# HG changeset patch # User rnateam # Date 1487671149 18000 # Node ID 33c0836ea3867c81a77f8bb1f8f017ee439fdf68 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/rna_tools/intarna commit bd39ebb8525db1e0f6a7e232bc05a5eea6badd25 diff -r 000000000000 -r 33c0836ea386 intarna.xml --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/intarna.xml Tue Feb 21 04:59:09 2017 -0500 @@ -0,0 +1,415 @@ + + Efficient RNA-RNA interaction prediction incorporating accessibility and seeding of interaction sites. + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + intarna + + + + + + IntaRNA --version + + "." + ## --qAccConstr $advancedOptions.query.qAccConstr + ## #end if + --qIntLoopMax $advancedOptions.query.qIntLoopMax + #if $advancedOptions.query.qRegion + --qRegion '$advancedOptions.query.qRegion' + #end if + + ## Target param. + --target '$advancedOptions.target._target' + --tAcc $advancedOptions.target.tAcc_cond.tAcc + #if $advancedOptions.target.tAcc_cond.tAcc == "P" or $advancedOptions.target.tAcc_cond.tAcc == "E" + --tAccFile '$advancedOptions.target.tAcc_cond.tAccFile' + #end if + --tAccW $advancedOptions.target.tAccW + --tAccL $advancedOptions.target.tAccL + ## #if $advancedOptions.target.tAccConstr <> "." + ## --tAccConstr $advancedOptions.target.tAccConstr + ## #end if + --tIntLoopMax $advancedOptions.target.tIntLoopMax + #if $advancedOptions.target.tRegion + --tRegion '$advancedOptions.target.tRegion' + #end if + + ## Seed param. + --noSeed $advancedOptions.seed.noSeed + --seedBP $advancedOptions.seed.seedBP + --seedMaxUP $advancedOptions.seed.seedMaxUP + --seedQMaxUP $advancedOptions.seed.seedQMaxUP + --seedTMaxUP $advancedOptions.seed.seedTMaxUP + --seedMaxE $advancedOptions.seed.seedMaxE + --seedMinPu $advancedOptions.seed.seedMinPu + --seedQRange '$advancedOptions.seed.seedQRange' + --seedTRange '$advancedOptions.seed.seedTRange' + + ## Interaction param. + --mode $advancedOptions.interaction.mode + --pred $advancedOptions.interaction.pred + --energy $advancedOptions.interaction.energy + #if $advancedOptions.interaction.energyVRNA + --energyVRNA '$advancedOptions.interaction.energyVRNA' + #end if + --temperature $advancedOptions.interaction.temperature + + ##Output param. + --out ./temp_tabular_output + --outMode $advancedOptions.output.outMode + --outNumber $advancedOptions.output.outNumber + --outOverlap $advancedOptions.output.outOverlap + --outMaxE $advancedOptions.output.outMaxE + --outDeltaE $advancedOptions.output.outDeltaE + #if $advancedOptions.output.outCsvCols + --outCsvCols '$advancedOptions.output.outCsvCols' + #end if + #if $advancedOptions.output.add_output_cond.selector == "add" + #if str($advancedOptions.output.add_output_cond.add_output.value) != 'None' + #for j in $advancedOptions.output.add_output_cond.add_output.value: + --$j $getVar($j) + #end for + #end if + #end if + + #elif $advancedOptions.advancedSelector == "basic" + ## Query parameters + --query '$advancedOptions.query._query' + --qAcc $advancedOptions.query.qAcc_cond.qAcc + #if $advancedOptions.query.qAcc_cond.qAcc == "P" or $advancedOptions.query.qAcc_cond.qAcc == "E" + --qAccFile '$advancedOptions.query.qAcc_cond.qAccFile' + #end if + --qAccW $advancedOptions.query.qAccW + --qAccL $advancedOptions.query.qAccL + + ## Target param. + --target '$advancedOptions.target._target' + --tAcc $advancedOptions.target.tAcc_cond.tAcc + #if $advancedOptions.target.tAcc_cond.tAcc == "P" or $advancedOptions.target.tAcc_cond.tAcc == "E" + --tAccFile '$advancedOptions.target.tAcc_cond.tAccFile' + #end if + --tAccW $advancedOptions.target.tAccW + --tAccL $advancedOptions.target.tAccL + + ## Seed param. + --noSeed $advancedOptions.seed.noSeed + --seedBP $advancedOptions.seed.seedBP + --seedMaxUP $advancedOptions.seed.seedMaxUP + + ## Interaction param. + --mode $advancedOptions.interaction.mode + + ##Output param. + --out ./temp_tabular_output + --outMode $advancedOptions.output.outMode + --outNumber $advancedOptions.output.outNumber + --outOverlap $advancedOptions.output.outOverlap + #if $advancedOptions.output.outCsvCols + --outCsvCols '$advancedOptions.output.outCsvCols' + #end if + #end if + && sed 's/\t/ /g' ./temp_tabular_output > ./temp_output_no_tabs + && sed 's/;/\t/g' ./temp_output_no_tabs > '$outfile' + + ]]> + + + + + + + + + +
+ + + + +
