Mercurial > repos > rnateam > graphclust_postprocessing
comparison test-data/1.cluster.top5.alirna.ps @ 17:f93c868203cc draft default tip
planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/GraphClust/CollectResults commit 4406735e44aba20859c252be39f4e99df28c7a92
| author | rnateam |
|---|---|
| date | Sat, 27 Oct 2018 13:23:06 -0400 |
| parents | |
| children |
comparison
equal
deleted
inserted
replaced
| 16:79df97a1bc0f | 17:f93c868203cc |
|---|---|
| 1 %!PS-Adobe-3.0 EPSF-3.0 | |
| 2 %%Creator: ViennaRNA-2.3.1 | |
| 3 %%CreationDate: Tue May 30 20:24:19 2017 | |
| 4 %%Title: RNA Secondary Structure Plot | |
| 5 %%BoundingBox: 0 0 700 700 | |
| 6 %%DocumentFonts: Helvetica | |
| 7 %%Pages: 1 | |
| 8 %%EndComments | |
| 9 | |
| 10 %Options: --noLP | |
| 11 % to switch off outline pairs of sequence comment or | |
| 12 % delete the appropriate line near the end of the file | |
| 13 | |
| 14 %%BeginProlog | |
| 15 /RNAplot 100 dict def | |
| 16 RNAplot begin | |
| 17 /fsize 14 def | |
| 18 /outlinecolor {0.2 setgray} bind def | |
| 19 /paircolor {0.2 setgray} bind def | |
| 20 /seqcolor {0 setgray} bind def | |
| 21 /cshow { dup stringwidth pop -2 div fsize -3 div rmoveto show} bind def | |
| 22 /min { 2 copy gt { exch } if pop } bind def | |
| 23 /max { 2 copy lt { exch } if pop } bind def | |
| 24 /arccoords { % i j arccoords | |
| 25 % puts optimal x1 y1 x2 y2 coordinates used in bezier curves from i to j | |
| 26 % onto the stack | |
| 27 dup 3 -1 roll dup 4 -1 roll lt dup dup 5 2 roll {exch} if | |
| 28 dup 3 -1 roll dup 3 -1 roll exch sub 1 sub dup | |
| 29 4 -2 roll 5 -1 roll {exch} if 4 2 roll | |
| 30 sequence length dup 2 div exch 3 1 roll lt | |
| 31 {exch 5 -1 roll pop 4 -2 roll exch 4 2 roll} | |
| 32 { 4 2 roll 5 -1 roll dup 6 1 roll {exch} if | |
| 33 4 -2 roll exch pop dup 3 -1 roll dup 4 1 roll | |
| 34 exch add 4 -1 roll dup 5 1 roll sub 1 sub | |
| 35 5 -1 roll not {4 -2 roll exch 4 2 roll} if | |
| 36 }ifelse | |
| 37 % compute the scalingfactor and prepare (1-sf) and sf*r | |
| 38 2 mul exch cpr 3 1 roll div dup | |
| 39 3 -1 roll mul exch 1 exch sub exch | |
| 40 % compute the coordinates | |
| 41 3 -1 roll 1 sub coor exch get aload pop % get coord for i | |
| 42 4 -1 roll dup 5 1 roll mul 3 -1 roll dup 4 1 roll add exch % calculate y1 | |
| 43 4 -1 roll dup 5 1 roll mul 3 -1 roll dup 4 1 roll add exch % calculate x1 | |
| 44 5 -1 roll 1 sub coor exch get aload pop % get coord for j | |
| 45 % duplicate j coord | |
| 46 dup 3 -1 roll dup 4 1 roll exch 8 2 roll | |
| 47 6 -1 roll dup 7 1 roll mul 5 -1 roll dup 6 1 roll add exch % calculate y2 | |
| 48 6 -1 roll mul 5 -1 roll add exch % calculate x2 | |
| 49 6 -2 roll % reorder | |
| 50 } bind def | |
| 51 /drawoutline { | |
| 52 gsave outlinecolor newpath | |
| 53 coor 0 get aload pop 0.8 0 360 arc % draw 5' circle of 1st sequence | |
