Mercurial > repos > rnateam > locarna_multiple

changeset 4:6e20ad2c8752 draft default tip

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/rna_tools/locarna commit 94c141a71ef115279f1090f782b6f5cdeea9c277
author bgruening
date Mon, 19 Aug 2024 18:52:41 +0000
parents 7554c0df9139
children
files locarna_multiple.xml macros.xml test-data/archaea-default.stdout test-data/archaea-probabilistic.aln test-data/archaea-ref_result.aln test-data/archaea_relplot.scr test-data/haca.snoRNA-c.aln test-data/haca.snoRNA-default.stdout test-data/haca.snoRNA.aln test-data/tRNA_2.aln test-data/tRNA_2.amprobs test-data/tRNA_2.bmprobs
diffstat 12 files changed, 447 insertions(+), 350 deletions(-) [+]
line wrap: on
line diff
--- a/locarna_multiple.xml	Mon Dec 05 14:28:49 2022 +0000
+++ b/locarna_multiple.xml	Mon Aug 19 18:52:41 2024 +0000
@@ -2,20 +2,14 @@
     <description>
         Multiple Alignment and Folding of RNAs (mlocarna)
     </description>
-
     <macros>
         <import>macros.xml</import>
     </macros>
-    
-    <expand macro="requirements" />
-
-    <expand macro="stdio" />
-    
+    <expand macro="requirements"/>
+    <expand macro="stdio"/>
     <expand macro="version" />
-    
     <command><![CDATA[
     mlocarna
-    
     '$input_data'
     #if 'stockholm' in str($outputs).split(","):
     --stockholm
@@ -25,8 +19,7 @@
     ## maybe reenable later? see  https://github.com/s-will/LocARNA/issues/77
     ## --width 60
     
-    ## -------------------- alignment mode and specific options
-    #
+    ## -------------------- alignment mode and specific option--------- #
     #if str($alignment_mode.alignment_mode_selector) == "global_locarna"
         $alignment_mode.free_endgaps
     #elif str($alignment_mode.alignment_mode_selector) == "local_locarna"
@@ -78,30 +71,21 @@
                 <option value="text">Fasta-like input with LocARNA constraints</option>
               </param>
             <when value="fasta">
-                <param name="input_data" type="data" format="fasta" label="Sequence input"
-                       help="Sequence input in pure fasta format"
-                       />
+                <param name="input_data" type="data" format="fasta" label="Sequence input" help="Sequence input in pure fasta format"/>
             </when>
             <when value="text">
-                <param name="input_data" type="data" format="text" label="Sequence input"
-                       help="Sequence input in fasta format with locarna-specific extensions"
-                       />
+                <param name="input_data" type="data" format="text" label="Sequence input" help="Sequence input in fasta format with locarna-specific extensions"/>
             </when>
         </conditional>
         <conditional name="alignment_mode">
-            <param name="alignment_mode_selector" type="select" label="Alignment mode"
-                   help="Note that local alignment mode usually requires to turn off 
-                         the 'max-diff' heuristic (maximal difference for alignment traces)."
-                   >
+            <param name="alignment_mode_selector" type="select" label="Alignment mode" help="Note that local alignment mode usually requires to turn off the 'max-diff' heuristic (maximal difference for alignment traces).">
                 <option value="global_locarna">Global alignment (LocARNA)</option>
                 <option value="local_locarna">Local alignment (LocARNA)</option>
                 <option value="probabilistic">Probabilistic alignment (LocARNA-P)</option>
                 <option value="sparse">Global fast alignment (SPARSE)</option>
             </param>
             <when value="global_locarna">
-                <param name="free_endgaps" type="select" label="Free endgaps"
-                       help="Specify whether gaps at the ends (all, 5', or 3' ends)
-                             of the sequences should be penalized or allowed for free.">
+                <param name="free_endgaps" type="select" label="Free endgaps" help="Specify whether gaps at the ends (all, 5', or 3' ends)of the sequences should be penalized or allowed for free.">
                     <option value="">No free endgaps</option>
                     <option value="--free-endgaps">Free endgaps</option>
                     <option value="--free-endgaps-5">Free endgaps, only 5'</option>
@@ -111,17 +95,9 @@
             <when value="local_locarna">
             </when>
             <when value="probabilistic">
-                <param name="consistency_transformation" type="boolean" 
-                       truevalue="--consistency-transformation" falsevalue="" 
-                       checked="true" label="Consistency transformation" 
-                       help="--consistency-transformation" />
-                <param name="iterate" type="boolean"
-                       truevalue="true" falsevalue="false"
-                       checked="false" label="Iterative refinement"
-                       help="--iterate" />
-                <param name="iterations" type="integer"
-                       value="1" label="Number of refinement iterations"
-                       help="--iterations num" />
+                <param name="consistency_transformation" type="boolean" truevalue="--consistency-transformation" falsevalue="" checked="true" label="Consistency transformation" help="--consistency-transformation"/>
+                <param name="iterate" type="boolean" truevalue="true" falsevalue="false" checked="false" label="Iterative refinement" help="--iterate"/>
+                <param name="iterations" type="integer" value="1" label="Number of refinement iterations" help="--iterations num"/>
             </when>
             <when value="sparse">
                 <section name="HeuristicsSparse" title="Heuristic parameters for SPARSE">
--- a/macros.xml	Mon Dec 05 14:28:49 2022 +0000
+++ b/macros.xml	Mon Aug 19 18:52:41 2024 +0000
@@ -1,7 +1,7 @@
 <macros>
-    <token name="@TOOL_VERSION@">1.9.2.3</token>
-    <token name="@VERSION_SUFFIX@">1</token>
-    <token name="@PROFILE@">21.09</token>
+    <token name="@TOOL_VERSION@">2.0.1</token>
+    <token name="@VERSION_SUFFIX@">0</token>
+    <token name="@PROFILE@">23.0</token>
 
