Mercurial > repos > petr-novak > repeatexplorer2_testing
changeset 1:422485508110 draft
Uploaded
| author | petr-novak |
|---|---|
| date | Fri, 24 Jul 2020 07:26:07 -0400 |
| parents | 43c4250c6761 |
| children | 349b197133dc |
| files | repex_full_clustering.xml repex_tarean.xml tool_dependencies.xml |
| diffstat | 3 files changed, 26 insertions(+), 565 deletions(-) [+] |
line wrap: on
line diff
--- a/repex_full_clustering.xml Thu Apr 30 07:42:45 2020 -0400 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,307 +0,0 @@ -<tool id="repeatexplorer2" name="RepeatExplorer2 clustering: " version="2.3.8" > - <stdio> - <regex match="lastdb: can't open file: NEAR" source="stderr" level="fatal" description="Version of last is too old, use ver 956 or higher\n" /> - <regex match="Traceback" source="stderr" level="fatal" description="Unknown error" /> - <regex match="error" source="stderr" level="fatal" description="Unknown error" /> - <regex match="Warning" source="stderr" level="warning" description="Unknown error" /> - <exit_code range="1:" level="fatal" description="Error" /> - </stdio> - <description>Improved version or repeat discovery and characterization using graph-based sequence clustering</description> - <requirements> - <requirement type="package">last</requirement> - <requirement type="package">imagemagick</requirement> - <requirement type="package">mafft</requirement> - <requirement type="package">blast</requirement> - <requirement type="package" version="0.9.29" >diamond</requirement> - <requirement type="package">blast-legacy</requirement> - <requirement type="package">r-igraph</requirement> - <requirement type="package">r-data.tree</requirement> - <requirement type="package">r-stringr</requirement> - <requirement type="package">r-r2html</requirement> - <requirement type="package">r-hwriter</requirement> - <requirement type="package">r-dt</requirement> - <requirement type="package">r-scales</requirement> - <requirement type="package">r-plotrix</requirement> - <requirement type="package">r-png</requirement> - <requirement type="package">r-plyr</requirement> - <requirement type="package">r-dplyr</requirement> - <requirement type="package">r-optparse</requirement> - <requirement type="package">r-dbi</requirement> - <requirement type="package">r-rsqlite</requirement> - <requirement type="package">r-rserve</requirement> - <requirement type="package">bioconductor-biostrings</requirement> - <requirement type="package" version="2.3.8">repex_tarean_testing</requirement> - <requirement type="set_environment">REPEX</requirement> - <requirement type="set_environment">REPEX_VERSION</requirement> - <requirement type="package" version="0.9.1" >pyrserve</requirement> - </requirements> - <command > - export PYTHONHASHSEED=0; - \${REPEX}/seqclust --sample ${read_sampling.sample} --output_dir=tarean_output --logfile=${log} --cleanup $paired --taxon $taxon - - #if $advanced_options.advanced: - --mincl $advanced_options.size_threshold $advanced_options.keep_names $advanced_options.automatic_filtering -D $advanced_options.blastx.options_blastx - --assembly_min $advanced_options.assembly_min_cluster_size - - #if $advanced_options.comparative.options_comparative: - --prefix_length $advanced_options.comparative.prefix_length - #end if - - #if $advanced_options.custom_library.options_custom_library: - -d $advanced_options.custom_library.library extra_database - #end if - - #if $advanced_options.options.options: - -opt $advanced_options.options.options - #end if - #end if - ${FastaFile} >stdout.log 2> stderr.log ; - echo "STDOUT CONTENT:" >> ${log} ; - cat stdout.log >> ${log} ; - echo "STDERR CONTENT:" >> ${log}; - cat stderr.log >> ${log} && - \${REPEX}/stderr_filter.py stderr.log && - cd tarean_output && - zip -r ${ReportArchive}.zip * && - mv ${ReportArchive}.zip ${ReportArchive} && - cp index.html ${ReportFile} && - mkdir ${ReportFile.files_path} && - cp -r --parents libdir ${ReportFile.files_path} && - cp -r --parents seqclust/clustering/superclusters ${ReportFile.files_path} && - cp -r --parents seqclust/clustering/clusters ${ReportFile.files_path} && - cp seqclust/clustering/hitsort.cls ${ReportFile.files_path}/seqclust/clustering/hitsort.cls && - cp *.png ${ReportFile.files_path}/ && - cp *.csv ${ReportFile.files_path}/ && - cp *.html ${ReportFile.files_path}/ && - cp *.css ${ReportFile.files_path}/ && - cp *.fasta ${ReportFile.files_path}/ 2>>$log && rm -r ../tarean_output || : - - </command> - <inputs> - <param name="FastaFile" label="NGS reads" type="data" format="fasta" - help="Input file must contain FASTA-formatted NGS reads. Illumina paired-end reads are recommended."