diff test-data/example1_ss.ps @ 0:76d9140e8fa5 draft

Imported from capsule None

--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/example1_ss.ps	Fri Feb 13 05:33:32 2015 -0500
@@ -0,0 +1,680 @@
+%!PS-Adobe-3.0 EPSF-3.0
+%%Creator: PS_dot.c,v 1.38 2007/02/02 15:18:13 ivo Exp $, ViennaRNA-2.0.4
+%%CreationDate: Mon Jan 12 21:39:30 2015
+%%Title: RNA Secondary Structure Plot
+%%BoundingBox: 66 210 518 662
+%%DocumentFonts: Helvetica
+%%Pages: 1
+%%EndComments
+
+%Options: -d2 
+% to switch off outline pairs of sequence comment or
+% delete the appropriate line near the end of the file
+
+%%BeginProlog
+/RNAplot 100 dict def
+RNAplot begin
+/fsize  14 def
+/outlinecolor {0.2 setgray} bind def
+/paircolor    {0.2 setgray} bind def
+/seqcolor     {0   setgray} bind def
+/cshow  { dup stringwidth pop -2 div fsize -3 div rmoveto show} bind def
+/min { 2 copy gt { exch } if pop } bind def
+/max { 2 copy lt { exch } if pop } bind def
+/arccoords { % i j arccoords
+  % puts optimal x1 y1 x2 y2 coordinates used in bezier curves from i to j
+  % onto the stack
+  dup 3 -1 roll dup 4 -1 roll lt dup dup 5 2 roll {exch} if
+  dup 3 -1 roll dup 3 -1 roll exch sub 1 sub dup
+  4 -2 roll 5 -1 roll {exch} if 4 2 roll
+  sequence length dup 2 div exch 3 1 roll lt 
+  {exch 5 -1 roll pop 4 -2 roll exch 4 2 roll}
+  { 4 2 roll 5 -1 roll dup 6 1 roll {exch} if
+    4 -2 roll exch pop dup 3 -1 roll dup 4 1 roll
+    exch add 4 -1 roll dup 5 1 roll sub 1 sub
+    5 -1 roll not {4 -2 roll exch 4 2 roll} if
+  }ifelse
+   % compute the scalingfactor and prepare (1-sf) and sf*r
+  2 mul exch cpr 3 1 roll div dup
+  3 -1 roll mul exch 1 exch sub exch
+   % compute the coordinates
+  3 -1 roll 1 sub coor exch get aload pop % get coord for i
+  4 -1 roll dup 5 1 roll mul 3 -1 roll dup 4 1 roll add exch % calculate y1
+  4 -1 roll dup 5 1 roll mul 3 -1 roll dup 4 1 roll add exch % calculate x1
+  5 -1 roll 1 sub coor exch get aload pop % get coord for j
+  % duplicate j coord
+  dup 3 -1 roll dup 4 1 roll exch 8 2 roll
+  6 -1 roll dup 7 1 roll mul 5 -1 roll dup 6 1 roll add exch % calculate y2
+  6 -1 roll mul 5 -1 roll add exch % calculate x2
+  6 -2 roll % reorder
+} bind def
+/drawoutline {
+  gsave outlinecolor newpath
+  coor 0 get aload pop 0.8 0 360 arc % draw 5' circle of 1st sequence
+  currentdict /cutpoint known        % check if cutpoint is defined
+  {coor 0 cutpoint getinterval
+   {aload pop lineto} forall         % draw outline of 1st sequence
+   coor cutpoint 1 add get aload pop
+   2 copy moveto 0.8 0 360 arc       % draw 5' circle of 2nd sequence
+   coor cutpoint 1 add coor length cutpoint 1 add sub getinterval
+   {aload pop lineto} forall}        % draw outline of 2nd sequence
+  {coor {aload pop lineto} forall}   % draw outline as a whole
+  ifelse
+  stroke grestore
+} bind def
+/drawpairs {
+  paircolor
+  0.7 setlinewidth
+  [9 3.01] 9 setdash
+  newpath
+  pairs {aload pop
+      currentdict (cpr) known
+      { exch dup
