Mercurial > repos > pjbriggs > pal_finder
view test-data/illuminaPE_microsats.out @ 1:771ebe02636f draft
Uploaded version 0.02.04.2: fix bug that causes tool to fail when prefix includes spaces; add explicit dependency on Perl 5.16.3.
author | pjbriggs |
---|---|
date | Mon, 23 Mar 2015 07:01:37 -0400 |
parents | 3f908e7fff4f |
children | b6ccc7dd7b02 |
line wrap: on
line source
readPairID Motifs(bases) Bases in all Motifs Possible Extended Possible Spanning Primers found (1=y,0=n) F Primer Name Forward Primer R Primer Name Reverse Primer Amplicon Motifs Number motif bases in amplicon Primers on sep reads Extend with primers Spand with primers Occurances of Forward Primer in Reads Occurances of Reverse Primer in Reads Occurances of Amplifiable Primer Pair in Reads Occurances of Amplifiable Primer Pair in PALs ILLUMINA-545855_0049_FC61RLR:2:1:8044:1926#0 AT(12) 12 0 ILLUMINA-545855_0049_FC61RLR:2:1:1978:1220#0 AC(12) 12 1 test_3 GCAGTAAACAAAGGCAAAGGG test_4 CCTGGGCAGAGGTGTTCC AC(12) 12 1 1 1 1 1 ILLUMINA-545855_0049_FC61RLR:2:1:5879:1238#0 AT(12) 12 0 ILLUMINA-545855_0049_FC61RLR:2:1:8899:1514#0 AC(12) AC(12) 24 1 test_2 TCTTTATCTAAACACATCCTGAAATACC test_1 AAACGCAATTATTTTGAGATGTCC AC(12) AC(12) 24 1 1 2 1 1 ILLUMINA-545855_0049_FC61RLR:2:1:10979:1695#0 TC(14) 14 1 test_7 TTCTCCCACTATATTTTGCATTGG test_8 TCCAGACTGAAGCTACCCTGG TC(14) 14 1 1 1 1 1 ILLUMINA-545855_0049_FC61RLR:2:1:5626:1554#0 AT(14) AC(16) AC(16) AT(12) 58 0 ILLUMINA-545855_0049_FC61RLR:2:1:8157:1636#0 AC(12) 12 1 test_5 AAGTACAGTGGGGAGGCTGG test_6 TTTTCTACACAGCTCAAGTAGCCC AC(12) 12 1 1 1 1 1 ILLUMINA-545855_0049_FC61RLR:2:1:19063:1614#0 AT(14) AT(14) AT(14) AT(14) 56 0 ILLUMINA-545855_0049_FC61RLR:2:1:17449:1584#0 AC(36) 36 0 ILLUMINA-545855_0049_FC61RLR:2:1:6204:1090#0 TC(12) 12 0