     <xml name="requirements">
         <requirements>
--- a/test-data/archaea-default.stdout	Mon Dec 05 14:28:49 2022 +0000
+++ b/test-data/archaea-default.stdout	Mon Aug 19 18:52:41 2024 +0000
@@ -1,9 +1,13 @@
-mLocARNA --- multiple Local (and global) Alignment of RNA --- LocARNA 1.9.0
-Copyright Sebastian Will
-
-Compute pair probs ...
-Compute pairwise alignments ... 
-Perform progressive alignment ...
+mLocARNA --- multiple Local (and global) Alignment of RNA --- LocARNA 2.0.1
 
 
+vhuU               AG-CUCACAACCGAACCC-AU------------UUGGGAGGUUGUGAGCU-
+fwdB               AU-GUUGGAGGGGAACCC-GU------------AAGGGACCCUCCAAGAU-
+selD               UUACGAUGUGCCGAACCCUUU------------AAGGGAGGCACAUCGAAA
+hdrA               GG--CACCACUCGAAGGC--U------------AAGCCAAAGUGGUG-CU-
+vhuD               GU--UCUCUCGGGAACCCGUC------------AAGGGACCGAGAGA-AC-
+fruA               ---CCUCGAGGGGAACCC-GA------------AAGGGACCCGAGAGG---
+fdhA               CG-CCACCCUGCGAACCCAAUAUAAAAUAAUACAAGGGAGCAG-GUGGCG-
+
 alifold            ((.(((((((((...(((.................))).))))))))))). (-31.36 = -20.01 + -11.34)
+Results written to target directory /tmp/tmpstsz4a83/job_working_directory/000/2/working/mlocarna_results.
--- a/test-data/archaea-probabilistic.aln	Mon Dec 05 14:28:49 2022 +0000
+++ b/test-data/archaea-probabilistic.aln	Mon Aug 19 18:52:41 2024 +0000
@@ -1,11 +1,10 @@
-CLUSTAL W --- LocARNA 1.9.0
-
+CLUSTAL W --- LocARNA 2.0.1
 
 
-selD               UUACGAUGUGCCGAACCCUU------------UAAGGGAGGCACAUCGAAA
-vhuU               AGC-UCACAACCGAACCCAU-------------UUGGGAGGUUGUGAG-CU
-fwdB               AUG-UUGGAGGGGAACCCGU-------------AAGGGACCCUCCAAG-AU
-hdrA               GGC-ACC-ACUCGAAGGCU--------------AAGCCAAAGU-GGUG-CU
-vhuD               GUU-CUC-UCGGGAACCCGU------------CAAGGGACCGA-GAGA-AC
-fdhA               CGC-CACCCUGCGAACCCAAUAUAAAAUAAUACAAGGGAGCAG-GUGG-CG
-fruA               CC-UCG--AGGGGAACCCGA-------------AAGGGACCC--GAGA-GG
+vhuU               AGC-UCACAACCGAACCCA-----U---U-----UGGGAGGUUGUGA-GCU
+fwdB               AUG-UUGGAGGGGAACCCG-----U---A-----AGGGACCCUCCAA-GAU
+selD               UUACGAUGUGCCGAACCCU-----U--UA-----AGGGAGGCACAUCGAAA
+hdrA               GGC-ACC-ACUCGAAGGCU---------A-----AGCCAAAGU-GGU-GCU
+vhuD               GUU-CUC-UCGGGAACCCG-----U--CA-----AGGGACCGA-GAG-AAC
+fruA               CC-UCGA--GGGGAACCCG-----A---A-----AGGGACCC--GAGA-GG
+fdhA               CGC-CACCCUGCGAACCCAAUAUAAAAUAAUACAAGGGAGCAG-GUG-GCG
--- a/test-data/archaea-ref_result.aln	Mon Dec 05 14:28:49 2022 +0000
+++ b/test-data/archaea-ref_result.aln	Mon Aug 19 18:52:41 2024 +0000
@@ -1,5 +1,4 @@
-CLUSTAL W --- LocARNA 1.9.0
-
+CLUSTAL W --- LocARNA 2.0.1
 