+        coor  exch 1 sub get aload pop moveto
+        exch arccoords curveto
+      }
+      { coor exch 1 sub get aload pop moveto
+        coor exch 1 sub get aload pop lineto
+      }ifelse
+  } forall
+  stroke
+} bind def
+% draw bases
+/drawbases {
+  [] 0 setdash
+  seqcolor
+  0
+  coor {
+    aload pop moveto
+    dup sequence exch 1 getinterval cshow
+    1 add
+  } forall
+  pop
+} bind def
+
+/init {
+  /Helvetica findfont fsize scalefont setfont
+  1 setlinejoin
+  1 setlinecap
+  0.8 setlinewidth
+  72 216 translate
+  % find the coordinate range
+  /xmax -1000 def /xmin 10000 def
+  /ymax -1000 def /ymin 10000 def
+  coor {
+      aload pop
+      dup ymin lt {dup /ymin exch def} if
+      dup ymax gt {/ymax exch def} {pop} ifelse
+      dup xmin lt {dup /xmin exch def} if
+      dup xmax gt {/xmax exch def} {pop} ifelse
+  } forall
+  /size {xmax xmin sub ymax ymin sub max} bind def
+  72 6 mul size div dup scale
+  size xmin sub xmax sub 2 div size ymin sub ymax sub 2 div
+  translate
+} bind def
+end
+%%EndProlog
+RNAplot begin
+% data start here
+/sequence (\
+AUGCAGGAAAUGCGGGUAGCCGCUGCCGCAAUCGUCUCGGCGAUUGGCGGUAGAGGAAAGUCCAGGCUCGCCCAAGCUGAGAUGCUUGGAGUGUUCGUACCUGGCGCAAGCCAGGGCAAGUGAGGCGCAAGCCUCGCUGACGGCGUGGAAAGGGCUCUCUCUGAGGCCCGAGUACGCUGAAAGUGCCACAGAAACGUAGCUUUUCUGGCGACAGAAAAGAUGGAACGCGGUAAACCCUGCGAGCGAGAAACCCAA\
+AUUUGGUAGGGGAACCGUCCUGAAGGAAUCAAACGGAAGGGACGGAUGGUAUCUUCGGAUGCCAUAGAUAGAUGGCUACCGCUCUUGGUGCGAGGGAUACGUCCCGCUUGCAGCACGGGAGAGACAGAACCUGGCUUAUAGCAUUUCCUGCUGGAU\
+) def
+/coor [
+[42.06064606 297.00585938]
+[46.61352158 282.17175293]
+[59.03635025 272.87374878]
+[58.69324493 257.87765503]
+[58.35013962 242.88159180]
+[58.00703430 227.88551331]
+[57.66392899 212.88943481]
+[57.32082748 197.89335632]
+[56.97772217 182.89727783]
+[56.63461685 167.90121460]
+[56.29151154 152.90513611]
+[55.94840622 137.90905762]
+[55.60530090 122.91297913]
+[46.82557678 110.75089264]
+[32.70000839 105.70427704]
+[18.57444000 100.65766144]
+[4.44887257 95.61104584]
+[-9.94205666 99.84201813]
+[-19.08859444 111.73070526]
+[-28.23513222 123.61939240]
+[-37.38166809 135.50807190]
+[-29.15162849 152.90130615]
+[-41.59085464 175.22094727]
+[-49.80515671 187.77185059]
+[-58.01945496 200.32276917]
+[-66.23375702 212.87367249]
+[-74.44805145 225.42457581]
+[-82.66235352 237.97549438]
+[-90.82874298 250.55761719]
+[-98.94709778 263.17080688]
+[-107.06545258 275.78396606]
+[-115.18381500 288.39715576]
+[-123.30216980 301.01034546]
+[-131.42053223 313.62350464]
+[-139.53887939 326.23669434]
+[-139.78965759 342.63391113]
+[-154.24520874 350.37789917]
+[-168.03489685 341.50228882]
+[-166.97308350 325.13757324]
+[-152.15206909 318.11834717]
+[-144.03370667 305.50515747]
+[-135.91534424 292.89196777]
+[-127.79698944 280.27880859]
+[-119.67863464 267.66561890]
+[-111.56027222 255.05244446]
+[-103.44191742 242.43927002]
+[-102.47118378 235.17279053]
+[-95.21325684 229.76118469]
+[-86.99896240 217.21028137]
+[-78.78466034 204.65937805]
+[-70.57036591 192.10845947]
