view test-data/illuminaPE_microsats.out @ 3:e1a14ed7a9d6 draft

Updated to version 0.02.04.4 (new pal_filter script)
author pjbriggs
date Wed, 24 Feb 2016 08:25:17 -0500
parents b6ccc7dd7b02
children
line wrap: on
line source

readPairID	Motifs(bases)	Bases in all Motifs	Possible Extended	Possible Spanning	Primers found (1=y,0=n)	F Primer Name	Forward Primer	R Primer Name	Reverse Primer	Amplicon Motifs	Number motif bases in amplicon	Primers on sep reads	Extend with primers	Spand with primers	Occurances of Forward Primer in Reads	Occurances of Reverse Primer in Reads	Occurances of Amplifiable Primer Pair in Reads	Occurances of Amplifiable Primer Pair in PALs
ILLUMINA-545855:49:FC61RLR:2:1:10979:1695	TC(14) 	14			1	test_7	TTCTCCCACTATATTTTGCATTGG	test_8	TCCAGACTGAAGCTACCCTGG	TC(14) 	14	1			1	1	1	1
ILLUMINA-545855:49:FC61RLR:2:1:17449:1584	AC(36) 	36			0													
ILLUMINA-545855:49:FC61RLR:2:1:19063:1614	AT(14) AT(14) AT(14) AT(14) 	56			0													
ILLUMINA-545855:49:FC61RLR:2:1:1978:1220	AC(12) 	12			1	test_3	GCAGTAAACAAAGGCAAAGGG	test_4	CCTGGGCAGAGGTGTTCC	AC(12) 	12	1			1	1	1	1
ILLUMINA-545855:49:FC61RLR:2:1:5626:1554	AT(14) AC(16) AC(16) AT(12) 	58			0													
ILLUMINA-545855:49:FC61RLR:2:1:5879:1238	AT(12) 	12			0													
ILLUMINA-545855:49:FC61RLR:2:1:6204:1090	TC(12) 	12			0													
ILLUMINA-545855:49:FC61RLR:2:1:8044:1926	AT(12) 	12			0													
ILLUMINA-545855:49:FC61RLR:2:1:8157:1636	AC(12) 	12			1	test_5	AAGTACAGTGGGGAGGCTGG	test_6	TTTTCTACACAGCTCAAGTAGCCC	AC(12) 	12	1			1	1	1	1
ILLUMINA-545855:49:FC61RLR:2:1:8899:1514	AC(12) AC(12) 	24			1	test_2	TCTTTATCTAAACACATCCTGAAATACC	test_1	AAACGCAATTATTTTGAGATGTCC	AC(12) AC(12) 	24	1			1	2	1	1