# HG changeset patch
# User public-health-bioinformatics
# Date 1695146621 0
# Node ID 3e0d5ceeeb0f09e1aeb969fb88cddfda00a8b515
planemo upload for repository https://github.com/public-health-bioinformatics/galaxy_tools/blob/master/tools/tbprofiler_json_to_tabular commit 24535690aedb81353cf5e036dc4577022d9604ad
diff -r 000000000000 -r 3e0d5ceeeb0f tbprofiler_json_to_tabular.py
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/tbprofiler_json_to_tabular.py Tue Sep 19 18:03:41 2023 +0000
@@ -0,0 +1,137 @@
+#!/usr/bin/env python
+
+import argparse
+import csv
+import json
+
+
+def main(args):
+
+ with open(args.input, 'r') as f:
+ report = json.load(f)
+
+ qc_fieldnames = [
+ 'pct_reads_mapped',
+ 'num_reads_mapped',
+ 'median_coverage',
+ ]
+
+ with open(args.qc, 'w') as f:
+ writer = csv.DictWriter(f, fieldnames=qc_fieldnames, dialect='excel-tab', quoting=csv.QUOTE_MINIMAL)
+ writer.writeheader()
+ output = {k: report['qc'][k] for k in qc_fieldnames}
+ writer.writerow(output)
+
+ gene_coverage_fieldnames = [
+ 'locus_tag',
+ 'gene',
+ 'fraction',
+ 'cutoff',
+ ]
+
+ with open(args.gene_coverage, 'w') as f:
+ writer = csv.DictWriter(f, fieldnames=gene_coverage_fieldnames, dialect='excel-tab', quoting=csv.QUOTE_MINIMAL)
+ writer.writeheader()
+ for row in report['qc']['gene_coverage']:
+ writer.writerow(row)
+
+ missing_positions_fieldnames = [
+ 'locus_tag',
+ 'gene',
+ 'position',
+ 'variants',
+ 'drugs'
+ ]
+
+ with open(args.missing_positions, 'w') as f:
+ writer = csv.DictWriter(f, fieldnames=missing_positions_fieldnames, dialect='excel-tab', quoting=csv.QUOTE_MINIMAL)
+ writer.writeheader()
+ for row in report['qc']['missing_positions']:
+ writer.writerow(row)
+
+ resistance_variants_fieldnames = [
+ 'chrom',
+ 'genome_pos',
+ 'locus_tag',
+ 'feature_id',
+ 'gene',
+ 'type',
+ 'ref',
+ 'alt',
+ 'freq',
+ 'nucleotide_change',
+ 'protein_change',
+ 'change',
+ 'drugs',
+ ]
+
+ with open(args.resistance_variants, 'w') as f:
+ writer = csv.DictWriter(f, fieldnames=resistance_variants_fieldnames, dialect='excel-tab', quoting=csv.QUOTE_MINIMAL)
+ writer.writeheader()
+ for row in report['dr_variants']:
+ row['drugs'] = ', '.join([drug['drug'] + ':' + drug['confers'] for drug in row['drugs']])
+ output = {k: row[k] for k in resistance_variants_fieldnames}
+ writer.writerow(output)
+
+ other_variants_fieldnames = [
+ 'chrom',
+ 'genome_pos',
+ 'locus_tag',
+ 'feature_id',
+ 'gene',
+ 'type',
+ 'ref',
+ 'alt',
+ 'freq',
+ 'nucleotide_change',
+ 'protein_change',
+ 'change',
+ 'gene_associated_drugs',
+ ]
+
+ with open(args.other_variants, 'w') as f:
+ writer = csv.DictWriter(f, fieldnames=other_variants_fieldnames, dialect='excel-tab', quoting=csv.QUOTE_MINIMAL)