+[-62.35606384 179.55755615]
+[-54.14176559 167.00665283]
+[-59.68206406 161.95144653]
+[-76.30296326 146.78584290]
+[-88.05078125 156.11260986]
+[-91.30287170 171.82260132]
+[-105.67762756 178.94621277]
+[-120.14797974 172.01882935]
+[-123.61350250 156.35453796]
+[-113.41574860 143.96966553]
+[-97.37755585 144.36479187]
+[-85.62973785 135.03802490]
+[-66.41344452 121.66181946]
+[-49.27035522 126.36154175]
+[-40.12381744 114.47285461]
+[-30.97727966 102.58416748]
+[-21.83074188 90.69548035]
+[-26.24375725 84.63121796]
+[-41.16038132 86.21054840]
+[-35.06978607 72.50268555]
+[-39.48280334 66.43842316]
+[-53.60836792 71.48503876]
+[-67.73394012 76.53165436]
+[-81.85950470 81.57826996]
+[-95.98506927 86.62489319]
+[-110.11064148 91.67150879]
+[-116.64728546 106.06066132]
+[-131.47320557 111.53492737]
+[-145.79244995 104.84651947]
+[-151.10966492 89.96355438]
+[-144.27023315 75.71582031]
+[-129.33187866 70.55625916]
+[-115.15725708 77.54593658]
+[-101.03168488 72.49932098]
+[-86.90612030 67.45270538]
+[-72.78055573 62.40608978]
+[-58.65498734 57.35947418]
+[-44.52941895 52.31285477]
+[-37.56217957 38.52346039]
+[-26.96384048 30.84691238]
+[-36.73162842 19.46313858]
+[-46.49941635 8.07936382]
+[-56.26720428 -3.30441141]
+[-66.03498840 -14.68818665]
+[-75.80278015 -26.07196045]
+[-98.98574066 -31.25790787]
+[-103.97647858 -53.77650833]
+[-115.58070374 -63.28135300]
+[-127.18492889 -72.78619385]
+[-141.12904358 -78.31444550]
+[-156.09373474 -79.34304047]
+[-171.05842590 -80.37163544]
+[-186.02311707 -81.40023804]
+[-200.98780823 -82.42883301]
+[-215.47293091 -74.74032593]
+[-229.22850037 -83.66873169]
+[-228.10395813 -100.02927399]
+[-213.25614929 -106.99163055]
+[-199.95921326 -97.39352417]
+[-184.99452209 -96.36492920]
+[-170.02983093 -95.33632660]
+[-155.06513977 -94.30773163]
+[-140.10044861 -93.27913666]
+[-134.25469971 -107.09315491]
+[-145.41206360 -117.11877441]
+[-156.56942749 -127.14439392]
+[-167.72680664 -137.17001343]
+[-180.43200684 -145.14358521]
+[-194.31199646 -150.83094788]
+[-208.19197083 -156.51832581]
+[-222.07194519 -162.20570374]
+[-235.95191956 -167.89308167]
+[-249.83189392 -173.58044434]
+[-263.71188354 -179.26782227]
+[-277.59185791 -184.95520020]
+[-293.76089478 -182.21772766]
+[-304.00628662 -195.02258301]
+[-297.78839111 -210.19723511]
+[-281.50369263 -212.13130188]
+[-271.90447998 -198.83517456]
+[-258.02450562 -193.14779663]
+[-244.14453125 -187.46043396]
+[-230.26455688 -181.77305603]
+[-216.38456726 -176.08567810]
+[-202.50459290 -170.39830017]
+[-188.62461853 -164.71093750]
+[-174.74464417 -159.02355957]
+[-170.33161926 -165.08781433]
+[-161.50559998 -177.21635437]
+[-157.09257507 -183.28060913]
+[-166.77328491 -194.73854065]
+[-176.45397949 -206.19645691]
+[-186.13467407 -217.65438843]
+[-195.81538391 -229.11230469]
+[-205.49607849 -240.57023621]
+[-215.17678833 -252.02816772]
+[-228.76481628 -249.99882507]
+[-241.48760986 -254.89045715]
+[-250.07904053 -265.33328247]
+[-252.38992310 -278.54754639]
+[-247.92489624 -291.08288574]