+
+ + + + + +
+
+ + + + + + + + +
+
+ + + + + + + + + + + +
+
+ + + + + + + + + + + + + + + + + + + + +
+
+ +
+ +
+
+ +
+
+ +
+
+ +
+
+ +
+
+
+
+ + + + + + + + + (( + advancedOptions['advancedSelector'] == "advanced" and + advancedOptions['output']['add_output_cond']['selector'] == "add" and + 'outQAccFile' in advancedOptions['output']['add_output_cond']['add_output'] + )) + + + + + (( + advancedOptions['advancedSelector'] == "advanced" and + advancedOptions['output']['add_output_cond']['selector'] == "add" and + 'outTAccFile' in advancedOptions['output']['add_output_cond']['add_output'] + )) + + + + + (( + advancedOptions['advancedSelector'] == "advanced" and + advancedOptions['output']['add_output_cond']['selector'] == "add" and + 'outQPuFile' in advancedOptions['output']['add_output_cond']['add_output'] + )) + + + + + (( + advancedOptions['advancedSelector'] == "advanced" and + advancedOptions['output']['add_output_cond']['selector'] == "add" and + 'outTPuFile' in advancedOptions['output']['add_output_cond']['add_output'] + )) + + + + + + + +
+ +
+
+ +
+
+ +
+
+ + +`_, is a general and fast approach to the prediction of RNA-RNA interactions incorporating both the accessibility of interacting sites as well as the existence of a user-definable seed interaction. We successfully applied IntaRNA to the prediction of bacterial sRNA targets and determined the exact locations of the interactions with a higher accuracy than competing programs. + +.. class:: infomark + +Please refer to `IntaRNA github repository `_ for use cases and additional information. + + +**Input** + + + +RNA sequences in *FASTA* format + + +**Output** + +RNA-RNA interaction information in CSV format and additional information/files on demand + +]]> + + + + + 10.1093/nar/gku359 + 10.1093/bioinformatics/btn544 + + +
diff -r 000000000000 -r 33c0836ea386 test-data/intarna_query.fa --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/intarna_query.fa Tue Feb 21 04:59:09 2017 -0500 @@ -0,0 +1,4 @@ +>ncRNA1 +AGGAUGGGGGAAACCCCAUACUCCUCACACACCAAAUCGCCCGAUUUAUCGGGCUUUUUU +>ncRNA2 +ACUGAGGUACGAUCGUGGCAGGGCCUUUGACUGACUUUCGUACUU diff -r 000000000000 -r 33c0836ea386 test-data/intarna_result.tabular --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/intarna_result.tabular Tue Feb 21 04:59:09 2017 -0500 @@ -0,0 +1,5 @@ +id1 start1 end1 id2 start2 end2 subseqDP hybridDP E +mRNA1 85 95 ncRNA1 21 32 GUGGUGAGGAG&CUCCUCACACAC (((((((((((&)))))))).))) -11.8782 +mRNA1 127 135 ncRNA2 18 25 GGCACCUGC&GCAGGGCC (((.(((((&)))))))) -6.95474 +mRNA2 86 97 ncRNA1 20 31 UGUGUGACGAGU&ACUCCUCACACA (((((((.((((&)))).))))))) -8.16661 +mRNA2 15 18 ncRNA2 22 25 GGCC&GGCC ((((&)))) -4.99627 diff -r 000000000000 -r 33c0836ea386 test-data/intarna_target.fa --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/intarna_target.fa Tue Feb 21 04:59:09 2017 -0500 @@ -0,0 +1,8 @@ +>mRNA1 +UUUAAAUUAAAAAAUCAUAGAAAAAGUAUCGUUUGAUACUUGUGAUUAUACUCAGUUAUA +CAGUAUCUUAAGGUGUUAUUAAUAGUGGUGAGGAGAAUUUAUGAAGCUUUUCAAAAGCUU +GCUUGUGGCACCUGCAACUCUUGGUCUUUUAGCACCAAUGACCGCUACUGCUAAU +>mRNA2 +UGCUUCUUAGUAAUGGCCAGCUCGGGGAUUUGGAACUGGUGGUUGUUAAUUCUAGGCAAA +UAGAUUAAAAUUAAAUUACUCAAAUUGUGUGACGAGUUUUAUGAAGCUUUUUAAAAGCUU +GUUGGUAGCUCCAGCAACGAUUGGGCUACUAGCUCCAUUUUCAACGUUUGCUGGC