view test-data/result.csv @ 5:6a17e1229b9f draft default tip

"planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mirdeep2/mirdeep2 commit 28870f676ce15ac711da6869c0c2f09f11d630e3"

miRDeep2 score	novel miRNAs reported by miRDeep2	novel miRNAs, estimated false positives	novel miRNAs, estimated true positives	known miRNAs in species	known miRNAs in data	known miRNAs detected by miRDeep2	estimated signal-to-noise	excision gearing
10	1	0 +/- 0	1 +/- 0 (88 +/- 33%)	7	6	5 (83%)	6.5	1
9	1	0 +/- 0	1 +/- 0 (88 +/- 33%)	7	6	5 (83%)	6.5	1
8	1	0 +/- 0	1 +/- 0 (88 +/- 33%)	7	6	5 (83%)	6.5	1
7	1	0 +/- 0	1 +/- 0 (88 +/- 33%)	7	6	5 (83%)	6.5	1
6	1	0 +/- 0	1 +/- 0 (88 +/- 33%)	7	6	5 (83%)	6.5	1
5	1	0 +/- 0	1 +/- 0 (88 +/- 33%)	7	6	5 (83%)	6.5	1
4	1	0 +/- 0	1 +/- 0 (88 +/- 33%)	7	6	5 (83%)	6.5	1
3	1	0 +/- 0	1 +/- 0 (88 +/- 33%)	7	6	5 (83%)	6.5	1
2	1	0 +/- 0	1 +/- 0 (88 +/- 33%)	7	6	5 (83%)	6.1	1
1	1	0 +/- 0	1 +/- 0 (78 +/- 42%)	7	6	6 (100%)	4.3	1
0	1	1 +/- 1	1 +/- 1 (53 +/- 50%)	7	6	6 (100%)	2.3	1
-1	1	1 +/- 1	0 +/- 1 (48 +/- 50%)	7	6	6 (100%)	2.1	1
-2	1	1 +/- 1	0 +/- 1 (48 +/- 50%)	7	6	6 (100%)	2	1
-3	1	1 +/- 1	0 +/- 1 (46 +/- 50%)	7	6	6 (100%)	1.8	1
-4	1	1 +/- 1	0 +/- 1 (46 +/- 50%)	7	6	6 (100%)	1.8	1
-5	1	1 +/- 1	0 +/- 0 (36 +/- 48%)	7	6	6 (100%)	2	1
-6	1	2 +/- 1	0 +/- 0 (4 +/- 20%)	7	6	6 (100%)	1.5	1
-7	1	2 +/- 1	0 +/- 0 (2 +/- 14%)	7	6	6 (100%)	1.4	1
-8	1	3 +/- 1	0 +/- 0 (0 +/- 0%)	7	6	6 (100%)	1.4	1
-9	1	3 +/- 1	0 +/- 0 (0 +/- 0%)	7	6	6 (100%)	1.4	1
-10	1	3 +/- 1	0 +/- 0 (0 +/- 0%)	7	6	6 (100%)	1.3	1



novel miRNAs predicted by miRDeep2
provisional id	miRDeep2 score	estimated probability that the miRNA candidate is a true positive	rfam alert	total read count	mature read count	loop read count	star read count	significant randfold p-value	miRBase miRNA	example miRBase miRNA with the same seed	UCSC browser	NCBI blastn	consensus mature sequence	consensus star sequence	consensus precursor sequence	precursor coordinate
chrII:11534525-11540624_7	102167.2	88 +/- 33%	-	200394	200381	0	13	yes	-	-	-	-	ucaccggguggaaacuagcagu	ugcugguuucuuccacaguggua	ugcugguuucuuccacagugguacuuuccauuagaacuaucaccggguggaaacuagcagu	chrII:11534525-11540624:3020..3081:+



mature miRBase miRNAs detected by miRDeep2
tag id	miRDeep2 score	estimated probability that the miRNA is a true positive	rfam alert	total read count	mature read count	loop read count	star read count	significant randfold p-value	mature miRBase miRNA	example miRBase miRNA with the same seed	UCSC browser	NCBI blastn	consensus mature sequence	consensus star sequence	consensus precursor sequence	precursor coordinate
chrII:11534525-11540624_11	61008.1	88 +/- 33%	-	119663	119545	0	118	yes	cel-miR-37	-	-	-	ucaccgggugaacacuugcagu	uguggguguccguugcggugcua	uguggguguccguugcggugcuacauucucuaaucuguaucaccgggugaacacuugcagu	chrII:11534525-11540624:3245..3306:+
chrII:11534525-11540624_17	17003.7	88 +/- 33%	-	33350	33300	0	50	yes	cel-miR-40	-	-	-	ucaccggguguacaucagcuaa	aguggauguaugccaugaugaua	aguggauguaugccaugaugauaagauaucagaaauccuaucaccggguguacaucagcuaa	chrII:11534525-11540624:3590..3652:+
chrII:11534525-11540624_9	7479.2	88 +/- 33%	-	14668	14617	0	51	yes	cel-miR-36	-	-	-	ucaccgggugaaaauucgcaug	cgccaauuuucgcuucagugcua	cgccaauuuucgcuucagugcuagaccauccaaagugucuaucaccgggugaaaauucgcaug	chrII:11534525-11540624:3123..3186:+
chrII:11534525-11540624_15	1974.9	88 +/- 33%	-	3872	3014	1	857	yes	cel-miR-39	-	-	-	ucaccggguguaaaucagcuug	agcugauuucgucuugguaaua	agcugauuucgucuugguaauaagcucgucauugagauuaucaccggguguaaaucagcuug	chrII:11534525-11540624:3494..3556:+
chrII:11534525-11540624_19	84.4	88 +/- 33%	-	164	68	9	87	yes	cel-miR-41	-	-	-	ggugguuuuucucugcagugaua	ucaccgggugaaaaaucaccua	ggugguuuuucucugcagugauagauacuucuaacaacucgcuaucaccgggugaaaaaucaccua	chrII:11534525-11540624:3715..3781:+
chrII:11534525-11540624_13	1.9	78 +/- 42%	-	2140	2132	8	0	yes	cel-miR-38	-	-	-	ucaccgggagaaaaacuggagu	uccgguuuuuuccguggugaua	uccgguuuuuuccguggugauaacgcauccaaaagucucuaucaccgggagaaaaacuggagu	chrII:11534525-11540624:3340..3403:+
chrII:11534525-11540624_12	-4.7	36 +/- 48%	-	119546	119545	1	0	no	cel-miR-37	-	-	-	ucaccgggugaacacuugcagu	uguuccgguuuuuuccguggugaua	ucaccgggugaacacuugcagugguccucgugguuucucugugagccagguccuguuccgguuuuuuccguggugaua	chrII:11534525-11540624:3284..3362:+

#miRBase miRNAs not detected by miRDeep2
miRBase precursor id	total read count	mature read count(s)	star read count	remaining reads	UCSC browser	NCBI blastn	miRBase mature sequence(s)	miRBase star sequence(s)	miRBase precursor sequence
4000	4000	0	0	-	-	aaugacacugguuaucuuuuccaucg	-	cgccggcaaugacacugguuaucuuuuccaucguggaaugccccccauugauuuuuuccccuuuucggggggaaaaaauuggaaacgagaaagguaucgggugucauagccggcg