Mercurial > repos > rnateam > mirdeep2_mapper
diff mapper.xml @ 4:dbbe92348c7a draft default tip
planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mirdeep2/mirdeep2_mapper commit 04c75332ac618b43ce5c3f307f7866e97147e865
| author | rnateam |
|---|---|
| date | Thu, 05 Apr 2018 08:55:27 -0400 |
| parents | a8d24f4b6d95 |
| children |
line wrap: on
line diff
--- a/mapper.xml Wed Jul 12 14:38:46 2017 -0400 +++ b/mapper.xml Thu Apr 05 08:55:27 2018 -0400 @@ -1,4 +1,4 @@ -<tool id="rbc_mirdeep2_mapper" name="MiRDeep2 Mapper" version="2.0.0"> +<tool id="rbc_mirdeep2_mapper" name="MiRDeep2 Mapper" version="2.0.0.8.1"> <description>process and map reads to a reference genome</description> <macros> <macro name="map_params"> @@ -28,36 +28,38 @@ <requirements> <requirement type="package" version="2.0.0.8">mirdeep2</requirement> </requirements> - <stdio> - <!-- Anything other than zero is an error --> - <exit_code range="1:" /> - <exit_code range=":-1" /> - <!-- In case the return code has not been set propery check stderr too --> - <regex match="Error:" /> - <regex match="Exception:" /> - </stdio> - <command> + <command detect_errors="aggressive"> <![CDATA[ - #if $operation.collapse_map == "collapse_and_map" or $operation.collapse_map == "only_map" #if $operation.refGenomeSource.genomeSource == "history" bowtie-build '$operation.refGenomeSource.ownFile' custom_bowtie_indices && #end if #end if - mapper.pl - - '$reads' - - #if $reads.extension.startswith("fasta") - -c - #else if $reads.extension.startswith("fastq") - -e - -h + mapper.pl + + #if $input.type == "single": + '$input.reads' + + #if $input.reads.extension.startswith("fasta") + -c + #else if $input.reads.extension.startswith("fastq") + -e + -h + #end if + #else: + '$samples' -d + + #if $input.reads_list[0].reads.extension.startswith("fasta") + -c + #else if $input.reads_list[0].reads.extension.startswith("fastq") + -e + -h + #end if #end if $remove_non_canon - + $convert_rna_dna #if $clip_adapter.clip == "true" @@ -69,10 +71,10 @@ #if $operation.collapse_map == "collapse_and_map" or $operation.collapse_map == "only_collapse" -m -s '$output_reads_collapsed' #end if - + #if $operation.collapse_map == "collapse_and_map" or $operation.collapse_map == "only_map" - -p - + -p + #if $operation.refGenomeSource.genomeSource == "history" custom_bowtie_indices #else @@ -80,15 +82,38 @@ #end if $operation.map_mismatch -r $operation.map_threshold - + -t '$output_mapping' #end if -v -n ]]> </command> + <configfiles> + <configfile name="samples"><![CDATA[#if $input.type == "multiple": +#for $r in $input.reads_list: +$r.reads $r.sample_name +#end for +#end if]]></configfile> + </configfiles> <inputs> - <param format="fastq, fasta" name="reads" type="data" optional="false" label="Deep sequencing reads" help="Reads in fastq or FASTA format"/> + <conditional name="input"> + <param name="type" type="select" label="Pool multiple read sets"> + <option value="single" selected="true">No</option> + <option value="multiple">Yes</option> + </param> + <when value="single"> + <param format="fastq,fasta" name="reads" type="data" label="Deep sequencing reads" help="Reads in fastq or FASTA format"/> + </when> + <when value="multiple"> + <repeat name="reads_list" title="Reads"> + <param name="sample_name" value="" type="text" label="Sample name" help="Must be a 3 letters/digits code"> + <validator type="expression" message="The sample name must be a 3 letters/digits code">len(value) == 3 and value.isalnum()</validator> + </param> + <param format="fastq,fasta" name="reads" type="data" optional="false" label="Deep sequencing reads" help="Reads in fastq or FASTA format"/> + </repeat> + </when> + </conditional> <param name="remove_non_canon" type="boolean" truevalue="-j" falsevalue="" checked="false" label="Remove reads with non-standard nucleotides" help="Remove all entries that have a sequence that