+ writer.writeheader()
+ for row in report['other_variants']:
+ row['gene_associated_drugs'] = ', '.join(row['gene_associated_drugs'])
+ output = {k: row[k] for k in other_variants_fieldnames}
+ writer.writerow(output)
+
+ analysis_metadata_fieldnames = [
+ 'timestamp',
+ 'tbprofiler_version',
+ 'mapping_program',
+ 'variant_calling_program',
+ 'db_name',
+ 'db_commit',
+ 'db_date',
+ ]
+
+ with open(args.analysis_metadata, 'w') as f:
+ writer = csv.DictWriter(f, fieldnames=analysis_metadata_fieldnames, dialect='excel-tab', quoting=csv.QUOTE_MINIMAL)
+ writer.writeheader()
+ output = {}
+ output['timestamp'] = report['timestamp']
+ output['tbprofiler_version'] = report['tbprofiler_version']
+ output['db_name'] = report['db_version']['name']
+ output['db_commit'] = report['db_version']['commit']
+ output['db_date'] = report['db_version']['Date']
+ for pipeline_entry in report['pipeline']:
+ if pipeline_entry['Analysis'] == "Mapping":
+ output['mapping_program'] = pipeline_entry['Program']
+ elif pipeline_entry['Analysis'] == "Variant calling":
+ output['variant_calling_program'] = pipeline_entry['Program']
+
+ writer.writerow(output)
+
+if __name__ == '__main__':
+ parser = argparse.ArgumentParser()
+ parser.add_argument('input')
+ parser.add_argument('--qc')
+ parser.add_argument('--gene-coverage')
+ parser.add_argument('--missing-positions')
+ parser.add_argument('--resistance-variants')
+ parser.add_argument('--other-variants')
+ parser.add_argument('--analysis-metadata')
+ args = parser.parse_args()
+ main(args)
diff -r 000000000000 -r 3e0d5ceeeb0f tbprofiler_json_to_tabular.xml
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/tbprofiler_json_to_tabular.xml Tue Sep 19 18:03:41 2023 +0000
@@ -0,0 +1,41 @@
+
+ Convert tbprofiler json report to tabular
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
diff -r 000000000000 -r 3e0d5ceeeb0f test-data/test-01_analysis_metadata.tsv
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/test-01_analysis_metadata.tsv Tue Sep 19 18:03:41 2023 +0000
@@ -0,0 +1,2 @@
+timestamp tbprofiler_version mapping_program variant_calling_program db_name db_commit db_date
+22-10-2022 01:09:50 4.1.1 bwa freebayes tbdb 7fc199d Tue Jan 25 17:21:48 2022 +0000
diff -r 000000000000 -r 3e0d5ceeeb0f test-data/test-01_gene_coverage.csv
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/test-01_gene_coverage.csv Tue Sep 19 18:03:41 2023 +0000
@@ -0,0 +1,43 @@
+locus_tag gene fraction cutoff
+Rv0005 gyrB 0.0 0
+Rv0006 gyrA 0.0 0
+Rv0407 fgd1 0.0 0
+Rv0486 mshA 0.0 0
+Rv0667 rpoB 0.0 0
+Rv0668 rpoC 0.0 0
+Rv0678 mmpR5 0.0 0
+Rv0682 rpsL 0.0 0
+Rv0701 rplC 0.0 0
+Rv1173 fbiC 0.0 0
