diff genbank_to_fasta.py @ 0:bcdd1a35e545 draft default tip

planemo upload for repository https://github.com/portiahollyoak/Tools commit 132bb96bba8e7aed66a102ed93b7744f36d10d37-dirty

--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/genbank_to_fasta.py	Fri Apr 22 12:09:14 2016 -0400
@@ -0,0 +1,92 @@
+#!/usr/bin/env python
+# coding: utf-8
+
+import argparse
+import doctest  # This will test if the functions are working
+
+
+def get_id(line):
+    """
+    This function reads a line and returns the ID name
+    
+    >>> line = 'ID   TE    standard; DNA; INV; 7411 BP.'
+    >>> 'TE'== get_id(line)
+    True
+    
+    """
+    if line.startswith("ID"):
+        id = line.split("   ")[1] #split line into 'ID' and rest of line, take rest of line and define as id
+        id = id.split(" ")[0] #split id into 'ID name' and rest of line, take ID name and define as id
+        return id
+
+
+def get_seq(line):
+    """
+    This function reads a sequence line from a genbank file
+    and returns a sequence with no spaces or digits
+    
+    >>> line = "AGTGACATAT TCACATACAA AACCACATAA CATAGAGTAA ACATATTGAA AAGCCGCATA        60"
+    >>> 'AGTGACATATTCACATACAAAACCACATAACATAGAGTAAACATATTGAAAAGCCGCATA' == get_seq(line)
+    True
+    
+    """
+    seq = []
+    for char in line:
+        if not char.isdigit() and not char == " ":  # If a character is not a digit or space, 
+                                                    # it will be added to sequence.
+            seq.append(char)
+    seq = "".join(seq)
+    return seq
+
+
+def make_seq_dictionary(input_file_handle):
+    """
+    This function loops over a multi genbank file and returns
+    a collection of ID and corresponding sequence in a dictionary.
+    """
+    seq_d = {}  # dictionary with id as key and sequence as value
+    next_line_is_seq = False
+    for line in input_file_handle:
+        line = line.strip()  # strips any leading or trailing whitespace
+        if line.startswith("ID"):
+            id = get_id(line)
+            seq_d[id]=""  # We just create a new key
+        if line.startswith("SQ"):
+            next_line_is_seq = True  # If line starts with 'SQ' then state is true
+            continue
+        if line.startswith("//"):  # If line starts with '//' then state is false
+            next_line_is_seq = False
+        if next_line_is_seq:  # Whatever has been read as true, this is copied to file
+            seq = get_seq(line)
+            seq_d[id] += seq
+    return seq_d
+
+
+def write_seq_d_to_file(seq_d, output):
+    """
+    This function will write the sequence dictionary to an output file
+    """
+    for transposon, seq in seq_d.items():
+        output.write(">%s\n" % transposon)
+        output.write("%s\n" % seq)
+
+description = ( "This script will extract ID names and sequences from a multigenbank"
+               "file and format them into a multifasta file." )
+
+
+parser = argparse.ArgumentParser(description)
+parser.add_argument("input", help="A multi-genbank file.")
+parser.add_argument("output", help="Name of the output fasta file.")
+args = parser.parse_args()
+
+try:
+    with open(args.input, encoding = "utf-8") as input_file_handle:
+        # This will perform the tasks
+        seq_d = make_seq_dictionary(input_file_handle)
+except TypeError:
+    with open(args.input) as input_file_handle:
+        seq_d = make_seq_dictionary(input_file_handle)
+
+with open(args.output, "w") as output:
+    write_seq_d_to_file(seq_d, output)
+