quality is encoded in + your fastq file, default + filtering which is suitable for Sanger and Illumina 1.8 encoding is shown below:: - Default filtering cutoff - | - | - V - SSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSS..................................................... - ..........................XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX...................... - ...............................IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII...................... - .................................JJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJ...................... - LLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLL.................................................... - !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~ - | | | | | | - 33 59 64 73 104 126 - 0........................26...31.......40 - -5....0........9.............................40 - 0........9.............................40 - 3.....9.............................40 - 0.2......................26...31........41 - - S - Sanger Phred+33, raw reads typically (0, 40) - X - Solexa Solexa+64, raw reads typically (-5, 40) - I - Illumina 1.3+ Phred+64, raw reads typically (0, 40) - J - Illumina 1.5+ Phred+64, raw reads typically (3, 40) - with 0=unused, 1=unused, 2=Read Segment Quality Control Indicator (bold) - (Note: See discussion above). - L - Illumina 1.8+ Phred+33, raw reads typically (0, 41) - - </help> + Default filtering cutoff + | + | + V + SSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSS..................................................... + ..........................XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX...................... + ...............................IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII...................... + .................................JJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJ...................... + LLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLL.................................................... + !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~ + | | | | | | + 33 59 64 73 104 126 + 0........................26...31.......40 + -5....0........9.............................40 + 0........9.............................40 + 3.....9.............................40 + 0.2......................26...31........41 + + S - Sanger Phred+33, raw reads typically (0, 40) + X - Solexa Solexa+64, raw reads typically (-5, 40) + I - Illumina 1.3+ Phred+64, raw reads typically (0, 40) + J - Illumina 1.5+ Phred+64, raw reads typically (3, 40) + with 0=unused, 1=unused, 2=Read Segment Quality Control Indicator (bold) + (Note: See discussion above). + L - Illumina 1.8+ Phred+33, raw reads typically (0, 41) + + </help> </tool>