+[-257.51794434 -302.61428833]
+[-267.11099243 -314.14569092]
+[-276.70404053 -325.67709351]
+[-284.53216553 -330.22500610]
+[-286.32586670 -337.33322144]
+[-295.83071899 -348.93743896]
+[-305.33557129 -360.54165649]
+[-320.04965210 -368.96374512]
+[-316.02999878 -385.43426514]
+[-299.09036255 -386.13119507]
+[-293.73135376 -370.04650879]
+[-284.22650146 -358.44229126]
+[-274.72164917 -346.83804321]
+[-265.17263794 -335.27017212]
+[-255.57958984 -323.73873901]
+[-245.98654175 -312.20733643]
+[-236.39349365 -300.67593384]
+[-220.01821899 -302.26220703]
+[-205.79644775 -293.66452026]
+[-199.46578979 -278.11874390]
+[-203.71885681 -261.70886230]
+[-194.03816223 -250.25093079]
+[-184.35745239 -238.79301453]
+[-174.67675781 -227.33508301]
+[-164.99606323 -215.87716675]
+[-155.31535339 -204.41923523]
+[-145.63465881 -192.96131897]
+[-141.63436890 -180.67662048]
+[-141.60919189 -169.09901428]
+[-144.92291260 -159.34556580]
+[-150.65541077 -152.25607300]
+[-157.70118713 -148.32739258]
+[-146.54380798 -138.30177307]
+[-135.38644409 -128.27615356]
+[-124.22907257 -118.25052643]
+[-113.94187164 -129.16719055]
+[-99.47093964 -133.11585999]
+[-85.06471252 -128.93724060]
+[-74.95267487 -117.85813141]
+[-72.10356140 -103.13119507]
+[-77.35384369 -89.08005524]
+[-89.16210175 -79.82991791]
+[-104.06160736 -78.09649658]
+[-117.68008423 -84.39041901]
+[-106.07585907 -74.88557434]
+[-94.47164154 -65.38072968]
+[-92.45198059 -66.40425110]
+[-90.33458710 -67.20630646]
+[-89.53431702 -82.18494415]
+[-88.73405457 -97.16358185]
+[-87.93378448 -112.14221954]
+[-87.13351440 -127.12085724]
+[-86.33324432 -142.09948730]
+[-85.53297424 -157.07812500]
+[-84.73271179 -172.05676270]
+[-92.64122009 -186.42295837]
+[-83.92362213 -200.31307983]
+[-67.54782867 -199.43817139]
+[-60.35985565 -184.69825745]
+[-69.75407410 -171.25650024]
+[-70.55434418 -156.27786255]
+[-71.35460663 -141.29922485]
+[-72.15487671 -126.32058716]
+[-72.95514679 -111.34194946]
+[-73.75541687 -96.36331177]
+[-74.55567932 -81.38467407]
+[-75.35594940 -66.40604401]
+[-67.97018433 -61.46640778]
+[-63.16696167 -53.83242416]
+[-61.87234116 -44.77110291]
+[-64.41900635 -35.83974838]
+[-54.65121460 -24.45597458]
+[-44.88342667 -13.07219887]
+[-35.11563873 -1.68842399]
+[-25.34785271 9.69535065]
+[-15.58006573 21.07912636]
+[-2.12498283 16.75079727]
+[12.84111309 20.26181984]
+[24.76665306 31.82793236]
+[29.40202522 49.07128906]
+[24.23037720 67.45729828]
+[9.49548912 81.48547363]
+[23.62105751 86.53208923]
+[37.74662399 91.57870483]
+[51.87219238 96.62532043]
+[118.20749664 79.33209991]
+[133.13385010 77.84761047]
+[148.06022644 76.36312866]
+[162.98658752 74.87864685]
+[177.91294861 73.39415741]
+[192.83930969 71.90967560]
+[207.76567078 70.42518616]
+[206.81819153 65.40071869]
+[207.11807251 59.85226059]
+[208.82124329 54.08790207]
+[212.00886536 48.45391846]
+[216.67895508 43.31697083]
+[222.74208069 39.04468155]
+[230.02160645 35.98537064]
+[238.25845337 34.44812012]
+[253.02836609 31.83088112]