 
 vhuU               AG-CUCACAACCGAACCC-AU------------UUGGGAGGUUGUGAGCU-
--- a/test-data/archaea_relplot.scr	Mon Dec 05 14:28:49 2022 +0000
+++ b/test-data/archaea_relplot.scr	Mon Aug 19 18:52:41 2024 +0000
@@ -1,4 +1,4 @@
-pdf("/tmp/tmp5yxSuG/files/000/dataset_2.dat",width=12,height=4,version="1.4")
+pdf("/tmp/tmpewnb251n/job_working_directory/000/2/outputs/dataset_a612ea0e-aca2-4d90-987a-39141bc61f36.dat",width=12,height=4,version="1.4")
 
 rel    <- read.table("mlocarna_results/results/result.bmreliability");
 seqrel <- rel[[2]]
@@ -112,8 +112,8 @@
 
 if (0!=1) {
 
-  on  <- c(0,4,33,44,49);
-  off <- c(3,20,43,48,51);
+  on  <- c(0,33);
+  off <- c(20,51);
 
   if (length(on)>0) {
     for (i in 1:length(on)) {
@@ -123,8 +123,8 @@
 
   ### draw on/off values
   if (0) {
-    lines(c(1,1+len),c(0.0355791,0.0355791),lty=2,lwd=1)
-    lines(c(1,1+len),c(0.702675,0.702675),lty=2,lwd=1)
+    lines(c(1,1+len),c(0.0139513,0.0139513),lty=2,lwd=1)
+    lines(c(1,1+len),c(0.656017,0.656017),lty=2,lwd=1)
   }
 }
 
--- a/test-data/haca.snoRNA-c.aln	Mon Dec 05 14:28:49 2022 +0000
+++ b/test-data/haca.snoRNA-c.aln	Mon Aug 19 18:52:41 2024 +0000
@@ -1,4 +1,4 @@
-CLUSTAL W --- LocARNA 1.9.2.3
+CLUSTAL W --- LocARNA 2.0.1
 
 ACA7               ACCUCCUGGGAUCGCAUCUGG-AGAGUGC---CUAGUAUUCUGCCAGCUU-CGGAAAGGGAGGGAAAGCAAGCCUGGCAGAGGCACCCAUUC-CAUUCCCAGCUUGCUCCGUAGCUGGCG
 ACA30              UGGCACUUU--CACAGUUCCU-UCCCCAG---GCAGUGGGGCCAGGAUUUGGUAGCUGGUGCUGAGAGAAAAC---CC-UUG--AUUGUAUU-CUUGCCCUGGG---AUUAUACCAGUGG
--- a/test-data/haca.snoRNA-default.stdout	Mon Dec 05 14:28:49 2022 +0000
+++ b/test-data/haca.snoRNA-default.stdout	Mon Aug 19 18:52:41 2024 +0000
@@ -1,10 +1,20 @@
-mLocARNA --- multiple Local (and global) Alignment of RNA --- LocARNA 1.9.0
-Copyright Sebastian Will
-
-Compute pair probs ...
-Compute pairwise alignments ... 
-Perform progressive alignment ...
+mLocARNA --- multiple Local (and global) Alignment of RNA --- LocARNA 2.0.1
 