+Rv1267c embR 0.0 0
+Rv1305 atpE 0.0 0
+EBG00000313325 rrs 0.0 0
+EBG00000313339 rrl 0.0 0
+Rv1483 fabG1 0.0 0
+Rv1484 inhA 0.0 0
+Rv1630 rpsA 0.0 0
+Rv1694 tlyA 0.0 0
+Rv1908c katG 0.0 0
+Rv2043c pncA 0.0 0
+Rv2245 kasA 0.0 0
+Rv2416c eis 0.0 0
+Rv2428 ahpC 0.0 0
+Rv2447c folC 0.0 0
+Rv2535c pepQ 0.0 0
+Rv2671 ribD 0.0 0
+Rv2754c thyX 0.0 0
+Rv2764c thyA 0.0 0
+Rv2780 ald 0.0 0
+Rv2983 fbiD 0.0 0
+Rv3261 fbiA 0.0 0
+Rv3262 fbiB 0.0 0
+Rv3423c alr 0.0 0
+Rv3547 ddn 0.0 0
+Rv3601c panD 0.0 0
+Rv3793 embC 0.0 0
+Rv3794 embA 0.0 0
+Rv3795 embB 0.0 0
+Rv3806c ubiA 0.0 0
+Rv3854c ethA 0.0 0
+Rv3855 ethR 0.0 0
+Rv3919c gid 0.0 0
diff -r 000000000000 -r 3e0d5ceeeb0f test-data/test-01_missing_positions.tsv
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/test-01_missing_positions.tsv Tue Sep 19 18:03:41 2023 +0000
@@ -0,0 +1,1 @@
+locus_tag gene position variants drugs
diff -r 000000000000 -r 3e0d5ceeeb0f test-data/test-01_other_variants.tsv
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/test-01_other_variants.tsv Tue Sep 19 18:03:41 2023 +0000
@@ -0,0 +1,14 @@
+chrom genome_pos locus_tag feature_id gene type ref alt freq nucleotide_change protein_change change gene_associated_drugs
+Chromosome 7362 Rv0006 CCP42728 gyrA missense_variant G C 1.0 c.61G>C p.Glu21Gln p.Glu21Gln levofloxacin, ciprofloxacin, ofloxacin, moxifloxacin, fluoroquinolones
+Chromosome 7585 Rv0006 CCP42728 gyrA missense_variant G C 1.0 c.284G>C p.Ser95Thr p.Ser95Thr levofloxacin, ciprofloxacin, ofloxacin, moxifloxacin, fluoroquinolones
+Chromosome 7892 Rv0006 CCP42728 gyrA synonymous_variant G A 1.0 c.591G>A p.Leu197Leu c.591G>A levofloxacin, ciprofloxacin, ofloxacin, moxifloxacin, fluoroquinolones
+Chromosome 9304 Rv0006 CCP42728 gyrA missense_variant G A 1.0 c.2003G>A p.Gly668Asp p.Gly668Asp levofloxacin, ciprofloxacin, ofloxacin, moxifloxacin, fluoroquinolones
+Chromosome 766789 Rv0668 CCP43411 rpoC synonymous_variant G A 1.0 c.3420G>A p.Glu1140Glu c.3420G>A rifampicin
+Chromosome 781395 Rv0682 CCP43425 rpsL upstream_gene_variant T C 1.0 c.-165T>C c.-165T>C streptomycin
+Chromosome 1305494 Rv1173 CCP43929 fbiC frameshift_variant&stop_lost&splice_region_variant CGGCCTAGCCCCGGCGACGATGCCGGGTCGCGGGATGCGGCCCGTTGAGGAGCGGGGCAATCT C 0.21739130434782608 c.2565_*55delGGCCTAGCCCCGGCGACGATGCCGGGTCGCGGGATGCGGCCCGTTGAGGAGCGGGGCAATCT p.Ala855fs c.2565_*55delGGCCTAGCCCCGGCGACGATGCCGGGTCGCGGGATGCGGCCCGTTGAGGAGCGGGGCAATCT delamanid
+Chromosome 1460976 Rv1305 CCP44062 atpE upstream_gene_variant C T 1.0 c.-69C>T c.-69C>T bedaquiline
+Chromosome 1471659 EBG00000313325 EBG00000313325-1 rrs upstream_gene_variant C T 1.0 n.-187C>T n.-187C>T aminoglycosides, streptomycin, amikacin, capreomycin, kanamycin