| 54 currentdict /cutpoint known % check if cutpoint is defined | |
| 55 {coor 0 cutpoint getinterval | |
| 56 {aload pop lineto} forall % draw outline of 1st sequence | |
| 57 coor cutpoint 1 add get aload pop | |
| 58 2 copy moveto 0.8 0 360 arc % draw 5' circle of 2nd sequence | |
| 59 coor cutpoint 1 add coor length cutpoint 1 add sub getinterval | |
| 60 {aload pop lineto} forall} % draw outline of 2nd sequence | |
| 61 {coor {aload pop lineto} forall} % draw outline as a whole | |
| 62 ifelse | |
| 63 stroke grestore | |
| 64 } bind def | |
| 65 /drawpairs { | |
| 66 paircolor | |
| 67 0.7 setlinewidth | |
| 68 [9 3.01] 9 setdash | |
| 69 newpath | |
| 70 pairs {aload pop | |
| 71 currentdict (cpr) known | |
| 72 { exch dup | |
| 73 coor exch 1 sub get aload pop moveto | |
| 74 exch arccoords curveto | |
| 75 } | |
| 76 { coor exch 1 sub get aload pop moveto | |
| 77 coor exch 1 sub get aload pop lineto | |
| 78 }ifelse | |
| 79 } forall | |
| 80 stroke | |
| 81 } bind def | |
| 82 % draw bases | |
| 83 /drawbases { | |
| 84 [] 0 setdash | |
| 85 seqcolor | |
| 86 0 | |
| 87 coor { | |
| 88 aload pop moveto | |
| 89 dup sequence exch 1 getinterval cshow | |
| 90 1 add | |
| 91 } forall | |
| 92 pop | |
| 93 } bind def | |
| 94 | |
| 95 /init { | |
| 96 /Helvetica findfont fsize scalefont setfont | |
| 97 1 setlinejoin | |
| 98 1 setlinecap | |
| 99 0.8 setlinewidth | |
| 100 % find the coordinate range | |
| 101 /xmax -1000 def /xmin 10000 def | |
| 102 /ymax -1000 def /ymin 10000 def | |
| 103 coor { | |
| 104 aload pop | |
| 105 dup ymin lt {dup /ymin exch def} if | |
| 106 dup ymax gt {/ymax exch def} {pop} ifelse | |
| 107 dup xmin lt {dup /xmin exch def} if | |
| 108 dup xmax gt {/xmax exch def} {pop} ifelse | |
| 109 } forall | |
| 110 /size {xmax xmin sub ymax ymin sub max} bind def | |
| 111 /width {xmax xmin sub} bind def | |
| 112 /height {ymax ymin sub} bind def | |
| 113 10 10 translate | |
| 114 680 size 10 add div dup scale | |
| 115 size width sub width xmin sub xmax sub add 2 div 5 add | |
| 116 size height sub height ymin sub ymax sub add 2 div 5 add | |
| 117 translate | |
| 118 } bind def | |
| 119 end | |
| 120 RNAplot begin | |
| 121 % extra definitions for standard anotations | |
| 122 /min { 2 copy gt { exch } if pop } bind def | |
| 123 /BLACK { 0 0 0 } def | |
| 124 /RED { 1 0 0 } def | |
| 125 /GREEN { 0 1 0 } def | |
| 126 /BLUE { 0 0 1 } def | |
| 127 /WHITE { 1 1 1 } def | |
| 128 /LabelFont { % font size LabelFont | |
| 129 exch findfont exch fsize mul scalefont setfont | |
| 130 } bind def | |
| 131 /Label { % i dx dy (text) Label | |
| 132 % write text at base i plus offset dx, dy | |
| 133 4 3 roll 1 sub coor exch get aload pop moveto | |
| 134 3 1 roll fsize mul exch fsize mul exch rmoveto | |
| 135 show | |
| 136 } bind def | |
| 137 /cmark { % i cmark draw circle around base i | |
| 138 newpath 1 sub coor exch get aload pop | |