 
-alifold            .((((((((........((((.(((((((......))))))).))))......))..)))))).............(((((((...((......((((((((((((.....)))))))))
-                   ))).........)).))).))))......... (-62.29 = -34.50 + -27.79)
+ACA7               ACCUCCUGGGAUCGCAUCUGG-AGAGUGC---CUAGUAUUCUGCCAGCUUCGGAA-AGGGAGGGAAAGCAAGCCUGGCAGAGGCACCCAUUC-CAUUCCCAGCUUGCUCCGUAGCUGGCG
+ACA30              UGGCACUUUCACAG--UUCCU-UCCCCAG---GCAGUGGGGCCAGGAUUUGGUAGCUGGUGCUGAGAGAAAAC---CC-UUG--AUUGUAUU-CUUGCCCUGGG---AUUAUACCAGUGG
+ACA5               UGCAGCCGUGUCAAAUUCAGUACCUGUCCUAUGCAUGGUAGGCACUGGCCCAGAA--GGCUGCCACAGAAACAC--UGUGAC-----UCAUG-GGCCCUGUUCCUGUGUCCCAGGCUCAG
+ACA59              GCCCAGGGUAUGUUCACGGGGCGAUGCUGCCCUCCCAGCUGG--CCCAUGGGUGA-CCCUGGGAACAUUAACUGCCUCACAACGUUUGUGCCUCAGUUACCCGUAGAUGUAGUGAGGGUA
+#A1                ................................................................AAAAAA..................................................
+#A2                ................................................................123456..................................................
+
+ACA7               AUUGGA-----AGACACU-CUGCG-----ACA
+ACA30              CAACUG-----UCACUCA-AUGGG-----ACA
+ACA5               GGAUAA-----AUUUGGU-UACAG-----ACA
+ACA59              ACAAUACUUACUCUCGUUGGUGAUAAGGAACA
+#A1                .............................BBB
+#A2                .............................123
+
+alifold            .((((((..........((((..(((((........)))))..))))..........)))))).............((((((.............((((((((..........)))).))
+                   ))..............)).))))......... (-53.08 = -26.63 + -26.46)
+Results written to target directory /tmp/tmpstsz4a83/job_working_directory/000/4/working/mlocarna_results.
--- a/test-data/haca.snoRNA.aln	Mon Dec 05 14:28:49 2022 +0000
+++ b/test-data/haca.snoRNA.aln	Mon Aug 19 18:52:41 2024 +0000
@@ -1,4 +1,4 @@
-CLUSTAL W --- LocARNA 1.9.2.3
+CLUSTAL W --- LocARNA 2.0.1
 
 ACA7               ACCUCCUGGGAUCGCAUCUGG-AGAGUGC---CUAGUAUUCUGCCAGCUU-CGGAAAGGGAGGGAAAGCAAGCCUGGCAGAGGCACCCAUUC-CAUUCCCAGCUUGCUCCGUAGCUGGCG
 ACA30              UGGCACUUU--CACAGUUCCU-UCCCCAG---GCAGUGGGGCCAGGAUUUGGUAGCUGGUGCUGAGAGAAAAC---CC-UUG--AUUGUAUU-CUUGCCCUGGG---AUUAUACCAGUGG
--- a/test-data/tRNA_2.aln	Mon Dec 05 14:28:49 2022 +0000
+++ b/test-data/tRNA_2.aln	Mon Aug 19 18:52:41 2024 +0000
@@ -1,4 +1,4 @@
-CLUSTAL W --- LocARNA 1.9.2.3 --- Score: 2587
+CLUSTAL W --- LocARNA 2.0.1 --- Score: 2587
 