+Chromosome 1917972 Rv1694 CCP44459 tlyA synonymous_variant A G 1.0 c.33A>G p.Leu11Leu c.33A>G capreomycin
+Chromosome 3073868 Rv2764c CCP45563 thyA missense_variant T C 1.0 c.604A>G p.Thr202Ala p.Thr202Ala para-aminosalicylic_acid
+Chromosome 4242643 Rv3794 CCP46623 embA upstream_gene_variant C T 1.0 c.-590C>T c.-590C>T ethambutol
+Chromosome 1305494 Rv1173 CCP43929 fbiC frameshift_variant&stop_lost&splice_region_variant C 1.0 c.2565_*56delCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN p.Ala855fs c.2565_*56delCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN delamanid
diff -r 000000000000 -r 3e0d5ceeeb0f test-data/test-01_qc.tsv
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/test-01_qc.tsv Tue Sep 19 18:03:41 2023 +0000
@@ -0,0 +1,2 @@
+pct_reads_mapped num_reads_mapped median_coverage
+99.47 1731409 84
diff -r 000000000000 -r 3e0d5ceeeb0f test-data/test-01_resistance_variants.tsv
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/test-01_resistance_variants.tsv Tue Sep 19 18:03:41 2023 +0000
@@ -0,0 +1,3 @@
+chrom genome_pos locus_tag feature_id gene type ref alt freq nucleotide_change protein_change change drugs
+Chromosome 761155 Rv0667 CCP43410 rpoB missense_variant C T 1.0 c.1349C>T p.Ser450Leu p.Ser450Leu rifampicin:resistance
+Chromosome 1674048 Rv1484 CCP44244 inhA upstream_gene_variant G A 1.0 c.-154G>A c.-154G>A isoniazid:resistance, ethionamide:resistance
diff -r 000000000000 -r 3e0d5ceeeb0f test-data/test-01_tbprofiler.json
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/test-01_tbprofiler.json Tue Sep 19 18:03:41 2023 +0000
@@ -0,0 +1,635 @@
+{
+ "qc": {
+ "pct_reads_mapped": 99.47,
+ "num_reads_mapped": 1731409,
+ "median_coverage": 84,
+ "gene_coverage": [
+ {
+ "fraction": 0.0,
+ "cutoff": 0,
+ "locus_tag": "Rv0005",
+ "gene": "gyrB"
+ },
+ {
+ "fraction": 0.0,
+ "cutoff": 0,
+ "locus_tag": "Rv0006",
+ "gene": "gyrA"
+ },
+ {
+ "fraction": 0.0,
+ "cutoff": 0,
+ "locus_tag": "Rv0407",
+ "gene": "fgd1"
+ },
+ {
+ "fraction": 0.0,
+ "cutoff": 0,
+ "locus_tag": "Rv0486",
+ "gene": "mshA"
+ },
+ {
+ "fraction": 0.0,
+ "cutoff": 0,
+ "locus_tag": "Rv0667",
+ "gene": "rpoB"
+ },
+ {
+ "fraction": 0.0,
+ "cutoff": 0,
+ "locus_tag": "Rv0668",
+ "gene": "rpoC"
+ },
+ {
+ "fraction": 0.0,
+ "cutoff": 0,
+ "locus_tag": "Rv0678",
+ "gene": "mmpR5"
+ },
+ {
+ "fraction": 0.0,
+ "cutoff": 0,
+ "locus_tag": "Rv0682",
+ "gene": "rpsL"
+ },
+ {
+ "fraction": 0.0,
+ "cutoff": 0,
+ "locus_tag": "Rv0701",
+ "gene": "rplC"
+ },
+ {
+ "fraction": 0.0,
+ "cutoff": 0,
+ "locus_tag": "Rv1173",
+ "gene": "fbiC"
+ },
+ {
+ "fraction": 0.0,
+ "cutoff": 0,
+ "locus_tag": "Rv1267c",