| 139 fsize 2 div 0 360 arc stroke | |
| 140 } bind def | |
| 141 /gmark { % i j c gmark | |
| 142 % draw basepair i,j with c counter examples in gray | |
| 143 gsave | |
| 144 3 min [0 0.33 0.66 0.9] exch get setgray | |
| 145 1 sub dup coor exch get aload pop moveto | |
| 146 sequence exch 1 getinterval cshow | |
| 147 1 sub dup coor exch get aload pop moveto | |
| 148 sequence exch 1 getinterval cshow | |
| 149 grestore | |
| 150 } bind def | |
| 151 /segmark { % f i j lw r g b segmark | |
| 152 % mark segment [i,j] with outline width lw and color rgb | |
| 153 % use omark and Fomark instead | |
| 154 gsave | |
| 155 setrgbcolor setlinewidth | |
| 156 newpath | |
| 157 1 sub exch 1 sub dup | |
| 158 coor exch get aload pop moveto | |
| 159 currentdict (cpr) known | |
| 160 { | |
| 161 3 -1 roll dup 4 1 roll dup | |
| 162 { | |
| 163 3 1 roll dup 3 -1 roll dup | |
| 164 4 1 roll exch 5 2 roll exch | |
| 165 } | |
| 166 { | |
| 167 3 1 roll exch | |
| 168 } ifelse | |
| 169 1 exch { coor exch get aload pop lineto } for | |
| 170 { | |
| 171 dup 3 1 roll 1 add exch 1 add arccoords pop pop | |
| 172 4 2 roll 5 -1 roll coor exch get aload pop curveto | |
| 173 } if | |
| 174 } | |
| 175 { | |
| 176 exch 1 exch { | |
| 177 coor exch get aload pop lineto | |
| 178 } for | |
| 179 } ifelse | |
| 180 { closepath fill } if stroke | |
| 181 grestore | |
| 182 } bind def | |
| 183 /omark { % i j lw r g b omark | |
| 184 % stroke segment [i..j] with linewidth lw, color rgb | |
| 185 false 7 1 roll segmark | |
| 186 } bind def | |
| 187 /Fomark { % i j r g b Fomark | |
| 188 % fill segment [i..j] with color rgb | |
| 189 % should precede drawbases | |
| 190 1 4 1 roll true 7 1 roll segmark | |
| 191 } bind def | |
| 192 /BFmark{ % i j k l r g b BFmark | |
| 193 % fill block between pairs (i,j) and (k,l) with color rgb | |
| 194 % should precede drawbases | |
| 195 gsave | |
| 196 setrgbcolor | |
| 197 newpath | |
| 198 currentdict (cpr) known | |
| 199 { | |
| 200 dup 1 sub coor exch get aload pop moveto % move to l | |
| 201 dup 1 sub 4 -1 roll dup 5 1 roll 1 sub 1 exch | |
| 202 { coor exch get aload pop lineto } for % lines from l to j | |
| 203 3 -1 roll 4 -1 roll dup 5 1 roll arccoords curveto % curve from j to i | |
| 204 exch dup 4 -1 roll 1 sub exch 1 sub 1 exch | |
| 205 { coor exch get aload pop lineto } for % lines from i to k | |
| 206 exch arccoords curveto% curve from k to l | |
| 207 } | |
| 208 { exch 4 3 roll exch 1 sub exch 1 sub dup | |
| 209 coor exch get aload pop moveto | |
| 210 exch 1 exch { coor exch get aload pop lineto } for | |
| 211 exch 1 sub exch 1 sub dup | |
| 212 coor exch get aload pop lineto | |
| 213 exch 1 exch { coor exch get aload pop lineto } for | |
| 214 } ifelse | |
| 215 closepath fill stroke | |
| 216 grestore | |
| 217 } bind def | |
| 218 /hsb { | |
| 219 dup 0.3 mul 1 exch sub sethsbcolor | |