 D10744             GGAAAAUUGAUCAUCGGCAAGAUAAGUUAUUUACUAAAUAAUAGGAUUUAAUAACCUGGUGAGUUCGAAUCUCACAUUUUCCG
 AF008220           GGAGGAUUAGC--UCAGCUGGGAGAGCAUCUGCCUUA-------CAAGCAGAGGGUCGGCG-GUUCGAGCCCGUCAUCCUCCA
--- a/test-data/tRNA_2.amprobs	Mon Dec 05 14:28:49 2022 +0000
+++ b/test-data/tRNA_2.amprobs	Mon Aug 19 18:52:41 2024 +0000
@@ -1,108 +1,185 @@
-64 69 54 59 0.079977
-63 70 53 60 0.0158884
-63 71 53 61 0.0915855
-62 72 52 62 0.203921
-61 73 51 63 0.202155
-60 74 50 64 0.175676
-59 75 49 65 0.0815626
-39 44 33 38 0.0114647
-39 46 33 37 0.0168669
-38 47 33 38 0.0303705
-37 48 32 39 0.0111801
-37 48 31 39 0.0434528
-36 42 34 38 0.0105213
-36 42 33 37 0.0442772
-36 42 33 38 0.0150469
-36 49 30 40 0.0445378
-35 40 33 37 0.0438048
-35 40 33 38 0.0131652
-35 43 33 37 0.0482007
-35 43 33 38 0.0524118
-35 43 32 39 0.0124841
-35 44 33 38 0.0456243
-35 44 32 39 0.0111628
-35 46 33 37 0.0220704
-35 50 29 41 0.016731
-34 44 33 38 0.0275446
-34 44 32 39 0.0318614
-34 44 31 39 0.0265932
-34 45 32 39 0.0344691
-33 42 31 39 0.123358
-33 47 31 39 0.0238501
-33 48 31 39 0.207448
-33 48 30 40 0.0278532
-33 49 32 39 0.0279853
-33 49 30 40 0.0365409
-32 36 33 37 0.0659838
-32 37 33 38 0.0229925
-32 40 31 39 0.01072
-32 43 30 40 0.102105
-32 45 31 39 0.0127413
-32 45 30 40 0.0472967
-32 46 30 40 0.0814206
-32 50 29 41 0.012395
-31 38 32 39 0.0108954
-31 44 29 41 0.0212986
-31 46 29 41 0.0101171
-31 50 30 40 0.105751
-31 50 29 41 0.490312
-31 50 28 42 0.0414615
-30 38 31 39 0.10883
-30 51 29 41 0.110433
-30 51 28 42 0.628654
-30 51 27 43 0.0377824
-29 39 30 40 0.119173
-29 52 28 42 0.130101
-29 52 27 43 0.657133
-28 40 29 41 0.103713
-28 53 27 43 0.113664
-28 53 25 45 0.0385623
-27 41 28 42 0.114432
-27 54 25 45 0.651098
-26 42 27 43 0.107977
-26 55 25 45 0.119566
-26 55 23 47 0.0239947
-26 56 25 46 0.011099
-26 56 24 47 0.147548
-26 56 23 47 0.0142523
-25 57 24 47 0.0172058
-25 57 22 48 0.0238997
-24 49 25 45 0.0155194
-24 57 23 47 0.0913467
-24 57 22 48 0.640114
-23 58 22 48 0.121828
-21 60 19 51 0.071982
-20 60 18 51 0.512044
-18 63 16 53 0.410891
-17 56 18 51 0.0172516
-17 64 15 54 0.505795
-17 65 15 55 0.0373483
-16 57 17 52 0.025034
-16 65 14 55 0.456198
-15 58 16 53 0.0181784
-15 67 13 57 0.463917
-14 19 13 18 0.0159303
-14 59 15 54 0.0239939
-14 68 12 58 0.536735
-13 60 14 55 0.0191717
-12 16 11 15 0.0116456
-12 21 13 22 0.0351601
-11 17 10 16 0.0359852
-11 22 12 23 0.0512024
-11 69 11 59 0.534042
-10 14 11 15 0.0213866
-10 23 11 24 0.0659783
-10 70 10 60 0.389747
-10 72 10 62 0.247777
-9 18 9 17 0.0444132
-9 73 8 63 0.0119982
-8 19 8 18 0.0421045
-8 74 9 64 0.0471423
-8 76 8 66 0.0271918
-7 76 7 66 0.821868
-6 77 6 67 0.869036
-5 78 5 68 0.962952
-4 79 4 69 0.963261
-3 80 3 70 0.872876
-2 81 2 71 0.752745
-1 82 1 72 0.752744
+64 69 54 59 0.16319
+63 70 53 60 0.0606329
+63 71 53 61 0.145389
+62 72 52 62 0.25696
+61 73 51 63 0.240954
+60 74 50 64 0.210569
+59 75 49 65 0.122694
+58 75 49 65 0.0111403
+39 44 33 38 0.0112145
+39 46 33 38 0.0175249
+38 47 33 38 0.0154611
+38 47 32 39 0.0177592
+38 47 31 39 0.0159878
+37 42 33 37 0.0132158
+37 42 33 38 0.0122008
+37 48 32 39 0.0117682
+37 48 31 39 0.0219232
+37 48 30 40 0.0159226
+36 42 33 37 0.0478677
+36 42 33 38 0.032832
+36 49 30 40 0.0232814
+36 49 29 41 0.0136757
+35 40 33 37 0.0183399
+35 43 33 37 0.0137049