+ "gene": "embR"
+ },
+ {
+ "fraction": 0.0,
+ "cutoff": 0,
+ "locus_tag": "Rv1305",
+ "gene": "atpE"
+ },
+ {
+ "fraction": 0.0,
+ "cutoff": 0,
+ "locus_tag": "EBG00000313325",
+ "gene": "rrs"
+ },
+ {
+ "fraction": 0.0,
+ "cutoff": 0,
+ "locus_tag": "EBG00000313339",
+ "gene": "rrl"
+ },
+ {
+ "fraction": 0.0,
+ "cutoff": 0,
+ "locus_tag": "Rv1483",
+ "gene": "fabG1"
+ },
+ {
+ "fraction": 0.0,
+ "cutoff": 0,
+ "locus_tag": "Rv1484",
+ "gene": "inhA"
+ },
+ {
+ "fraction": 0.0,
+ "cutoff": 0,
+ "locus_tag": "Rv1630",
+ "gene": "rpsA"
+ },
+ {
+ "fraction": 0.0,
+ "cutoff": 0,
+ "locus_tag": "Rv1694",
+ "gene": "tlyA"
+ },
+ {
+ "fraction": 0.0,
+ "cutoff": 0,
+ "locus_tag": "Rv1908c",
+ "gene": "katG"
+ },
+ {
+ "fraction": 0.0,
+ "cutoff": 0,
+ "locus_tag": "Rv2043c",
+ "gene": "pncA"
+ },
+ {
+ "fraction": 0.0,
+ "cutoff": 0,
+ "locus_tag": "Rv2245",
+ "gene": "kasA"
+ },
+ {
+ "fraction": 0.0,
+ "cutoff": 0,
+ "locus_tag": "Rv2416c",
+ "gene": "eis"
+ },
+ {
+ "fraction": 0.0,
+ "cutoff": 0,
+ "locus_tag": "Rv2428",
+ "gene": "ahpC"
+ },
+ {
+ "fraction": 0.0,
+ "cutoff": 0,
+ "locus_tag": "Rv2447c",
+ "gene": "folC"
+ },
+ {
+ "fraction": 0.0,
+ "cutoff": 0,
+ "locus_tag": "Rv2535c",
+ "gene": "pepQ"
+ },
+ {
+ "fraction": 0.0,
+ "cutoff": 0,
+ "locus_tag": "Rv2671",
+ "gene": "ribD"
+ },
+ {
+ "fraction": 0.0,
+ "cutoff": 0,
+ "locus_tag": "Rv2754c",
+ "gene": "thyX"
+ },
+ {
+ "fraction": 0.0,
+ "cutoff": 0,
+ "locus_tag": "Rv2764c",
+ "gene": "thyA"
+ },
+ {
+ "fraction": 0.0,
+ "cutoff": 0,
+ "locus_tag": "Rv2780",
+ "gene": "ald"
+ },
+ {
+ "fraction": 0.0,
+ "cutoff": 0,
+ "locus_tag": "Rv2983",
+ "gene": "fbiD"
+ },
+ {
+ "fraction": 0.0,
+ "cutoff": 0,
+ "locus_tag": "Rv3261",
+ "gene": "fbiA"
+ },
+ {
+ "fraction": 0.0,
+ "cutoff": 0,
+ "locus_tag": "Rv3262",
+ "gene": "fbiB"
+ },
+ {
+ "fraction": 0.0,
+ "cutoff": 0,
+ "locus_tag": "Rv3423c",
+ "gene": "alr"
+ },
+ {
+ "fraction": 0.0,
+ "cutoff": 0,
+ "locus_tag": "Rv3547",
+ "gene": "ddn"
+ },
+ {
+ "fraction": 0.0,
+ "cutoff": 0,
+ "locus_tag": "Rv3601c",
+ "gene": "panD"
+ },
+ {
+ "fraction": 0.0,
+ "cutoff": 0,
+ "locus_tag": "Rv3793",
+ "gene": "embC"
+ },
+ {
+ "fraction": 0.0,
+ "cutoff": 0,
+ "locus_tag": "Rv3794",
+ "gene": "embA"
+ },
+ {
+ "fraction": 0.0,
+ "cutoff": 0,
+ "locus_tag": "Rv3795",
+ "gene": "embB"
+ },
+ {
+ "fraction": 0.0,
+ "cutoff": 0,
+ "locus_tag": "Rv3806c",
+ "gene": "ubiA"
+ },
+ {
+ "fraction": 0.0,
+ "cutoff": 0,
+ "locus_tag": "Rv3854c",
+ "gene": "ethA"
+ },
+ {
+ "fraction": 0.0,
+ "cutoff": 0,
+ "locus_tag": "Rv3855",
+ "gene": "ethR"
+ },
+ {
+ "fraction": 0.0,
+ "cutoff": 0,
+ "locus_tag": "Rv3919c",
+ "gene": "gid"
+ }
+ ],