/> - <param name="paired" type="boolean" truevalue="--paired" falsevalue="" checked="True" label="Paired-end reads" help="If paired-end reads are used, left- and right-hand reads must be interlaced and all pairs must be complete. Example of the correct format is provided in the help below." /> - - <conditional name="read_sampling"> - <param name="do_sampling" type="boolean" truevalue="true" falsevalue="false" checked="False" label="Read sampling" help="Use this option if you want to analyze only a part of the reads" /> - <when value="false"> - <!-- pass --> - <param name="sample" label="Sample size" hidden="True" type="integer" value="0" help="Number of analyzed reads"/> - </when> - <when value="true"> - <param name="sample" label="Sample size" type="integer" value="500000" min="10000" help="Number of analyzed reads"/> - </when> - </conditional> - - - <param name="taxon" label="Select taxon and protein domain database version (REXdb)" type="select" help="Reference database of transposable element protein domains - REXdb - is used for annotation of repeats"> - <option value="VIRIDIPLANTAE3.0" selected="true">Viridiplantae version 3.0 </option> - <option value="VIRIDIPLANTAE2.2" selected="true">Viridiplantae version 2.2</option> - <option value="METAZOA3.0" >Metazoa version 3.0</option> - <option value="METAZOA2.0" >Metazoa version 2.0</option> - <!-- Modify setting in config.py accordingly --> - </param> - - <conditional name="advanced_options"> - <param name="advanced" type="boolean" truevalue="true" falsevalue="false" checked="False" label="Advanced options" /> - <when value="false"> - <!-- pass --> - </when> - <when value="true"> - <conditional name="comparative"> - <param name="options_comparative" type="boolean" truevalue="true" falsevalue="false" checked="False" label="Perform comparative analysis" help="Use this options to analyze multiple samples simultaneously"/> - <when value="false"> - <!-- do nothing here --> - </when> - <when value="true"> - <param name="prefix_length" label="Group code length" type="integer" value="3" min="1" max="10" help="For comparative analysis, reads from different samples are distinguished by sample codes included as prefix to the read names. See example below."/> - </when> - </conditional> - - <conditional name="blastx"> - <param name="options_blastx" type="select" label="Select parameters for protein domain search"> - <option value="BLASTX_W2" selected="false">blastx with word size 2 (the most sensitive, slowest)</option> - <option value="BLASTX_W3" selected="true">blastx with word size 3 (default)</option> - <option value="DIAMOND" selected="false">diamond program (the least sensitive, fastest)</option> - </param> - </conditional> - - <conditional name="options"> - <param name="options" type="select" label="Similarity search options"> - <option value="ILLUMINA" selected="true">Default </option> - <option value="ILLUMINA_DUST_OFF" selected="false">Masking of low complexity repeats disabled </option> - - <option value="ILLUMINA_SENSITIVE_MGBLAST" selected="false">Illumina reads, sensitive search (search parameters: mgblast, min PID 80, -W8) slow, experimental feature!</option> - <option value="ILLUMINA_SENSITIVE_BLASTPLUS" selected="false">Illumina reads, more sensitive search (search parameters: blastn, min PID 80, -W6) extremely slow, experimental feature!</option> - <option value="OXFORD_NANOPORE" selected="false"> - Pseudo short reads simulated from Oxford Nanopore data, experimental feature! - </option> - </param> - </conditional> - - <conditional name="custom_library"> - <param name="options_custom_library" type="boolean" truevalue="true" falsevalue="false" checked="False" label="Use custom repeat database"/> - <when value="false"> - <!-- do nothing here --> - </when> - <when value="true"> - <param name="library" format="fasta" type="data" label="Custom repeat database" help="The database should contain DNA sequences in FASTA format. The required format for sequence IDs is : '>reapeatname#class/subclass'"/> - </when> - </conditional> - <param name="size_threshold" label="Cluster size threshold for detailed analysis" type="float" value="0.01" min="0.0001" max="100" help ="Minimal size (as percentage of input reads) of the smallest cluster which is analyzed; clusters with less than 20 reads are not considered."