+35 43 33 38 0.0188671
+35 43 32 39 0.0247033
+35 43 31 39 0.010845
+35 44 33 38 0.0133046
+35 44 32 39 0.0201842
+35 44 31 39 0.0100118
+35 50 29 41 0.0141317
+34 44 32 39 0.0162654
+34 44 31 39 0.033133
+34 45 32 39 0.0135707
+34 45 31 39 0.0175689
+34 45 30 40 0.0113915
+33 39 33 38 0.0116888
+33 42 31 39 0.03031
+33 47 31 39 0.0140218
+33 47 30 40 0.0221686
+33 48 31 39 0.0269906
+33 48 30 40 0.0512999
+33 49 32 39 0.011275
+33 49 31 39 0.0127182
+33 49 30 40 0.0341216
+33 49 29 41 0.0110589
+32 36 33 37 0.0569404
+32 37 33 38 0.0330938
+32 43 30 40 0.0244236
+32 45 30 40 0.0193929
+32 46 30 40 0.0206158
+32 46 29 41 0.0202383
+32 50 30 40 0.0137112
+32 50 29 41 0.0275772
+32 50 28 42 0.0105666
+31 38 32 39 0.026892
+31 40 31 39 0.0105917
+31 44 29 41 0.0148997
+31 46 29 41 0.0103933
+31 50 30 40 0.0592117
+31 50 29 41 0.0810522
+31 50 28 42 0.10226
+31 51 28 42 0.0278259
+30 38 31 39 0.0914819
+30 41 31 39 0.0185614
+30 41 30 40 0.0150206
+30 51 29 41 0.0757883
+30 51 28 42 0.12309
+30 51 27 43 0.0979955
+29 39 31 39 0.0200176
+29 39 30 40 0.118225
+29 42 30 40 0.0321991
+29 42 29 41 0.0153204
+29 52 28 42 0.109792
+29 52 27 43 0.137233
+28 40 30 40 0.0218993
+28 40 29 41 0.0958501
+28 43 29 41 0.0242155
+28 43 28 42 0.011836
+28 45 29 41 0.0162616
+28 53 27 43 0.0984421
+28 53 25 44 0.0274902
+28 53 25 45 0.0931804
+27 41 29 41 0.0180663
+27 41 28 42 0.103004
+27 44 28 42 0.0165945
+27 46 29 41 0.0103194
+27 46 28 42 0.0325129
+27 54 25 44 0.0132369
+27 54 25 45 0.132523
+27 54 25 46 0.0142974
+26 42 28 42 0.0188804
+26 42 27 43 0.086134
+26 47 28 42 0.0144383
+26 47 27 43 0.0452725
+26 55 25 45 0.101408
+26 55 24 47 0.0117641
+26 55 23 47 0.0494924
+26 56 25 46 0.0334479
+26 56 24 47 0.0515715
+26 56 23 47 0.0537746
+25 48 27 43 0.016738
+25 57 24 47 0.0378734
+25 57 23 47 0.0203137
+25 57 22 48 0.0666714
+24 48 25 44 0.0127371
+24 48 25 45 0.0133523
+24 48 25 46 0.0100569
+24 49 25 45 0.0467857
+24 49 25 46 0.0126485
+24 57 23 47 0.0921866
+24 57 22 48 0.124135
+23 50 25 45 0.0119876
+23 50 24 47 0.0126511
+23 51 24 47 0.0294762
+23 58 22 48 0.138271
+22 47 23 47 0.0133778
+22 52 23 47 0.0170463
+22 60 19 51 0.0221401
+21 52 22 48 0.0272167
+21 60 19 51 0.0328765
+21 60 18 51 0.0165578
+20 60 18 51 0.0900924
+19 52 20 48 0.0220804
+19 60 18 51 0.013892
+19 60 17 52 0.0105015
+18 63 16 53 0.122589
+17 55 18 51 0.0203127
+17 56 18 51 0.06657
+17 64 15 54 0.143165
+17 65 15 55 0.0308707
+16 56 17 52 0.0182183
+16 57 17 52 0.105046
+16 65 14 55 0.13451
+15 58 16 53 0.0844361
+15 67 13 57 0.149023
+14 19 13 18 0.0174277
+14 59 15 54 0.105879
+14 68 12 58 0.143275
+13 60 14 55 0.0819401
+13 70 11 59 0.011409
+12 16 11 15 0.0197214
+12 17 13 18 0.0110198
+12 21 13 22 0.0246713
+12 21 11 20 0.0113061
+12 61 13 57 0.0221517
+12 63 13 57 0.0118578
+12 67 13 57 0.0206475
+11 17 10 16 0.027035
+11 22 12 23 0.0289103
+11 22 11 20 0.0100156
+11 62 12 58 0.0238073
+11 63 12 58 0.020677
+11 68 12 58 0.0231266
+11 69 11 59 0.126668
+10 14 11 15 0.0664008
+10 23 11 24 0.0292855
+10 64 11 59 0.0182822
+10 65 11 59 0.0270649
+10 70 11 59 0.013269
+10 70 10 60 0.111863
+10 72 11 63 0.0111665
+10 72 10 61 0.0197501
+10 72 10 62 0.0851968
+9 15 10 16 0.0281596
+9 18 9 17 0.0412594
+9 66 10 60 0.0160834
+9 71 10 61 0.0165719
+9 73 9 64 0.0380848
+9 73 8 63 0.028412
