view fasta_affixer.xml @ 16:5376e1c9adec draft

Uploaded

<tool id="fasta_affixer" name="FASTA read name affixer" version="1.0.0">
<description> Appending suffix and prefix to the read names </description>
<command interpreter="python3">
fasta_affixer.py -f $input -p "$prefix" -s "$suffix" -n $nspace -o $output
</command>

 <inputs>
  <param format="fasta" type="data" name="input" label="Choose your FASTA file" />
  <param name="prefix" type="text" size="10" value="" label="Prefix" help="Enter prefix which will be added to all read names" />
  <param name="suffix" type="text" size="10" value="" label="Suffix" help="Enter suffix which will be added to all read names"/>
  <param name="nspace" type="integer" size="10" value="0" min="0" max="1000" label="Number of spaces in the name to ignore" help="By default, a string before the first space is considered to be the read name, and all characters following the space are discarded. If you want to keep the information following the space(s) in the name, enter positive integer."/>
 </inputs>


 <outputs>
 	<data format="fasta" name="output" label="FASTA dataset ${input.hid} with modified sequence names" />
 </outputs>

 <tests>
   <test>
     <param name="input" value="single_output.fasta" />
     <param name="prefix" value="TEST" />
     <param name="suffux" value="OK"/>
     <param name="nspace" value="0" />
     <output name="output" value="prefix_suffix.fasta" />
   </test>
 </tests>
 <help>
**What is does**
 
Tool for appending prefix and suffix to sequences names in fasta formated sequences. This tool is useful
if you want to do comparative analysis with RepeatExplorer and need to
append sample codes to sequence identifiers

**Example**
The following fasta file:

::

  >123454
  acgtactgactagccatgacg
  >234235
  acgtactgactagccatgacg

is renamed to:

::

  >prefix123454suffix
  acgtactgactagccatgacg
  >prefix234235suffix
  acgtactgactagccatgacg


By default, anything after spaces is 
excluded from sequences name. In example sequence:

::
  
 >SRR352150.23846180 HWUSI-EAS1786:7:119:15910:19280/1
 CTGGATTCTATACCTTTGGCAACTACTTCTTGGTTGATCAGGAAATTAACACTAGTAGTTTAGGCAATTTGGAATGGTGCCAAAGATGTATAGAACTTTC
 IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIGIIIHIIIIIFIIIIIIHDHBBIHFIHIIBHHDDHIFHIHIIIHIHGGDFDEI@EGEGFGFEFB@ECG

when **Number of spaces in name to ignore** is set to 0 (default) the output will be:
 
::
 
 >prefixSRR352150.23846180suffix
 CTGGATTCTATACCTTTGGCAACTACTTCTTGGTTGATCAGGAAATTAACACTAGTAGTTTAGGCAATTTGGAATGGTGCCAAAGATGTATAGAACTTTC

 
If you want to keep spaces the setting **Number of spaces in name to ignore** to 1 will yield 
 
:: 
 
 >prefixSRR352150.23846180 HWUSI-EAS1786:7:119:15910:19280/1suffix
 CTGGATTCTATACCTTTGGCAACTACTTCTTGGTTGATCAGGAAATTAACACTAGTAGTTTAGGCAATTTGGAATGGTGCCAAAGATGTATAGAACTTTC


</help>
</tool>