/> - <param name="automatic_filtering" label="Perform automatic filtering of abundant satellite repeats" help="Automatic filtering identifies the most abundant tandem repeats and partially removes their reads from the analysis. This enables to analyze higher proportions of other less abundant repeats." type="boolean" truevalue="--automatic_filtering" falsevalue="" checked="false"/> - <param name="keep_names" label="Keep original read names" type="boolean" truevalue="--keep_names" falsevalue="" checked="false" help="By default, reads are renamed using integers. Use this option to keep original names."/> - <param name="assembly_min_cluster_size" type="integer" label="Minimal cluster size for assembly" value="5" min="2" max="100"/> - </when> - </conditional> - - - - </inputs> - <outputs> - <data name="log" format="txt" label="RepeatExplorer2 - log file"/> - <data name="ReportArchive" format="zip" label="RepeatExplorer2 - Archive with HTML report from data ${FastaFile.hid}"/> - <data name="ReportFile" format="html" label="RepeatExplorer2 - HTML report from data ${FastaFile.hid}"/> - </outputs> - - <help> - **HELP** - - RepeatExplorer2 clustering is a computational pipeline for unsupervised - identification of repeats from unassembled sequence reads. The - pipeline uses low-pass whole genome sequence reads and performs graph-based - clustering. Resulting clusters, representing all types of repeats, are then - examined to identify and classify into repeats groups. - - **Input data** - - The analysis requires either **single** or **paired-end reads** generated - by whole genome shotgun sequencing provided as a single fasta-formatted file. - Generally, paired-end reads provide significantly better results than single - reads. Reads should be of uniform length (optimal size range is 100-200 nt) and - the number of analyzed reads should represent less than 1x genome equivalent - (genome coverage of 0.01 - 0.50 x is recommended). Reads should be - quality-filtered (recommended filtering : quality score >=10 over 95% of bases - and no Ns allowed) and only **complete read pairs** should be submitted for - analysis. When paired reads are used, input data must be **interlaced** format - as fasta file: - - example of interlaced input format:: - - >0001_f - CGTAATATACATACTTGCTAGCTAGTTGGATGCATCCAACTTGCAAGCTAGTTTGATG - >0001_r - GATTTGACGGACACACTAACTAGCTAGTTGCATCTAAGCGGGCACACTAACTAACTAT - >0002_f - ACTCATTTGGACTTAACTTTGATAATAAAAACTTAAAAAGGTTTCTGCACATGAATCG - >0002_r - TATGTTGAAAAATTGAATTTCGGGACGAAACAGCGTCTATCGTCACGACATAGTGCTC - >0003_f - TGACATTTGTGAACGTTAATGTTCAACAAATCTTTCCAATGTCTTTTTATCTTATCAT - >0003_r - TATTGAAATACTGGACACAAATTGGAAATGAAACCTTGTGAGTTATTCAATTTATGTT - ... - - - **Comparative analysis** - - For comparative analysis sequence names must contain code (prefix) for each group. - Prefix in sequences names must be of fixed length. - - Example of labeling two groups with where **group code length** is 2 and is used to distinguish groups - AA and BB :: - - >AA0001_f - CGTAATATACATACTTGCTAGCTAGTTGGATGCATCCAACTTGCAAGCTAGTTTGATG - >AA0001_r - GATTTGACGGACACACTAACTAGCTAGTTGCATCTAAGCGGGCACACTAACTAACTAT - >AA0002_f - ACTCATTTGGACTTAACTTTGATAATAAAAACTTAAAAAGGTTTCTGCACATGAATCG - >AA0002_r - TATGTTGAAAAATTGAATTTCGGGACGAAACAGCGTCTATCGTCACGACATAGTGCTC - >BB0001_f - TGACATTTGTGAACGTTAATGTTCAACAAATCTTTCCAATGTCTTTTTATCTTATCAT - >BB0001_r - TATTGAAATACTGGACACAAATTGGAAATGAAACCTTGTGAGTTATTCAATTTATGTT - >BB0002_f - TGACATTTGTGAACGTTAATGTTCAACAAATCTTTCCAATGTCTTTTTATCTTATCAT - >BB0002_r - TATTGAAATACTGGACACAAATTGGAAATGAAACCTTGTGAGTTATTCAATTTATGTT - - - To prepare quality filtered and interlaced input fasta file from fastq - files, use `Preprocessing of paired-reads`__ tool. - - .. __: tool_runner?tool_id=paired_fastq_filtering - - - **Additional parameters** - - **Sample size** defines how many reads should be used in calculation. - Default setting with 500,000 reads will enable detection of high copy - repeats within several hours of computation time. For higher - sensitivity the sample size can be set higher. Since sample size affects - the memory usage, this parameter may be automatically adjusted to lower - value during the run. Maximum sample size