+9 75 9 64 0.0125148
+8 16 9 17 0.0193588
+8 19 8 18 0.0410658
+8 74 9 64 0.109379
+8 74 8 63 0.029173
+8 76 8 66 0.0732703
+8 76 7 66 0.0172466
+7 76 8 66 0.0398486
+7 76 7 66 0.552277
+6 77 6 67 0.695078
+5 78 5 68 0.823761
+4 79 4 69 0.829247
+3 80 3 70 0.718496
+2 81 2 71 0.630949
+1 82 1 72 0.630758
--- a/test-data/tRNA_2.bmprobs	Mon Dec 05 14:28:49 2022 +0000
+++ b/test-data/tRNA_2.bmprobs	Mon Aug 19 18:52:41 2024 +0000
@@ -1,172 +1,204 @@
-1 1 0.247253
-2 2 0.247252
-3 3 0.127121
-4 4 0.0367335
-5 5 0.0369676
-6 6 0.129988
-7 7 0.156077
-8 8 0.835935
-8 9 0.012729
-9 8 0.010632
-9 9 0.727258
-9 10 0.0549287
-10 9 0.04195
-10 10 0.0853335
-10 11 0.0115868
-11 10 0.0364601
-11 11 0.112239
-12 10 0.011935
-12 11 0.0436248
-12 12 0.0614308
-13 11 0.0645154
-13 12 0.028434
-14 12 0.133445
-14 13 0.0169358
-15 13 0.260167
-15 14 0.0172799
-15 16 0.0124747
-16 14 0.271834
-16 15 0.0178714
-16 17 0.0141486
-17 15 0.185722
-17 16 0.0202801
-17 18 0.0184277
-18 16 0.300704
-18 17 0.0355582
-18 19 0.0165149
-19 17 0.700705
-19 18 0.0610097
-19 20 0.0138794
-20 18 0.193762
-20 19 0.11731
-20 21 0.012503
-21 19 0.633061
-21 20 0.119843
-22 20 0.625797
-22 21 0.127468
-23 20 0.0117929
-23 21 0.621337
-23 22 0.0118595
-23 24 0.0104834
-24 21 0.0184503
-24 22 0.0481581
-24 23 0.0441549
-24 25 0.0420745
-25 23 0.68405
-25 24 0.0269372
-25 26 0.0420693
-26 24 0.53624
-27 25 0.0346266
-27 26 0.120675
-28 26 0.681355
-28 27 0.0199945
-28 29 0.0196255
-29 27 0.0227404
-30 28 0.0396584
-30 29 0.0227396
-30 31 0.0165441
-31 29 0.121498
-31 32 0.114327
-32 30 0.351807
-32 31 0.0703916
-32 33 0.0332191
-33 31 0.0980398
-33 32 0.0266787
-33 34 0.0331979
-34 31 0.0122885
-34 32 0.400684
-34 33 0.0116529
-34 35 0.0331958
-35 32 0.0101403
-35 33 0.22599
-35 36 0.0332106
-36 33 0.0136772
-36 34 0.156117
-36 37 0.0332566
-37 34 0.0427905
-37 35 0.113127
-37 38 0.0933967
-38 35 0.0723242
-38 36 0.0618818
-39 34 0.0149807
-39 36 0.0997152
-39 37 0.0299675
-40 34 0.0108419
-40 35 0.01547
-40 37 0.111326
-40 38 0.0203761
-40 41 0.0196142
-41 35 0.0159003
-41 36 0.0127203
-41 38 0.149756
-42 34 0.0119499
-42 36 0.0189085
-42 37 0.010129
-42 39 0.0145996
-43 34 0.010789
-43 35 0.013731
-43 37 0.0170711
-43 38 0.0146016
-43 44 0.0354944
-44 35 0.0181452
-44 36 0.0122707
-44 38 0.0248855
-44 39 0.0183418
-44 45 0.0336616
-45 36 0.0423026
-45 39 0.0300877
-45 40 0.013096
-45 46 0.0286025
-46 37 0.0702926
-46 38 0.0130327
-46 40 0.0113529
-47 38 0.119444
-48 39 0.0264015
-48 40 0.0166626
-49 39 0.0133557
-49 40 0.309884
-50 41 0.109972
-51 41 0.0223073
-51 42 0.0365047
-52 43 0.0228365
-53 43 0.02009
-53 44 0.683193
-54 44 0.121387
-54 45 0.035521
-55 46 0.681952
-56 46 0.0343041
-56 47 0.536468
-56 48 0.0112514
-57 47 0.0531432
-57 48 0.0486503
-58 48 0.0521922
-58 49 0.632028
-59 49 0.117956
-59 50 0.628217
-60 50 0.0252284
-60 51 0.104879
-61 51 0.0460576
-61 52 0.573747
-62 52 0.165836
-62 53 0.0472354
-63 53 0.382375
-64 54 0.2672
-65 55 0.320519
-66 56 0.818192
-67 57 0.355528
-68 58 0.282881
-69 59 0.27801
-70 60 0.464549
-71 61 0.857675
-72 62 0.497193
-73 63 0.7313
-74 64 0.734773
-75 65 0.881053
-76 66 0.139472
-77 67 0.130956
-78 68 0.0370464
-79 69 0.0367371
-80 70 0.127122
-81 71 0.247251
-82 72 0.247251
-83 73 0.999955
+1 1 0.366252
+2 2 0.365091
+3 3 0.27684
+4 4 0.164336