+ "missing_positions": []
+ },
+ "delly": "success",
+ "lineage": [
+ {
+ "lin": "lineage4",
+ "family": "Euro-American",
+ "spoligotype": "LAM;T;S;X;H",
+ "rd": "None",
+ "frac": 1.0
+ },
+ {
+ "lin": "lineage4.5",
+ "family": "Euro-American",
+ "spoligotype": "H;T",
+ "rd": "RD122",
+ "frac": 1.0
+ }
+ ],
+ "main_lin": "lineage4",
+ "sublin": "lineage4.5",
+ "dr_variants": [
+ {
+ "chrom": "Chromosome",
+ "genome_pos": 761155,
+ "ref": "C",
+ "alt": "T",
+ "freq": 1.0,
+ "feature_id": "CCP43410",
+ "type": "missense_variant",
+ "nucleotide_change": "c.1349C>T",
+ "protein_change": "p.Ser450Leu",
+ "annotation": [
+ {
+ "type": "resistance_association_confidence",
+ "drug": "rifampicin",
+ "confidence": "high"
+ }
+ ],
+ "alternate_consequences": [],
+ "change": "p.Ser450Leu",
+ "locus_tag": "Rv0667",
+ "gene": "rpoB",
+ "drugs": [
+ {
+ "type": "drug",
+ "drug": "rifampicin",
+ "confers": "resistance",
+ "literature": "10.1128/AAC.01093-18"
+ }
+ ]
+ },
+ {
+ "chrom": "Chromosome",
+ "genome_pos": 1674048,
+ "ref": "G",
+ "alt": "A",
+ "freq": 1.0,
+ "feature_id": "CCP44244",
+ "type": "upstream_gene_variant",
+ "nucleotide_change": "c.-154G>A",
+ "protein_change": "",
+ "annotation": [],
+ "alternate_consequences": [],
+ "change": "c.-154G>A",
+ "locus_tag": "Rv1484",
+ "gene": "inhA",
+ "drugs": [
+ {
+ "type": "drug",
+ "drug": "isoniazid",
+ "confers": "resistance",
+ "literature": "https://www.who.int/publications/i/item/9789240028173"
+ },
+ {
+ "type": "drug",
+ "drug": "ethionamide",
+ "confers": "resistance",
+ "literature": "https://www.who.int/publications/i/item/9789240028173"
+ }
+ ]
+ }
+ ],
+ "other_variants": [
+ {
+ "chrom": "Chromosome",
+ "genome_pos": 7362,
+ "ref": "G",
+ "alt": "C",
+ "freq": 1.0,
+ "feature_id": "CCP42728",
+ "type": "missense_variant",
+ "nucleotide_change": "c.61G>C",
+ "protein_change": "p.Glu21Gln",
+ "alternate_consequences": [],
+ "change": "p.Glu21Gln",
+ "locus_tag": "Rv0006",
+ "gene": "gyrA",
+ "gene_associated_drugs": [
+ "levofloxacin",
+ "ciprofloxacin",
+ "ofloxacin",
+ "moxifloxacin",
+ "fluoroquinolones"
+ ]
+ },
+ {
+ "chrom": "Chromosome",
+ "genome_pos": 7585,
+ "ref": "G",
+ "alt": "C",
+ "freq": 1.0,
+ "feature_id": "CCP42728",
+ "type": "missense_variant",
+ "nucleotide_change": "c.284G>C",
+ "protein_change": "p.Ser95Thr",
+ "annotation": [
+ {
+ "type": "phylogenetic_mutation",
+ "lineage": "lineage4"
+ }
+ ],
+ "alternate_consequences": [],
+ "change": "p.Ser95Thr",
+ "locus_tag": "Rv0006",
+ "gene": "gyrA",
+ "gene_associated_drugs": [
+ "levofloxacin",
+ "ciprofloxacin",
+ "ofloxacin",
+ "moxifloxacin",
+ "fluoroquinolones"
+ ]
+ },
+ {
+ "chrom": "Chromosome",