+[267.79827881 29.21364403]
+[282.56817627 26.59640694]
+[289.42739868 12.80303001]
+[302.93545532 5.77555704]
+[317.81539917 8.02305317]
+[328.39208984 18.47637749]
+[343.16198730 15.85914040]
+[357.93188477 13.24190331]
+[372.70178223 10.62466621]
+[387.47171021 8.00742912]
+[402.24160767 5.39019156]
+[405.42944336 -14.38106346]
+[416.64169312 -31.34718895]
+[434.10409546 -42.36170959]
+[454.85861206 -45.25786591]
+[475.26364136 -39.27045441]
+[491.63278198 -25.21584892]
+[505.63922119 -30.58424950]
+[519.64562988 -35.95264816]
+[533.65209961 -41.32104874]
+[547.65850830 -46.68944931]
+[561.66497803 -52.05784988]
+[575.67138672 -57.42624664]
+[579.85992432 -73.85271454]
+[592.90319824 -84.41780853]
+[609.50823975 -85.09050751]
+[623.08813477 -75.80330658]
+[626.86700439 -90.85321808]
+[638.79187012 -100.78182983]
+[654.27734375 -101.77139282]
+[667.36901855 -93.44140625]
+[673.03277588 -78.99491119]
+[669.09088135 -63.98688126]
+[657.05902100 -54.18821335]
+[641.56365967 -53.36669159]
+[628.56317139 -61.83821106]
+[626.42895508 -48.70367050]
+[618.03155518 -38.24233246]
+[605.46887207 -33.23781967]
+[591.96435547 -35.08874130]
+[581.03979492 -43.41981125]
+[567.03338623 -38.05141068]
+[553.02691650 -32.68301010]
+[539.02050781 -27.31461143]
+[525.01403809 -21.94621086]
+[511.00759888 -16.57781219]
+[497.00115967 -11.20941162]
+[499.56207275 3.57036328]
+[514.55816650 3.91346860]
+[529.55426025 4.25657368]
+[544.55029297 4.59967899]
+[559.54638672 4.94278431]
+[574.54248047 5.28588915]
+[589.53851318 5.62899446]
+[604.53460693 5.97209978]
+[618.65295410 -2.37084746]
+[632.80242920 5.91910172]
+[632.42736816 22.31395912]
+[617.91351318 29.94809914]
+[604.19152832 20.96817589]
+[589.19543457 20.62507057]
+[574.19934082 20.28196526]
+[559.20324707 19.93885994]
+[544.20721436 19.59575462]
+[529.21112061 19.25264931]
+[514.21502686 18.90954399]
+[499.21896362 18.56643867]
+[494.37283325 29.36221313]
+[487.24349976 38.69115067]
+[478.24191284 46.08493042]
+[467.87142944 51.18465424]
+[456.69982910 53.75814056]
+[445.32806396 53.71020508]
+[434.35815430 51.08555603]
+[424.36123657 46.06418991]
+[415.84774780 38.94970322]
+[409.24157715 30.15123749]
+[404.85882568 20.16009521]
+[390.08892822 22.77733231]
+[375.31903076 25.39456940]
+[360.54913330 28.01180840]
+[345.77923584 30.62904549]
+[331.00930786 33.24628067]
+[324.66851807 46.69739151]
+[311.46685791 53.92097092]
+[296.36654663 51.96292496]
+[285.18539429 41.36631012]
+[270.41549683 43.98354721]
+[255.64559937 46.60078430]
+[240.87568665 49.21802521]
+[238.95297241 56.46737671]
+[253.93037415 55.64429092]
+[259.34143066 69.63430786]
+[247.70822144 79.10365295]
+[235.10752869 70.96608734]
+[233.18479919 78.21543884]
+[244.71621704 87.80849457]
+[256.24761963 97.40154266]
+[267.77902222 106.99459076]
+[284.02386475 109.23905945]
+[289.95101929 124.52960968]
+[279.46316528 137.13662720]
+[263.34930420 134.09109497]
+[258.18597412 118.52600098]
+[246.65457153 108.93295288]
+[235.12315369 99.33989716]
