diff README.md @ 0:a4cd8608ef6b draft

Uploaded

--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/README.md	Mon Apr 01 07:56:36 2019 -0400
@@ -0,0 +1,74 @@
+# RepeatExplorer utilities #
+
+This repository include utilities for preprocessing of NGS data to suitable format for RepeatExplorer  and TAREAN 
+analysis. Each tool include also XML file which define tool interface for Galaxy environment
+
+## Available tools ##
+
+### Paired fastq reads filtering and interlacing ###
+tool definition file: `paired_fastq_filtering.xml`
+
+This tool is designed to make memory efficient preprocessing of two fastq files. Output of this file can be used as input of RepeatExplorer clustering. Input files can be in GNU zipped archive (.gz extension). Reads are filtered based on the quality, presence of N bases and adapters. Two input fastq files are procesed in parallel. Only complete pair are kept. As the input files are process in chunks, it is required that pair reads are complete and in the same order in both input files. All reads which pass the quality filter fill be writen into output files. If sampling is specified, only sample of sequences will be returned. Cutadapt us run with this options:
+
+```
+--anywhere='AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT'
+--anywhere='AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT'
+--anywhere='GATCGGAAGAGCACACGTCTGAACTCCAGTCAC'
+--anywhere='ATCTCGTATGCCGTCTTCTGCTTG'
+--anywhere='CAAGCAGAAGACGGCATACGAGAT'
+--anywhere='GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC'
+--error-rate=0.05
+--times=1 --overlap=15 --discard
+```
+
+Order of fastq files processing
+
+1. Trimming (optional)
+2. Filter by quality
+3. Discard single reads, keep complete pairs
+4. Cutadapt filtering
+5. Discard single reads, keep complete pairs
+6. Sampling (optional)
+7. Interlacing two fasta files
+
+
+### single fastq reads filtering ###
+tool definition file: `single_fastq_filtering.xml`
+
+This tool is designed to perform preprocessing
+of fastq file. Input files can be in GNU zipped archive (.gz extension). Reads
+are filtered based on the quality, presence of N bases and adapters. All reads
+which pass the quality filter fill be writen into output files. If sampling is
+specified, only sample of sequences will be returned. 
+
+### fasta afixer ###
+tool definition file: `fasta_affixer.xml`
+
+Tool for appending prefix and suffix to sequences names in fasta formated sequences. This tool is useful
+if you want to do comparative analysis with RepeatExplorer and need to
+append sample codes to sequence identifiers
+
+
+## Dependencies ##
+
+R programming environment with installed packages *optparse* and *ShortRead* (Bioconductor)
+python3
+cutadapt
+
+## License ##
+
+Copyright (c) 2012 Petr Novak ([e-mail]), Jiri Macas and Pavel Neumann,
+Laboratory of Molecular Cytogenetics(http://w3lamc.umbr.cas.cz/lamc/)
+Institute of Plant Molecular Biology, Biology Centre AS CR, Ceske Budejovice, Czech Republic
+
+This program is free software: you can redistribute it and/or modify
+it under the terms of the GNU General Public License as published by
+the Free Software Foundation, either version 3 of the License, or
+(at your option) any later version.
+
+This program is distributed in the hope that it will be useful,
+but WITHOUT ANY WARRANTY; without even the implied warranty of
+MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the
+GNU General Public License for more details.
+You should have received a copy of the GNU General Public License
+along with this program.  If not, see <http://www.gnu.org/licenses/>.