which can be processed depends on - the repetitiveness of analyzed genome. - - - **Select taxon and protein domain database version (REXdb)**. Classification - of transposable elements is based on the similarity to our reference database - of transposable element protein domains (**REXdb**). Standalone database for Viridiplantae species - can be obtained on `repeatexplorer.org`__. Classification - system used in REXdb is described in article `Systematic survey of plant - LTR-retrotransposons elucidates phylogenetic relationships of their - polyprotein domains and provides a reference for element classification`__ - Database for Metazoa species is still under development so use it with caution. - - .. __: http://repeatexplorer.org - .. __: https://doi.org/10.1186/s13100-018-0144-1 - - **Select parameters for protein domain search** REXdb is compared with s - equence clusters either using blastx or diamond aligner. Diamond program - is about three time faster than blastx with word size 3. - - **Similarity search options** By default sequence reads are compared using - mgblast program. Default threshold is explicitly set to 90% sequence - similarity spanning at least 55% of the read length (in the case of reads - differing in length it applies to the longer one). Additionally, sequence - overlap must be at least 55 nt. If you select option for shorter reads - than 100 nt, minimum overlap 55 nt is not required. - - By default, - mgblast search use DUST program to filter out - low-complexity sequences. If you want - to increase sensitivity of detection of satellites with shorter monomer - use option with '*no masking of low complexity repeats*'. Note that omitting - DUST filtering will significantly increase running times - - - **Automatic filtering of abundant satellite repeats** perform clustering on - smaller dataset of sequence reads to detect abundant high confidence - satellite repeats. If such satellites are detected, sequence reads derived - from these satellites are depleted from input dataset. This step enable more - sensitive detection of less abundant repeats as more reads can be used - in clustering step. - - **Use custom repeat database**. This option allows users to perform similarity - comparison of identified repeats to their custom databases. The repeat class must - be encoded in FASTA headers of database entries in order to allow correct - parsing of similarity hits. Required format for custom database sequence name is: :: - - >reapeatname#class/subclass - - - **Output** - - List of clusters identified as putative satellite repeats, their genomic - abundance and various cluster characteristics. - - Output includes a **HTML summary** with table listing of all analyzed - clusters. More detailed information about clusters is provided in - additional files and directories. All results are also provided as - downloadable **zip archive**. Additionally a **log file** reporting - the progress of the computational pipeline is provided. - - </help> - -</tool>
--- a/repex_tarean.xml Thu Apr 30 07:42:45 2020 -0400 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,251 +0,0 @@ -<tool id="tarean" name="Tandem Repeat Analyzer" version="2.3.8" > - <stdio> - <regex match="Traceback" source="stderr" level="fatal" description="Unknown error" /> - <regex match="error" source="stderr" level="fatal" description="Unknown error" /> - <regex match="warning" source="stderr" level="warning" description="Unknown warning" /> - <exit_code range="1:" level="fatal" description="Error" /> - </stdio> - <description>Identification of genomic tandem repeats from NGS data</description> - <requirements> - <requirement type="package">imagemagick</requirement> - <requirement type="package">mafft</requirement> - <requirement type="package">blast</requirement> - <requirement type="package" version="0.9.29">diamond</requirement> - <requirement type="package">blast-legacy</requirement> - <requirement type="package">r-igraph</requirement> - <requirement type="package">r-data.tree</requirement> - <requirement type="package">r-stringr</requirement> - <requirement type="package">r-r2html</requirement> - <requirement type="package">r-hwriter</requirement> - <requirement type="package">r-dt</requirement> - <requirement type="package">r-scales</requirement> - <requirement type="package">r-plotrix</requirement> - <requirement