Mercurial > repos > petr-novak > repeatexplorer2_testing
diff repex_tarean.xml @ 0:43c4250c6761 draft
Uploaded
| author | petr-novak |
|---|---|
| date | Thu, 30 Apr 2020 07:42:45 -0400 |
| parents | |
| children |
line wrap: on
line diff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/repex_tarean.xml Thu Apr 30 07:42:45 2020 -0400 @@ -0,0 +1,251 @@ +<tool id="tarean" name="Tandem Repeat Analyzer" version="2.3.8" > + <stdio> + <regex match="Traceback" source="stderr" level="fatal" description="Unknown error" /> + <regex match="error" source="stderr" level="fatal" description="Unknown error" /> + <regex match="warning" source="stderr" level="warning" description="Unknown warning" /> + <exit_code range="1:" level="fatal" description="Error" /> + </stdio> + <description>Identification of genomic tandem repeats from NGS data</description> + <requirements> + <requirement type="package">imagemagick</requirement> + <requirement type="package">mafft</requirement> + <requirement type="package">blast</requirement> + <requirement type="package" version="0.9.29">diamond</requirement> + <requirement type="package">blast-legacy</requirement> + <requirement type="package">r-igraph</requirement> + <requirement type="package">r-data.tree</requirement> + <requirement type="package">r-stringr</requirement> + <requirement type="package">r-r2html</requirement> + <requirement type="package">r-hwriter</requirement> + <requirement type="package">r-dt</requirement> + <requirement type="package">r-scales</requirement> + <requirement type="package">r-plotrix</requirement> + <requirement type="package">r-png</requirement> + <requirement type="package">r-plyr</requirement> + <requirement type="package">r-dplyr</requirement> + <requirement type="package">r-optparse</requirement> + <requirement type="package">r-dbi</requirement> + <requirement type="package">r-rsqlite</requirement> + <requirement type="package">r-rserve</requirement> + <requirement type="package">bioconductor-biostrings</requirement> + <requirement type="package" version="2.3.8">repex_tarean_testing</requirement> + <requirement type="set_environment">REPEX</requirement> + <requirement type="set_environment">REPEX_VERSION</requirement> + <requirement type="package" version="0.9.1">pyrserve</requirement> + </requirements> + <command detect_errors="exit_code"> + export PYTHONHASHSEED=0; + \${REPEX}/seqclust --paired --sample ${read_sampling.sample} --output_dir=tarean_output --logfile=${log} --cleanup --tarean_mode + #if $advanced_options.advanced: + --mincl $advanced_options.size_threshold $advanced_options.keep_names $advanced_options.automatic_filtering -M $advanced_options.merging + #if $advanced_options.custom_library.options_custom_library : + -d $advanced_options.custom_library.library extra_database + #end if + #if $advanced_options.options.options: + -opt $advanced_options.options.options + #end if + #else: + -M 0.2 + + #end if + ${FastaFile} >stdout.log 2> stderr.log ; + echo "STDOUT CONTENT:" >> ${log} ; + cat stdout.log >> ${log} ; + echo "STDERR CONTENT:" >> ${log} ; + cat stderr.log >> ${log} && + \${REPEX}/stderr_filter.py stderr.log && + cd tarean_output && + zip -r ${ReportArchive}.zip * && + mv ${ReportArchive}.zip ${ReportArchive} && + cp index.html ${ReportFile} && + mkdir ${ReportFile.files_path} && + cp -r --parents libdir ${ReportFile.files_path} && + cp -r --parents seqclust/clustering/superclusters ${ReportFile.files_path} && + cp -r --parents seqclust/clustering/clusters ${ReportFile.files_path} && + cp seqclust/clustering/hitsort.cls ${ReportFile.files_path}/seqclust/clustering/hitsort.cls && + cp *.png ${ReportFile.files_path}/ && + cp *.csv ${ReportFile.files_path}/ && + cp *.html ${ReportFile.files_path}/ && + cp *.css ${ReportFile.files_path}/ && + cp *.fasta ${ReportFile.files_path}/ 2>>$log && rm -r ../tarean_output || : + + + </command> + + <inputs> + <param name="FastaFile" label="Paired-end Illumina reads" type="data" format="fasta" + help="Input file must contain FASTA-formatted interlaced read pairs from paired-end sequencing. All pairs must be complete. Example of the input data format is provided in the help below."/> + + <conditional name="read_sampling"> + <param name="do_sampling" type="boolean" truevalue="true" falsevalue="false" checked="False" label="Read sampling" help="Use this option if you want to analyze only a part of the reads" /> + <when value="false"> + <!