+[223.59175110 89.74684906]
+[209.25015259 85.35155487]
+[194.32379150 86.83603668]
+[179.39743042 88.32051849]
+[164.47106934 89.80500793]
+[149.54470825 91.28948975]
+[134.61834717 92.77397919]
+[119.69197845 94.25846100]
+[112.70944977 107.53416443]
+[119.94377136 120.67435455]
+[126.76836395 126.62311554]
+[127.18272400 133.94242859]
+[134.31663513 147.13740540]
+[141.45056152 160.33238220]
+[148.58447266 173.52734375]
+[163.93939209 173.87649536]
+[177.05422974 181.87004089]
+[184.40113831 195.35775757]
+[184.00386047 210.71150208]
+[175.96923828 223.80122375]
+[162.45857239 231.10581970]
+[147.10614014 230.66041565]
+[134.04167175 222.58480835]
+[126.77945709 209.05130005]
+[127.27298737 193.70034790]
+[135.38949585 180.66125488]
+[128.25558472 167.46629333]
+[121.12166595 154.27131653]
+[113.98775482 141.07635498]
+[106.80358124 127.90867615]
+[99.56925964 114.76848602]
+[92.32728577 116.71883392]
+[96.22798157 131.20277405]
+[92.36414337 145.69659424]
+[81.74404144 135.10346985]
+[77.84334564 120.61952972]
+[70.60137177 122.56987762]
+[70.94448090 137.56594849]
+[71.28758240 152.56202698]
+[71.63069153 167.55810547]
+[71.97379303 182.55418396]
+[72.31690216 197.55024719]
+[72.66000366 212.54632568]
+[73.00311279 227.54240417]
+[73.34621429 242.53848267]
+[73.68932343 257.53454590]
+[74.03242493 272.53063965]
+[86.86750793 281.25073242]
+[92.09406281 295.86111450]
+[87.70237732 310.74374390]
+[75.38114166 320.17596436]
+[59.86812592 320.53088379]
+] def
+/pairs [
+[3 406]
+[4 405]
+[5 404]
+[6 403]
+[7 402]
+[8 401]
+[9 400]
+[10 399]
+[11 398]
+[12 397]
+[13 396]
+[14 237]
+[15 236]
+[16 235]
+[17 234]
+[18 68]
+[19 67]
+[20 66]
+[21 65]
+[23 53]
+[24 52]
+[25 51]
+[26 50]
+[27 49]
+[28 48]
+[29 46]
+[30 45]
+[31 44]
+[32 43]
+[33 42]
+[34 41]
+[35 40]
+[55 63]
+[56 62]
+[72 89]
+[73 88]
+[74 87]
+[75 86]
+[76 85]
+[77 84]
+[91 228]
+[92 227]
+[93 226]
+[94 225]
+[95 224]
+[96 223]
+[98 198]
+[99 197]
+[100 196]
+[101 114]
+[102 113]
+[103 112]
+[104 111]
+[105 110]
+[115 187]
+[116 186]
+[117 185]
+[118 184]
+[119 138]
+[120 137]
+[121 136]
+[122 135]
+[123 134]
+[124 133]
+[125 132]
+[126 131]
+[141 179]
+[142 178]
+[143 177]
+[144 176]
+[145 175]
+[146 174]
+[147 173]
+[152 169]
+[153 168]
+[154 167]
+[155 166]
+[157 165]
+[158 164]
+[159 163]
+[200 219]
+[201 218]
+[202 217]
+[203 216]
+[204 215]
+[205 214]
+[206 213]
+[207 212]
+[238 367]
+[239 366]
+[240 365]
+[241 364]
+[242 363]
+[243 362]
+[244 361]
+[252 343]
+[253 342]
+[254 341]
+[255 340]
+[259 336]
+[260 335]
+[261 334]
+[262 333]
+[263 332]
+[264 331]
+[270 300]
+[271 299]
+[272 298]
+[273 297]
+[274 296]
+[275 295]
+[276 294]
+[280 289]
+[301 320]
+[302 319]
+[303 318]
+[304 317]
+[305 316]
+[306 315]
+[307 314]
+[308 313]
+[349 360]
+[350 359]
+[351 358]
+[352 357]
+[368 390]
+[369 389]
+[371 388]
+[372 387]
+[373 386]
+[374 385]
+] def
+
+init
+
+% switch off outline pairs or bases by removing these lines
+drawoutline
+drawpairs
+drawbases
+% show it
+showpage
+end
+%%EOF