type="package">r-png</requirement> - <requirement type="package">r-plyr</requirement> - <requirement type="package">r-dplyr</requirement> - <requirement type="package">r-optparse</requirement> - <requirement type="package">r-dbi</requirement> - <requirement type="package">r-rsqlite</requirement> - <requirement type="package">r-rserve</requirement> - <requirement type="package">bioconductor-biostrings</requirement> - <requirement type="package" version="2.3.8">repex_tarean_testing</requirement> - <requirement type="set_environment">REPEX</requirement> - <requirement type="set_environment">REPEX_VERSION</requirement> - <requirement type="package" version="0.9.1">pyrserve</requirement> - </requirements> - <command detect_errors="exit_code"> - export PYTHONHASHSEED=0; - \${REPEX}/seqclust --paired --sample ${read_sampling.sample} --output_dir=tarean_output --logfile=${log} --cleanup --tarean_mode - #if $advanced_options.advanced: - --mincl $advanced_options.size_threshold $advanced_options.keep_names $advanced_options.automatic_filtering -M $advanced_options.merging - #if $advanced_options.custom_library.options_custom_library : - -d $advanced_options.custom_library.library extra_database - #end if - #if $advanced_options.options.options: - -opt $advanced_options.options.options - #end if - #else: - -M 0.2 - - #end if - ${FastaFile} >stdout.log 2> stderr.log ; - echo "STDOUT CONTENT:" >> ${log} ; - cat stdout.log >> ${log} ; - echo "STDERR CONTENT:" >> ${log} ; - cat stderr.log >> ${log} && - \${REPEX}/stderr_filter.py stderr.log && - cd tarean_output && - zip -r ${ReportArchive}.zip * && - mv ${ReportArchive}.zip ${ReportArchive} && - cp index.html ${ReportFile} && - mkdir ${ReportFile.files_path} && - cp -r --parents libdir ${ReportFile.files_path} && - cp -r --parents seqclust/clustering/superclusters ${ReportFile.files_path} && - cp -r --parents seqclust/clustering/clusters ${ReportFile.files_path} && - cp seqclust/clustering/hitsort.cls ${ReportFile.files_path}/seqclust/clustering/hitsort.cls && - cp *.png ${ReportFile.files_path}/ && - cp *.csv ${ReportFile.files_path}/ && - cp *.html ${ReportFile.files_path}/ && - cp *.css ${ReportFile.files_path}/ && - cp *.fasta ${ReportFile.files_path}/ 2>>$log && rm -r ../tarean_output || : - - - </command> - - <inputs> - <param name="FastaFile" label="Paired-end Illumina reads" type="data" format="fasta" - help="Input file must contain FASTA-formatted interlaced read pairs from paired-end sequencing. All pairs must be complete. Example of the input data format is provided in the help below."/> - - <conditional name="read_sampling"> - <param name="do_sampling" type="boolean" truevalue="true" falsevalue="false" checked="False" label="Read sampling" help="Use this option if you want to analyze only a part of the reads" /> - <when value="false"> - <!-- pass --> - <param name="sample" label="Sample size" hidden="True" type="integer" value="0" help="Number of analyzed reads"/> - </when> - <when value="true"> - <param name="sample" label="Sample size" type="integer" value="500000" min="10000" help="Number of analyzed reads"/> - </when> - </conditional> - - <conditional name="advanced_options"> - <param name="advanced" type="boolean" truevalue="true" falsevalue="false" checked="False" label="Advanced options" /> - <when value="false"> - <!-- pass --> - </when> - <when value="true"> - <param name="merging" type="boolean" truevalue="0.2" falsevalue="0" checked="True" label="Perform cluster merging" help="By default, clusters connected through paired-end reads are merged"/> - <conditional name="custom_library"> - <param name="options_custom_library" type="boolean" truevalue="true" falsevalue="false" checked="False" label="Use custom repeat database"/> - <when value="false"> - <!-- do nothing here --> - </when> - <when value="true"> - <param name="library" format="fasta" type="data" label="Use custom repeat database" help="Perform additional similarity search to user-provided repeat database. The database should contain FASTA-formatted DNA sequences with headers (sequence names) in the format: '>reapeatname#class/subclass'"/> - </when> - </conditional> - <param name="size_threshold" label="Cluster size threshold for detailed analysis" type="float" value="0.01" min="0.0001" max="100" help ="Minimal size (as percentage of input reads) of the smallest cluster which is analyzed; cluster with less than 20 reads are not considered."