+ "genome_pos": 7892,
+ "ref": "G",
+ "alt": "A",
+ "freq": 1.0,
+ "feature_id": "CCP42728",
+ "type": "synonymous_variant",
+ "nucleotide_change": "c.591G>A",
+ "protein_change": "p.Leu197Leu",
+ "alternate_consequences": [],
+ "change": "c.591G>A",
+ "locus_tag": "Rv0006",
+ "gene": "gyrA",
+ "gene_associated_drugs": [
+ "levofloxacin",
+ "ciprofloxacin",
+ "ofloxacin",
+ "moxifloxacin",
+ "fluoroquinolones"
+ ]
+ },
+ {
+ "chrom": "Chromosome",
+ "genome_pos": 9304,
+ "ref": "G",
+ "alt": "A",
+ "freq": 1.0,
+ "feature_id": "CCP42728",
+ "type": "missense_variant",
+ "nucleotide_change": "c.2003G>A",
+ "protein_change": "p.Gly668Asp",
+ "alternate_consequences": [],
+ "change": "p.Gly668Asp",
+ "locus_tag": "Rv0006",
+ "gene": "gyrA",
+ "gene_associated_drugs": [
+ "levofloxacin",
+ "ciprofloxacin",
+ "ofloxacin",
+ "moxifloxacin",
+ "fluoroquinolones"
+ ]
+ },
+ {
+ "chrom": "Chromosome",
+ "genome_pos": 766789,
+ "ref": "G",
+ "alt": "A",
+ "freq": 1.0,
+ "feature_id": "CCP43411",
+ "type": "synonymous_variant",
+ "nucleotide_change": "c.3420G>A",
+ "protein_change": "p.Glu1140Glu",
+ "alternate_consequences": [],
+ "change": "c.3420G>A",
+ "locus_tag": "Rv0668",
+ "gene": "rpoC",
+ "gene_associated_drugs": [
+ "rifampicin"
+ ]
+ },
+ {
+ "chrom": "Chromosome",
+ "genome_pos": 781395,
+ "ref": "T",
+ "alt": "C",
+ "freq": 1.0,
+ "feature_id": "CCP43425",
+ "type": "upstream_gene_variant",
+ "nucleotide_change": "c.-165T>C",
+ "protein_change": "",
+ "alternate_consequences": [],
+ "change": "c.-165T>C",
+ "locus_tag": "Rv0682",
+ "gene": "rpsL",
+ "gene_associated_drugs": [
+ "streptomycin"
+ ]
+ },
+ {
+ "chrom": "Chromosome",
+ "genome_pos": 1305494,
+ "ref": "CGGCCTAGCCCCGGCGACGATGCCGGGTCGCGGGATGCGGCCCGTTGAGGAGCGGGGCAATCT",
+ "alt": "C",
+ "freq": 0.21739130434782608,
+ "feature_id": "CCP43929",
+ "type": "frameshift_variant&stop_lost&splice_region_variant",
+ "nucleotide_change": "c.2565_*55delGGCCTAGCCCCGGCGACGATGCCGGGTCGCGGGATGCGGCCCGTTGAGGAGCGGGGCAATCT",
+ "protein_change": "p.Ala855fs",
+ "alternate_consequences": [],
+ "change": "c.2565_*55delGGCCTAGCCCCGGCGACGATGCCGGGTCGCGGGATGCGGCCCGTTGAGGAGCGGGGCAATCT",
+ "locus_tag": "Rv1173",
+ "gene": "fbiC",
+ "gene_associated_drugs": [
+ "delamanid"
+ ]
+ },
+ {
+ "chrom": "Chromosome",
+ "genome_pos": 1460976,
+ "ref": "C",
+ "alt": "T",
+ "freq": 1.0,
+ "feature_id": "CCP44062",
+ "type": "upstream_gene_variant",
+ "nucleotide_change": "c.-69C>T",
+ "protein_change": "",
+ "alternate_consequences": [],
+ "change": "c.-69C>T",
+ "locus_tag": "Rv1305",
+ "gene": "atpE",
+ "gene_associated_drugs": [
+ "bedaquiline"
+ ]
+ },
+ {
+ "chrom": "Chromosome",
+ "genome_pos": 1471659,
+ "ref": "C",
+ "alt": "T",
+ "freq": 1.0,
+ "feature_id": "EBG00000313325-1",
+ "type": "upstream_gene_variant",
+ "nucleotide_change": "n.-187C>T",
+ "protein_change": "",
+ "alternate_consequences": [],
+ "change": "n.-187C>T",
+ "locus_tag": "EBG00000313325",
+ "gene": "rrs",
+ "gene_associated_drugs": [
+ "aminoglycosides",
+ "streptomycin",
+ "amikacin",
+ "capreomycin",
+ "kanamycin"
+ ]
+ },
+ {
+ "chrom": "Chromosome",
+ "genome_pos": 1917972,
+ "ref": "A",
+ "alt": "G",
+ "freq": 1.0,
+ "feature_id": "CCP44459",
+ "type": "synonymous_variant",
+ "nucleotide_change": "c.33A>G",
+ "protein_change": "p.Leu11Leu",
+ "alternate_consequences": [],
+ "change": "c.33A>G",
+ "locus_tag": "Rv1694",
+ "gene": "tlyA",
+ "gene_associated_drugs": [
+ "capreomycin"
+ ]
+ },
+ {
+ "chrom": "Chromosome",
+ "genome_pos": 3073868,
+ "ref": "T",
+ "alt": "C",
+ "freq": 1.0,
+ "feature_id": "CCP45563",
+ "type": "missense_variant",
+ "nucleotide_change": "c.604A>G",
+ "protein_change": "p.Thr202Ala",
+ "alternate_consequences": [],
+ "change": "p.Thr202Ala",
+ "locus_tag": "Rv2764c",
+ "gene": "thyA",
+ "gene_associated_drugs": [
+ "para-aminosalicylic_acid"
+ ]
+ },
+ {
+ "chrom": "Chromosome",
+ "genome_pos": 4242643,
+ "ref": "C",
+ "alt": "T",
+ "freq": 1.0,
+ "feature_id": "CCP46623",
+ "type": "upstream_gene_variant",
+ "nucleotide_change": "c.-590C>T",
+ "protein_change": "",
+ "alternate_consequences": [
+ {
+ "gene_name": "embC",
+ "gene_id": "Rv3793",
+ "feature_id": "CCP46622",
+ "type": "synonymous_variant",
+ "nucleotide_change": "c.2781C>T",
+ "protein_change": "p.Arg927Arg"
+ }
+ ],
+ "change": "c.-590C>T",
+ "locus_tag": "Rv3794",
+ "gene": "embA",
+ "gene_associated_drugs": [
+ "ethambutol"
+ ]
+ },
+ {
+ "chrom": "Chromosome",
+ "genome_pos": 1305494,
+ "ref": "C",
+ "alt": "",
+ "freq": 1.0,
+ "feature_id": "CCP43929",
+ "type": "frameshift_variant&stop_lost&splice_region_variant",
+ "nucleotide_change": "c.2565_*56delCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN",
+ "protein_change": "p.Ala855fs",
+ "alternate_consequences": [],
+ "change": "c.2565_*56delCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN",
+ "locus_tag": "Rv1173",
+ "gene": "fbiC",
+ "gene_associated_drugs": [
+ "delamanid"
+ ]
+ }
+ ],
+ "drtype": "MDR-TB",
+ "db_version": {
+ "name": "tbdb",
+ "commit": "7fc199d",
+ "Merge": "bad550a 277d053",
+ "Author": "Jody Phelan ",
+ "Date": "Tue Jan 25 17:21:48 2022 +0000"
+ },
+ "id": "tbprofiler",
+ "tbprofiler_version": "4.1.1",
+ "pipeline": [
+ {
+ "Analysis": "Mapping",
+ "Program": "bwa"
+ },
+ {
+ "Analysis": "Variant calling",
+ "Program": "freebayes"
+ }
+ ],
+ "timestamp": "22-10-2022 01:09:50"
+}