contains letters other than a,c,g,t,u,n,A,C,G,T,U,N. (-j)"/> <param name="convert_rna_dna" type="boolean" truevalue="-i" falsevalue="" checked="false" label="Convert RNA to DNA alphabet (to map against genome)" help="(-i)"/> @@ -104,11 +129,11 @@ </when> <when value="false"/> </conditional> - + <param name="discard_short_reads" value="18" type="integer" optional="false" label="Discard reads shorter than this length" help="Set to 0 to keep all reads. (-l)"> <validator type="in_range" min="0" message="Minimum value is 0"/> </param> - + <conditional name="operation"> <param name="collapse_map" type="select" label="Collapse reads and/or Map" help="(-m) and/or (-p)"> <option value="collapse_and_map">Collapse reads and Map</option> @@ -144,7 +169,10 @@ </outputs> <tests> <test> - <param name="reads" value="reads.fa"/> + <conditional name="input"> + <param name="type" value="single"/> + <param name="reads" value="reads.fa"/> + </conditional> <param name="remove_non_canon" value="True"/> <param name="clip" value="true"/> <param name="adapter_seq" value="TCGTATGCCGTCTTCTGCTTGT"/> @@ -171,22 +199,57 @@ </assert_contents> </output> </test> + <test> + <conditional name="input"> + <param name="type" value="multiple"/> + <repeat name="reads_list"> + <param name="sample_name" value="sa1"/> + <param name="reads" value="reads_sample1.fa"/> + </repeat> + <repeat name="reads_list"> + <param name="sample_name" value="sa2"/> + <param name="reads" value="reads_sample2.fa"/> + </repeat> + </conditional> + <param name="remove_non_canon" value="True"/> + <param name="clip" value="true"/> + <param name="adapter_seq" value="TCGTATGCCGTCTTCTGCTTGT"/> + <param name="discard_short_reads" value="18"/> + <param name="collapse_map" value="collapse_and_map"/> + <param name="genomeSource" value="history"/> + <param name="ownFile" value="cel_cluster.fa"/> + <output name="output_reads_collapsed"> + <assert_contents> + <has_text text=">sa1_220_x1"/> + <has_text text="TCACCGGGTGTACATCAGC"/> + <has_text text=">sa2_0_x250"/> + <has_text text="AATGACACTGGTTATCTTTTCCATCG"/> + </assert_contents> + </output> + <output name="output_mapping"> + <assert_contents> + <has_line_matching expression="^.*22\t1\t22\ttcaccgggtggaaactagcagt\tchrII:11534525-11540624\t22\t3060\t3081.*$"/> + <has_line_matching expression="^.*21\t1\t21\ttcaccgggtggaaactagcag\tchrII:11534525-11540624\t21\t3060\t3080.*$"/> + <has_line_matching expression="^.*22\t1\t22\ttcaccgggtgtacatcagctaa\tchrII:11534525-11540624\t22\t3631\t3652.*$"/> + </assert_contents> + </output> + </test> </tests> <help> <![CDATA[ **What it does** -The MiRDeep2 Mapper module is designed as a tool to process deep sequencing reads and/or map them to the reference genome. -The module works in sequence space, and can process or map data that is in sequence FASTA format. +The MiRDeep2 Mapper module is designed as a tool to process deep sequencing reads and/or map them to the reference genome. +The module works in sequence space, and can process or map data that is in sequence FASTA format. A number of the functions of the mapper module are implemented specifically with Solexa/Illumina data in mind. **Input** -Default input is a file in FASTA format, seq.txt or qseq.txt format. More input can be given depending on the options used. +Default input is a file in FASTA format, seq.txt or qseq.txt format. More input can be given depending on the options used. **Output** -The output depends on the options used. Either a FASTA file with processed reads or an arf file with with mapped reads, or both, are output. +The output depends on the options used. Either a FASTA file with processed reads or an arf file with with mapped reads, or both, are output. Arf format: Is a proprietary file format generated and processed by miRDeep2. It contains information of reads mapped to a reference genome. Each line in such a file contains 13 columns: