Mercurial > repos > rnateam > mirdeep2_mapper
changeset 2:ab8cd78709e1 draft
planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mirdeep2/mirdeep2_mapper commit b9d202134c3c6d0e5c398c3ae75e410067fcfc52
| author | rnateam |
|---|---|
| date | Wed, 23 Nov 2016 16:32:13 -0500 |
| parents | 12fc62b7dc09 |
| children | a8d24f4b6d95 |
| files | mapper.xml tool_dependencies.xml |
| diffstat | 2 files changed, 35 insertions(+), 22 deletions(-) [+] |
line wrap: on
line diff
--- a/mapper.xml Thu Feb 12 09:46:55 2015 -0500 +++ b/mapper.xml Wed Nov 23 16:32:13 2016 -0500 @@ -40,17 +40,19 @@ #if $operation.collapse_map == "collapse_and_map" or $operation.collapse_map == "only_map" #if $operation.refGenomeSource.genomeSource == "history" - bowtie-build $operation.refGenomeSource.ownFile custom_bowtie_indices && + bowtie-build '$operation.refGenomeSource.ownFile' custom_bowtie_indices && #end if #end if + mapper.pl - $reads + '$reads' #if $reads.extension.startswith("fasta") -c #else if $reads.extension.startswith("fastq") - -e -h + -e + -h #end if $remove_non_canon @@ -64,7 +66,7 @@ -l $discard_short_reads #if $operation.collapse_map == "collapse_and_map" or $operation.collapse_map == "only_collapse" - -m -s $output_reads_collapsed + -m -s '$output_reads_collapsed' #end if #if $operation.collapse_map == "collapse_and_map" or $operation.collapse_map == "only_map" @@ -73,14 +75,12 @@ #if $operation.refGenomeSource.genomeSource == "history" custom_bowtie_indices #else - $operation.refGenomeSource.index + '$operation.refGenomeSource.index.fields.path' #end if - $operation.map_mismatch - -r $operation.map_threshold - -t $output_mapping + -t '$output_mapping' #end if -v -n @@ -95,7 +95,7 @@ <regex match="Exception:" /> </stdio> <inputs> - <param format="fastq, fasta" name="reads" type="data" optional="false" label="Deep sequencing reads" help="Reads in fastq or fasta format"/> + <param format="fastq, fasta" name="reads" type="data" optional="false" label="Deep sequencing reads" help="Reads in fastq or FASTA format"/> <param name="remove_non_canon" type="boolean" truevalue="-j" falsevalue="" checked="false" label="Remove reads with non-standard nucleotides" help="Remove all entries that have a sequence that contains letters other than a,c,g,t,u,n,A,C,G,T,U,N. (-j)"/> <param name="convert_rna_dna" type="boolean" truevalue="-i" falsevalue="" checked="false" label="Convert RNA to DNA alphabet (to map against genome)" help="(-i)"/> @@ -181,23 +181,36 @@ </tests> <help> <![CDATA[ -**What MiRDeep2 Mapper does** +**What it does** -The mapper module is designed as a tool to process deep sequencing reads and/or map them to the reference genome. -The module works in sequence space, and can process or map data that is in sequence fasta format. +The MiRDeep2 Mapper module is designed as a tool to process deep sequencing reads and/or map them to the reference genome. +The module works in sequence space, and can process or map data that is in sequence FASTA format. A number of the functions of the mapper module are implemented specifically with Solexa/Illumina data in mind. -**Example** +**Input** + +Default input is a file in FASTA format, seq.txt or qseq.txt format. More input can be given depending on the options used. -Processing reads and mapping them to a genome. +**Output** + +The output depends on the options used. Either a FASTA file with processed reads or an arf file with with mapped reads, or both, are output. + +Arf format: +Is a proprietary file format generated and processed by miRDeep2. It contains information of reads mapped to a reference genome. Each line in such a file contains 13 columns: -The -c option designates that the input file is a fasta file. The -j options removes entries with -non-canonical letters (letters other than a,c,g,t,u,n,A,C,G,T,U,N). The -k option clips adapters. The -l option discards reads shorter than 18 nts. -The -m option collapses the reads. The -p option maps the processed reads against the previously indexed genome (cel_cluster). The -s option -designates the name of the output file of processed reads and the -t option designates the name of the output file of the genome mappings. Last, --v gives verbose output to the screen. - - ``mapper.pl reads.fa -c -j -k TCGTATGCCGTCTTCTGCTTGT -l 18 -m -p cel_cluster -s reads_collapsed.fa -t reads_collapsed_vs_genome.arf -v`` +1. read identifier +2. length of read sequence +3. start position in read sequence that is mapped +4. end position in read sequence that is mapped +5. read sequence +6. identifier of the genome-part to which a read is mapped to. This is either a scaffold id or a chromosome name +7. length of the genome sequence a read is mapped to +8. start position in the genome where a read is mapped to +9. end position in the genome where a read is mapped to +10. genome sequence to which a read is mapped +11. genome strand information. Plus means the read is aligned to the sense-strand of the genome. Minus means it is aligned to the antisense-strand of the genome. +12. Number of mismatches in the read mapping +13. Edit string that indicates matches by lowercase 'm' and mismatches by uppercase 'M' ]]> </help>
--- a/tool_dependencies.xml Thu Feb 12 09:46:55 2015 -0500 +++ b/tool_dependencies.xml Wed Nov 23 16:32:13 2016 -0500 @@ -1,7 +1,7 @@ <?xml version="1.0"?> <tool_dependency> <package name="perl" version="5.18.1"> - <repository changeset_revision="114b6af405fa" name="package_perl_5_18" owner="iuc" prior_installation_required="True" toolshed="https://toolshed.g2.bx.psu.edu" /> + <repository changeset_revision="35f117d7396b" name="package_perl_5_18" owner="iuc" prior_installation_required="True" toolshed="https://toolshed.g2.bx.psu.edu" /> </package> <package name="bowtie" version="0.12.7"> <repository changeset_revision="9f9f38617a98" name="package_bowtie_0_12_7" owner="devteam" toolshed="https://toolshed.g2.bx.psu.edu" />