-- pass --> + <param name="sample" label="Sample size" hidden="True" type="integer" value="0" help="Number of analyzed reads"/> + </when> + <when value="true"> + <param name="sample" label="Sample size" type="integer" value="500000" min="10000" help="Number of analyzed reads"/> + </when> + </conditional> + + <conditional name="advanced_options"> + <param name="advanced" type="boolean" truevalue="true" falsevalue="false" checked="False" label="Advanced options" /> + <when value="false"> + <!-- pass --> + </when> + <when value="true"> + <param name="merging" type="boolean" truevalue="0.2" falsevalue="0" checked="True" label="Perform cluster merging" help="By default, clusters connected through paired-end reads are merged"/> + <conditional name="custom_library"> + <param name="options_custom_library" type="boolean" truevalue="true" falsevalue="false" checked="False" label="Use custom repeat database"/> + <when value="false"> + <!-- do nothing here --> + </when> + <when value="true"> + <param name="library" format="fasta" type="data" label="Use custom repeat database" help="Perform additional similarity search to user-provided repeat database. The database should contain FASTA-formatted DNA sequences with headers (sequence names) in the format: '>reapeatname#class/subclass'"/> + </when> + </conditional> + <param name="size_threshold" label="Cluster size threshold for detailed analysis" type="float" value="0.01" min="0.0001" max="100" help ="Minimal size (as percentage of input reads) of the smallest cluster which is analyzed; cluster with less than 20 reads are not considered."/> + <param name="automatic_filtering" label="Perform automatic filtering of abundant satellite repeats" type="boolean" truevalue="--automatic_filtering" falsevalue="" checked="false"/> + <param name="keep_names" label="Keep original read names" type="boolean" truevalue="--keep_names" falsevalue="" checked="false" help="By default, reads are renamed using integers. Use this option if you want to keep original names."/> + <conditional name="options"> + <param name="options" type="select" label="Similarity search options"> + <option value="ILLUMINA" selected="true">Default </option> + <option value="ILLUMINA_DUST_OFF" selected="false">Masking of low complexity repeats disabled </option> + + <option value="ILLUMINA_SENSITIVE_MGBLAST" selected="false">Illumina reads, sensitive search (search parameters: mgblast, min PID 80, -W8) slow, experimental feature!</option> + <option value="ILLUMINA_SENSITIVE_BLASTPLUS" selected="false">Illumina reads, more sensitive search (search parameters: blastn, min PID 80, -W6) extremely slow, experimental feature!</option> + <option value="OXFORD_NANOPORE" selected="false"> + Pseudo short reads simulated from Oxford Nanopore data, experimental feature! + </option> + </param> + </conditional> + </when> + </conditional> + + + + </inputs> + <outputs> + <data name="log" format="txt" label="TAREAN log file"/> + <data name="ReportArchive" format="zip" label="TAREAN Archive with HTML report from data ${FastaFile.hid}"/> + <data name="ReportFile" format="html" label="TAREAN HTML report from data ${FastaFile.hid}"/> + </outputs> + + <help> + **HELP** + + TAREAN - TAndem REpeat ANalyzer is a computational pipeline for + **unsupervised identification of satellite repeats** from unassembled + sequence reads. The pipeline uses low-pass paired-end whole genome + sequence reads and performs graph-based clustering. The resulting + clusters, representing all types of repeats present in the genome, are + then examined to identify those containing circular structures indicative + of tandem repeats. A poster summarizing TAREAN principles and + implementation can be found `here.`__ + + + .. __: http://w3lamc.umbr.cas.cz/lamc/?page_id=312 + + **Input data** + + + The analysis requires **paired-end reads** generated by whole genome + shotgun sequencing. The data should be provided as a single input file in + fasta format with the reads interlaced (see example below). All the pairs + must be complete, i.e. both "forward" and "reverse" sequence reads must be + present. The reads should all be trimmed to the same length. The optimal + size range is between 100 and 200 nucleotides. The number of reads to be + analyzed should not exceed 1x coverage of the genome. Genome coverage + between 0.01 and 0.5x is recommended. The reads should be filtered for + quality. The recommended quality filtering is as follows: each