| 220 } bind def | |
| 221 /colorpair { % i j hue sat colorpair | |
| 222 % draw basepair i,j in color | |
| 223 % 1 index 0.00 ne { | |
| 224 gsave | |
| 225 newpath | |
| 226 hsb | |
| 227 fsize setlinewidth | |
| 228 currentdict (cpr) known | |
| 229 { | |
| 230 exch dup | |
| 231 coor exch 1 sub get aload pop moveto | |
| 232 exch arccoords curveto | |
| 233 } | |
| 234 { 1 sub coor exch get aload pop moveto | |
| 235 1 sub coor exch get aload pop lineto | |
| 236 } ifelse | |
| 237 stroke | |
| 238 grestore | |
| 239 % } if | |
| 240 } bind def | |
| 241 end | |
| 242 | |
| 243 %%EndProlog | |
| 244 RNAplot begin | |
| 245 % data start here | |
| 246 /sequence (\ | |
| 247 GUUUCCGUAGUGUAGUGGUUAUCACGUUCGCCUCACACGCGAAAGGU_________CCCCGGUUCGAAACCGGGCGGAAACA\ | |
| 248 ) def | |
| 249 /coor [ | |
| 250 [126.01442719 205.80749512] | |
| 251 [125.44680786 190.81823730] | |
| 252 [124.87918091 175.82897949] | |
| 253 [124.31156158 160.83972168] | |
| 254 [123.74394226 145.85047913] | |
| 255 [123.17631531 130.86122131] | |
| 256 [122.60869598 115.87195587] | |
| 257 [107.91925812 124.77088928] | |
| 258 [91.87033844 122.99333954] | |
| 259 [80.97422791 112.51052094] | |
| 260 [66.42591858 116.16383362] | |
| 261 [51.87760544 119.81713867] | |
| 262 [47.74618530 134.60993958] | |
| 263 [36.76065063 145.34370422] | |
| 264 [21.87605476 149.13108826] | |
| 265 [7.09627628 144.95332336] | |
| 266 [-3.60299659 133.93420410] | |
| 267 [-7.34371328 119.03780365] | |
| 268 [-3.11964059 104.27119446] | |
| 269 [7.93296814 93.60651398] | |
| 270 [22.84101677 89.91250610] | |
| 271 [37.59431458 94.18284607] | |
| 272 [48.22429657 105.26882935] | |
| 273 [62.77260971 101.61552429] | |
| 274 [77.32091522 97.96221161] | |
| 275 [93.74244690 75.59227753] | |
| 276 [122.92980194 84.59557343] | |
| 277 [115.84320831 71.37512970] | |
| 278 [108.75661469 58.15468216] | |
| 279 [101.67002106 44.93423462] | |
| 280 [94.58342743 31.71378899] | |
| 281 [79.24071503 28.69135094] | |
| 282 [69.47061157 16.48155785] | |
| 283 [69.88626099 0.84949923] | |
| 284 [80.29140472 -10.82384396] | |
| 285 [95.77305603 -13.02667522] | |
| 286 [109.02124786 -4.71888638] | |
| 287 [113.78059387 10.17683983] | |
| 288 [107.80387115 24.62719536] | |
| 289 [114.89046478 37.84764099] | |
| 290 [121.97705841 51.06808853] | |
| 291 [129.06365967 64.28853607] | |
| 292 [136.15025330 77.50897980] | |
| 293 [130.14912415 63.76174545] | |
| 294 [129.68310547 48.76898575] | |
| 295 [134.81886292 34.67558289] | |
| 296 [144.82167053 23.49776077] | |
| 297 [158.26051331 16.83462524] | |
| 298 [173.21282959 15.63941574] | |
| 299 [187.53950500 20.08312035] | |
| 300 [199.19094849 29.53001785] | |
| 301 [206.50028992 42.62862396] | |
| 302 [208.42185974 57.50503159] | |
| 303 [204.68074036 72.03101349] | |
| 304 [195.81214905 84.12845612] | |
| 305 [183.08483887 92.06668854] | |