/> - <param name="automatic_filtering" label="Perform automatic filtering of abundant satellite repeats" type="boolean" truevalue="--automatic_filtering" falsevalue="" checked="false"/> - <param name="keep_names" label="Keep original read names" type="boolean" truevalue="--keep_names" falsevalue="" checked="false" help="By default, reads are renamed using integers. Use this option if you want to keep original names."/> - <conditional name="options"> - <param name="options" type="select" label="Similarity search options"> - <option value="ILLUMINA" selected="true">Default </option> - <option value="ILLUMINA_DUST_OFF" selected="false">Masking of low complexity repeats disabled </option> - - <option value="ILLUMINA_SENSITIVE_MGBLAST" selected="false">Illumina reads, sensitive search (search parameters: mgblast, min PID 80, -W8) slow, experimental feature!</option> - <option value="ILLUMINA_SENSITIVE_BLASTPLUS" selected="false">Illumina reads, more sensitive search (search parameters: blastn, min PID 80, -W6) extremely slow, experimental feature!</option> - <option value="OXFORD_NANOPORE" selected="false"> - Pseudo short reads simulated from Oxford Nanopore data, experimental feature! - </option> - </param> - </conditional> - </when> - </conditional> - - - - </inputs> - <outputs> - <data name="log" format="txt" label="TAREAN log file"/> - <data name="ReportArchive" format="zip" label="TAREAN Archive with HTML report from data ${FastaFile.hid}"/> - <data name="ReportFile" format="html" label="TAREAN HTML report from data ${FastaFile.hid}"/> - </outputs> - - <help> - **HELP** - - TAREAN - TAndem REpeat ANalyzer is a computational pipeline for - **unsupervised identification of satellite repeats** from unassembled - sequence reads. The pipeline uses low-pass paired-end whole genome - sequence reads and performs graph-based clustering. The resulting - clusters, representing all types of repeats present in the genome, are - then examined to identify those containing circular structures indicative - of tandem repeats. A poster summarizing TAREAN principles and - implementation can be found `here.`__ - - - .. __: http://w3lamc.umbr.cas.cz/lamc/?page_id=312 - - **Input data** - - - The analysis requires **paired-end reads** generated by whole genome - shotgun sequencing. The data should be provided as a single input file in - fasta format with the reads interlaced (see example below). All the pairs - must be complete, i.e. both "forward" and "reverse" sequence reads must be - present. The reads should all be trimmed to the same length. The optimal - size range is between 100 and 200 nucleotides. The number of reads to be - analyzed should not exceed 1x coverage of the genome. Genome coverage - between 0.01 and 0.5x is recommended. The reads should be filtered for - quality. The recommended quality filtering is as follows: each read should - have a quality score >=10 for 95% of the bases, i.e. if your reads are 100 - base pairs long, then a read only passes this quality threshold if 95 - bases have a quality of 10 or higher. Additionally, any reads containing - indeterminate base pairs (indicated as N in the reads) should be removed. - Finally, if either one of the reads in a pair fails to meet the - aforementioned thresholds, **both** sequences should be removed. - example of interlaced input format:: - - >0001_f - CGTAATATACATACTTGCTAGCTAGTTGGATGCATCCAACTTGCAAGCTAGTTTGATG - >0001_r - GATTTGACGGACACACTAACTAGCTAGTTGCATCTAAGCGGGCACACTAACTAACTAT - >0002_f - ACTCATTTGGACTTAACTTTGATAATAAAAACTTAAAAAGGTTTCTGCACATGAATCG - >0002_r - TATGTTGAAAAATTGAATTTCGGGACGAAACAGCGTCTATCGTCACGACATAGTGCTC - >0003_f - TGACATTTGTGAACGTTAATGTTCAACAAATCTTTCCAATGTCTTTTTATCTTATCAT - >0003_r - TATTGAAATACTGGACACAAATTGGAAATGAAACCTTGTGAGTTATTCAATTTATGTT - ... - - - To perform the quality filtering on your fastQ formatted data as described - above, and to interlace your paired-end sequence reads, - please use the `Preprocessing of paired-reads`__ tool. - - .. __: tool_runner?tool_id=paired_fastq_filtering - - - **Additional parameters** - - **Sample size** defines how many reads will be used during the computation. - The default setting of 500,000 reads will enable detection of high copy - number satellites within several hours. For higher - sensitivity the sample size can be increased. Since the sample size affects - memory