read should + have a quality score >=10 for 95% of the bases, i.e. if your reads are 100 + base pairs long, then a read only passes this quality threshold if 95 + bases have a quality of 10 or higher. Additionally, any reads containing + indeterminate base pairs (indicated as N in the reads) should be removed. + Finally, if either one of the reads in a pair fails to meet the + aforementioned thresholds, **both** sequences should be removed. + example of interlaced input format:: + + >0001_f + CGTAATATACATACTTGCTAGCTAGTTGGATGCATCCAACTTGCAAGCTAGTTTGATG + >0001_r + GATTTGACGGACACACTAACTAGCTAGTTGCATCTAAGCGGGCACACTAACTAACTAT + >0002_f + ACTCATTTGGACTTAACTTTGATAATAAAAACTTAAAAAGGTTTCTGCACATGAATCG + >0002_r + TATGTTGAAAAATTGAATTTCGGGACGAAACAGCGTCTATCGTCACGACATAGTGCTC + >0003_f + TGACATTTGTGAACGTTAATGTTCAACAAATCTTTCCAATGTCTTTTTATCTTATCAT + >0003_r + TATTGAAATACTGGACACAAATTGGAAATGAAACCTTGTGAGTTATTCAATTTATGTT + ... + + + To perform the quality filtering on your fastQ formatted data as described + above, and to interlace your paired-end sequence reads, + please use the `Preprocessing of paired-reads`__ tool. + + .. __: tool_runner?tool_id=paired_fastq_filtering + + + **Additional parameters** + + **Sample size** defines how many reads will be used during the computation. + The default setting of 500,000 reads will enable detection of high copy + number satellites within several hours. For higher + sensitivity the sample size can be increased. Since the sample size affects + memory usage, this parameter may be automatically adjusted to a lower value + during the run. The maximum sample size which can be processed depends on the + repetitiveness of the analyzed genome. This significantly limits the number of reads + that can be analyzed with the TAREAN pipeline. + + **Perform cluster merging**. Families of repetitive elements are + frequently split into multiple clusters rather than being represented as a + single one. If you do not want to merge clusters based on the presence + of broken read pairs, disable this option. + + **Use custom repeat database**. This option allows users to perform similarity + comparison of identified repeats to their custom databases. The repeat class should + be encoded in FASTA headers of database entries in order to allow correct + parsing of similarity hits. + + **Similarity search options** By default sequence reads are compared using + mgblast program. Default threshold is explicitly set to 90% sequence + similarity spanning at least 55% of the read length (in the case of reads + differing in length it applies to the longer one). Additionally, sequence + overlap must be at least 55 nt. If you select option for shorter reads + than 100 nt, minimum overlap 55 nt is not required. + + By default, + mgblast search use DUST program to filter out + low-complexity sequences. If you want + to increase sensitivity of detection of satellites with shorter monomer + use option with '*no masking of low complexity repeats*'. Note that omitting + DUST filtering will significantly increase running times + + **Output** + + A list of clusters identified as putative satellite repeats, their genomic + abundance and various cluster characteristics are provided. Length and + consensus sequences of reconstructed monomers are also shown and + accompanied by a detailed output from kmer-based reconstruction including + sequences and sequence logos of alternative variants of monomer sequences. + + The output includes an **HTML summary** with a table listing all analyzed + clusters. More detailed information about clusters is provided in + additional files and directories. All results are also provided as a + downloadable **zip archive**. Since read clustering results in + thousands of clusters, the search for satellite repeats is limited to + a subset of the largest ones corresponding to the most abundant genomic + repeats. The default setting of the pipeline is to analyze all clusters containing at least + 0.01% of the input reads. Besides the satellite repeats, three other + groups of clusters are reported in the output (1) LTR-retrotransposons, + (2) 45S and 5S rDNA and (3) all remaining clusters passing the size + threshold. As (1) and (2) contain sequences with circular + graphs, their consensus is calculated in the same way as for satellite + repeats. Additionally a **log file** reporting the progress of the + computational pipeline is provided. + + + </help> + +</tool>