| 306 [168.31959534 94.71005249] | |
| 307 [153.62709045 91.67971802] | |
| 308 [168.02673340 95.88093567] | |
| 309 [182.42637634 100.08216095] | |
| 310 [196.82603455 104.28337860] | |
| 311 [211.22567749 108.48459625] | |
| 312 [224.12878418 99.65035248] | |
| 313 [239.68653870 101.22833252] | |
| 314 [250.55305481 112.47345734] | |
| 315 [251.59750366 128.07612610] | |
| 316 [242.32670593 140.66921997] | |
| 317 [227.11805725 144.30670166] | |
| 318 [213.15261841 137.27102661] | |
| 319 [207.02444458 122.88423920] | |
| 320 [192.62480164 118.68302155] | |
| 321 [178.22515869 114.48180389] | |
| 322 [163.82551575 110.28057861] | |
| 323 [149.42587280 106.07936096] | |
| 324 [137.59794617 115.30433655] | |
| 325 [138.16557312 130.29359436] | |
| 326 [138.73320007 145.28285217] | |
| 327 [139.30081177 160.27210999] | |
| 328 [139.86843872 175.26136780] | |
| 329 [140.43606567 190.25062561] | |
| 330 [141.00367737 205.23986816] | |
| 331 [143.92169189 224.40065002] | |
| 332 ] def | |
| 333 /pairs [ | |
| 334 [1 81] | |
| 335 [2 80] | |
| 336 [3 79] | |
| 337 [4 78] | |
| 338 [5 77] | |
| 339 [6 76] | |
| 340 [7 75] | |
| 341 [10 25] | |
| 342 [11 24] | |
| 343 [12 23] | |
| 344 [27 43] | |
| 345 [28 42] | |
| 346 [29 41] | |
| 347 [30 40] | |
| 348 [31 39] | |
| 349 [58 74] | |
| 350 [59 73] | |
| 351 [60 72] | |
| 352 [61 71] | |
| 353 [62 70] | |
| 354 ] def | |
| 355 | |
| 356 init | |
| 357 | |
| 358 % Start Annotations | |
| 359 1 81 0.0 1 colorpair | |
| 360 2 80 0.16 1 colorpair | |
| 361 3 79 0.16 1 colorpair | |
| 362 4 78 0.16 1 colorpair | |
| 363 5 77 0.16 1 colorpair | |
| 364 6 76 0.32 1 colorpair | |
| 365 7 75 0.16 1 colorpair | |
| 366 10 25 0.0 1 colorpair | |
| 367 11 24 0.16 1 colorpair | |
| 368 12 23 0.16 1 colorpair | |
| 369 27 43 0.16 1 colorpair | |
| 370 28 42 0.0 1 colorpair | |
| 371 29 41 0.16 1 colorpair | |
| 372 30 40 0.0 1 colorpair | |
| 373 31 39 0.16 1 colorpair | |
| 374 58 74 0.16 1 colorpair | |
| 375 59 73 0.0 1 colorpair | |
| 376 60 72 0.16 1 colorpair | |
| 377 61 71 0.0 1 colorpair | |
| 378 62 70 0.0 1 colorpair | |
| 379 | |
| 380 % End Annotations | |
| 381 % switch off outline pairs or bases by removing these lines | |
| 382 drawoutline | |
| 383 drawpairs | |
| 384 drawbases | |
| 385 % Start Annotations | |
| 386 2 cmark | |
| 387 80 cmark | |
| 388 3 cmark | |
| 389 79 cmark | |
| 390 4 cmark | |
| 391 78 cmark | |
| 392 5 cmark | |
| 393 77 cmark | |
| 394 6 cmark | |
| 395 76 cmark | |
| 396 7 cmark | |
| 397 75 cmark | |
| 398 11 cmark | |
| 399 24 cmark | |
| 400 12 cmark | |
| 401 23 cmark | |
| 402 27 cmark | |
| 403 43 cmark | |
| 404 29 cmark | |
| 405 41 cmark | |
| 406 31 cmark | |
| 407 39 cmark | |
| 408 58 cmark | |
| 409 74 cmark | |
| 410 60 cmark | |
| 411 72 cmark | |
| 412 | |
| 413 % End Annotations | |
| 414 % show it | |
| 415 showpage | |
| 416 end | |
| 417 %%EOF |