+5 5 0.164496
+6 6 0.275403
+6 7 0.0150333
+7 7 0.312158
+7 8 0.041509
+8 7 0.0147566
+8 8 0.537633
+8 9 0.0515355
+9 8 0.029658
+9 9 0.340577
+9 10 0.155798
+10 9 0.0624269
+10 10 0.1087
+10 11 0.0817069
+11 9 0.0153131
+11 10 0.0586114
+11 11 0.0692688
+11 12 0.0603811
+12 10 0.0279601
+12 11 0.0560559
+12 12 0.0638994
+12 13 0.0516385
+13 11 0.0476271
+13 12 0.0400538
+13 13 0.0236597
+13 14 0.0429642
+14 12 0.0692335
+14 13 0.0256176
+14 14 0.0136384
+14 15 0.0315447
+15 13 0.117035
+15 14 0.0251312
+15 16 0.097924
+16 14 0.143556
+16 15 0.0257794
+16 17 0.0661332
+16 18 0.0114245
+17 15 0.115644
+17 16 0.0290074
+17 18 0.110305
+17 19 0.0179278
+18 16 0.145455
+18 17 0.0433537
+18 19 0.0938817
+18 20 0.014589
+19 17 0.225382
+19 18 0.0699153
+19 19 0.0108711
+19 20 0.0748197
+19 21 0.0129644
+20 17 0.0271947
+20 18 0.124659
+20 19 0.126635
+20 21 0.0658208
+21 18 0.0358134
+21 19 0.0923461
+21 20 0.144193
+21 22 0.046438
+22 19 0.0286916
+22 20 0.0788485
+22 21 0.161012
+22 23 0.0344135
+23 20 0.033323
+23 21 0.0774252
+23 22 0.0462986
+23 24 0.02822
+24 21 0.0448704
+24 22 0.038983
+24 23 0.0914385
+24 25 0.0264846
+25 22 0.0255459
+25 23 0.152178
+25 24 0.0517826
+25 26 0.0264143
+26 23 0.0114342
+26 24 0.107608
+26 25 0.0104744
+27 24 0.0171665
+27 25 0.0254544
+27 26 0.105359
+28 26 0.147377
+28 27 0.0361346
+28 29 0.0332037
+29 26 0.0250025
+29 27 0.0304826
+30 27 0.0199978
+30 28 0.0405605
+30 29 0.0383873
+30 31 0.0415247
+31 28 0.0116663
+31 29 0.0606234
+31 30 0.0115163
+31 32 0.0169077
+32 29 0.0983364
+32 30 0.0341299
+33 30 0.0418556
+33 31 0.0175872
+34 31 0.0311096
+34 32 0.0137121
+35 32 0.0168319
+37 38 0.0130611
+38 39 0.0191599
+40 41 0.0323542
+45 40 0.015565
+46 40 0.0110929
+46 41 0.0149779
+47 39 0.0105212
+47 41 0.0109433
+48 40 0.0266892
+48 41 0.0140021
+49 40 0.0261797
+49 41 0.0748955
+50 41 0.0525148
+51 41 0.0372709
+51 42 0.0377785
+51 43 0.0120601
+52 43 0.0338294
+52 44 0.0188302
+52 47 0.011994
+52 48 0.0100314
+53 43 0.0376898
+53 44 0.150707
+53 45 0.0139785
+53 48 0.0201243
+53 49 0.0195735
+54 44 0.109801
+54 45 0.030891
+54 46 0.0253539
+54 49 0.0245344
+54 50 0.0145876
+55 45 0.0248296
+55 46 0.0970525
+55 47 0.0256489
+55 48 0.0114306
+55 50 0.0321933
+56 46 0.0638499
+56 47 0.102833
+56 48 0.0362092
+56 51 0.0435195
+57 47 0.088865
+57 48 0.0422988
+57 49 0.0220075
+57 52 0.0112409
+58 48 0.112294
+58 49 0.0962222
+58 50 0.0168976
+58 53 0.0461357
+59 49 0.177376
+59 50 0.0822895
+60 50 0.133033
+60 51 0.0614758
+61 51 0.141414
+61 52 0.149188
+62 52 0.20773
+62 53 0.0371771
+63 53 0.276067
+63 54 0.0140229
+64 54 0.287741
+64 55 0.0108699
+65 55 0.461596
+65 60 0.011126
+66 56 0.627243
+66 60 0.0157815
+66 61 0.0122127
+67 57 0.488199
+67 61 0.0177159
+68 58 0.479821
+68 62 0.0121482
+69 59 0.303654
+69 60 0.0105558
+70 59 0.0113422
+70 60 0.405517
+70 61 0.0163693
+70 62 0.010016
+70 64 0.0114747
+71 60 0.0202893
+71 61 0.417286
+71 62 0.0265025
+71 63 0.0118155
+72 61 0.0240496
+72 62 0.323048
+72 63 0.0244174
+72 64 0.0151525
+73 62 0.0325948
+73 63 0.417022
+73 64 0.0213962
+73 65 0.01446
+74 63 0.0220079
+74 64 0.398229
+74 65 0.0218064
+75 64 0.0224602
+75 65 0.650758
+76 66 0.286689
+77 67 0.293382
+78 68 0.169285
+79 69 0.165512
+80 70 0.276995
+81 71 0.364451
+82 72 0.363923
+83 73 0.988123