usage, this parameter may be automatically adjusted to a lower value - during the run. The maximum sample size which can be processed depends on the - repetitiveness of the analyzed genome. This significantly limits the number of reads - that can be analyzed with the TAREAN pipeline. - - **Perform cluster merging**. Families of repetitive elements are - frequently split into multiple clusters rather than being represented as a - single one. If you do not want to merge clusters based on the presence - of broken read pairs, disable this option. - - **Use custom repeat database**. This option allows users to perform similarity - comparison of identified repeats to their custom databases. The repeat class should - be encoded in FASTA headers of database entries in order to allow correct - parsing of similarity hits. - - **Similarity search options** By default sequence reads are compared using - mgblast program. Default threshold is explicitly set to 90% sequence - similarity spanning at least 55% of the read length (in the case of reads - differing in length it applies to the longer one). Additionally, sequence - overlap must be at least 55 nt. If you select option for shorter reads - than 100 nt, minimum overlap 55 nt is not required. - - By default, - mgblast search use DUST program to filter out - low-complexity sequences. If you want - to increase sensitivity of detection of satellites with shorter monomer - use option with '*no masking of low complexity repeats*'. Note that omitting - DUST filtering will significantly increase running times - - **Output** - - A list of clusters identified as putative satellite repeats, their genomic - abundance and various cluster characteristics are provided. Length and - consensus sequences of reconstructed monomers are also shown and - accompanied by a detailed output from kmer-based reconstruction including - sequences and sequence logos of alternative variants of monomer sequences. - - The output includes an **HTML summary** with a table listing all analyzed - clusters. More detailed information about clusters is provided in - additional files and directories. All results are also provided as a - downloadable **zip archive**. Since read clustering results in - thousands of clusters, the search for satellite repeats is limited to - a subset of the largest ones corresponding to the most abundant genomic - repeats. The default setting of the pipeline is to analyze all clusters containing at least - 0.01% of the input reads. Besides the satellite repeats, three other - groups of clusters are reported in the output (1) LTR-retrotransposons, - (2) 45S and 5S rDNA and (3) all remaining clusters passing the size - threshold. As (1) and (2) contain sequences with circular - graphs, their consensus is calculated in the same way as for satellite - repeats. Additionally a **log file** reporting the progress of the - computational pipeline is provided. - - - </help> - -</tool>
--- a/tool_dependencies.xml Thu Apr 30 07:42:45 2020 -0400 +++ b/tool_dependencies.xml Fri Jul 24 07:26:07 2020 -0400 @@ -1,9 +1,28 @@ -<?xml version="1.0" ?> +<?xml version="1.0"?> <tool_dependency> - <package name="repex_tarean_testing" version="2.3.8"> - <repository changeset_revision="31743c5c3fc7" name="package_repex_tarean_testing_2_3_8" owner="petr-novak" prior_installation_required="True" toolshed="https://toolshed.g2.bx.psu.edu"/> - <readme> - prepare repex database and scripts + <package name="repex_tarean_dev" version="2.3.8"> + <install version="1.0"> + <actions> + <action type="download_by_url">https://bitbucket.org/petrnovak/repex_tarean/get/7fa000f91080.zip</action> + <action type="shell_command"> + make + </action> + <action type="move_directory_files"> + <source_directory>$TMP_WORK_DIR/petrnovak-repex_tarean-7fa000f91080</source_directory> + <destination_directory>$INSTALL_DIR</destination_directory> + </action> + + <action type="set_environment"> + <environment_variable action="set_to" name="REPEX">$INSTALL_DIR</environment_variable> + </action> + <action type="set_environment"> + <environment_variable action="set_to" name="REPEX_VERSION">"version: 0.3.8-458(7fa000f) branch: almitey"</environment_variable> + </action> + </actions> + </install> + <readme> + repeatexplorer executables and databases </readme> - </package> -</tool_dependency> \ No newline at end of file + </package> +</tool_dependency> +