Mercurial > repos > pjbriggs > pal_finder
view test-data/illuminaPE_microsats.out @ 3:e1a14ed7a9d6 draft
Updated to version 0.02.04.4 (new pal_filter script)
author | pjbriggs |
---|---|
date | Wed, 24 Feb 2016 08:25:17 -0500 |
parents | b6ccc7dd7b02 |
children |
line wrap: on
line source
readPairID Motifs(bases) Bases in all Motifs Possible Extended Possible Spanning Primers found (1=y,0=n) F Primer Name Forward Primer R Primer Name Reverse Primer Amplicon Motifs Number motif bases in amplicon Primers on sep reads Extend with primers Spand with primers Occurances of Forward Primer in Reads Occurances of Reverse Primer in Reads Occurances of Amplifiable Primer Pair in Reads Occurances of Amplifiable Primer Pair in PALs ILLUMINA-545855:49:FC61RLR:2:1:10979:1695 TC(14) 14 1 test_7 TTCTCCCACTATATTTTGCATTGG test_8 TCCAGACTGAAGCTACCCTGG TC(14) 14 1 1 1 1 1 ILLUMINA-545855:49:FC61RLR:2:1:17449:1584 AC(36) 36 0 ILLUMINA-545855:49:FC61RLR:2:1:19063:1614 AT(14) AT(14) AT(14) AT(14) 56 0 ILLUMINA-545855:49:FC61RLR:2:1:1978:1220 AC(12) 12 1 test_3 GCAGTAAACAAAGGCAAAGGG test_4 CCTGGGCAGAGGTGTTCC AC(12) 12 1 1 1 1 1 ILLUMINA-545855:49:FC61RLR:2:1:5626:1554 AT(14) AC(16) AC(16) AT(12) 58 0 ILLUMINA-545855:49:FC61RLR:2:1:5879:1238 AT(12) 12 0 ILLUMINA-545855:49:FC61RLR:2:1:6204:1090 TC(12) 12 0 ILLUMINA-545855:49:FC61RLR:2:1:8044:1926 AT(12) 12 0 ILLUMINA-545855:49:FC61RLR:2:1:8157:1636 AC(12) 12 1 test_5 AAGTACAGTGGGGAGGCTGG test_6 TTTTCTACACAGCTCAAGTAGCCC AC(12) 12 1 1 1 1 1 ILLUMINA-545855:49:FC61RLR:2:1:8899:1514 AC(12) AC(12) 24 1 test_2 TCTTTATCTAAACACATCCTGAAATACC test_1 AAACGCAATTATTTTGAGATGTCC AC(12) AC(12) 24 1 1 2 1 1