changeset 0:af18bb0baa92 draft

Imported from capsule None
author rnateam
date Tue, 27 Jan 2015 09:06:06 -0500
parents
children 12fc62b7dc09
files mapper.xml test-data/cel_cluster.fa test-data/reads.fa tool-data/bowtie_indices.loc.sample tool_data_table_conf.xml.sample tool_dependencies.xml
diffstat 6 files changed, 757116 insertions(+), 0 deletions(-) [+]
line wrap: on
line diff
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/mapper.xml	Tue Jan 27 09:06:06 2015 -0500
@@ -0,0 +1,208 @@
+<tool id="rbc_mirdeep2_mapper" name="MiRDeep2 Mapper" version="2.0.0">
+    <macros>
+        <macro name="map_params">
+            <conditional name="refGenomeSource">
+                <param name="genomeSource" type="select" label="Will you select a reference genome from your history or use a built-in index?" help="Map to genome. (-p)">
+                    <option value="indexed">Use a built-in index</option>
+                    <option value="history">Use one from the history</option>
+                </param>
+                <when value="indexed">
+                    <param name="index" type="select" label="Select a reference genome" help="If your genome of interest is not listed, contact your Galaxy admin.">
+                        <options from_data_table="bowtie_indexes">
+                        <filter type="sort_by" column="2"/>
+                            <validator type="no_options" message="No indexes are available for the selected input dataset"/>
+                        </options>
+                    </param>
+                </when> <!-- build-in -->
+                <when value="history">
+                    <param name="ownFile" type="data" format="fasta" metadata_name="dbkey" label="Select the reference genome" />
+                </when> <!-- history -->
+            </conditional> <!-- refGenomeSource -->
+            <param name="map_mismatch" type="boolean" truevalue="-q" falsevalue="" checked="false" label="Map with one mismatch in the seed (mapping takes longer)" help="(-q)"/>
+            <param name="map_threshold" value="5" type="integer" optional="false" label="A read is allowed to map up to this number of positions in the genome" help="Map threshold. (-r)">
+                <validator type="in_range" min="1" message="Minimum value is 1"/>
+            </param>
+        </macro>
+    </macros>
+    <description>
+<![CDATA[
+process and map reads to a reference genome
+]]>
+    </description>
+    <requirements>
+        <requirement type="package" version="2.0">mirdeep2_mapper</requirement>
+        <requirement type="package" version="0.12.7">bowtie</requirement>
+        <requirement type="package" version="5.18.1">perl</requirement>
+    </requirements>
+
+    <command>
+<![CDATA[
+
+        #if $operation.collapse_map == "collapse_and_map" or $operation.collapse_map == "only_map"
+            #if $operation.refGenomeSource.genomeSource == "history"
+                bowtie-build $operation.refGenomeSource.ownFile custom_bowtie_indices &&
+            #end if
+        #end if
+        mapper.pl 
+    
+        $reads
+        
+        #if $reads.extension.startswith("fasta")
+            -c
+        #else if $reads.extension.startswith("fastq")
+            -e -h
+        #end if
+
+        $remove_non_canon
+        
+        $convert_rna_dna
+
+        #if $clip_adapter.clip == "true"
+            -k $clip_adapter.adapter_seq
+        #end if
+
+        -l $discard_short_reads
+
+        #if $operation.collapse_map == "collapse_and_map" or $operation.collapse_map == "only_collapse"
+            -m -s $output_reads_collapsed
+        #end if
+        
+        #if $operation.collapse_map == "collapse_and_map" or $operation.collapse_map == "only_map"
+            -p 
+            
+            #if $operation.refGenomeSource.genomeSource == "history"
+                custom_bowtie_indices
+            #else
+                $index
+            #end if
+
+            $operation.map_mismatch
+
+            -r $operation.map_threshold
+            
+            -t $output_mapping
+        #end if
+
+        -v -n
+]]>
+    </command>
+    <stdio>
+        <!-- Anything other than zero is an error -->
+        <exit_code range="1:" />
+        <exit_code range=":-1" />
+        <!-- In case the return code has not been set propery check stderr too -->
+        <regex match="Error:" />
+        <regex match="Exception:" />
+    </stdio>
+    <inputs>
+        <param format="fastq, fasta" name="reads" type="data" optional="false" label="Deep sequencing reads" help="Reads in fastq or fasta format"/>
+        <param name="remove_non_canon" type="boolean" truevalue="-j" falsevalue="" checked="false" label="Remove reads with non-standard nucleotides" help="Remove all entries that have a sequence that contains letters other than a,c,g,t,u,n,A,C,G,T,U,N. (-j)"/>
+        <param name="convert_rna_dna" type="boolean" truevalue="-i" falsevalue="" checked="false" label="Convert RNA to DNA alphabet (to map against genome)" help="(-i)"/>
+
+        <conditional name="clip_adapter">
+            <param name="clip" type="select" label="Clip 3' Adapter Sequence" help="(-k)">
+                <option value="false">Don't Clip</option>
+                <option value="true">Clip Sequence</option>
+            </param>
+            <when value="true">
+                <param name="adapter_seq" value="" type="text" optional="false" label="Sequence to clip" help="Adapter Sequence can only contain a,c,g,t,u,n,A,C,G,T,U,N">
+                    <validator type="regex" message="Adapter can ONLY contain a,c,g,t,u,n,A,C,G,T,U,N">^[ACGTUacgtu]+$</validator>
+                </param>
+            </when>
+            <when value="false"/>
+        </conditional>
+        
+        <param name="discard_short_reads" value="18" type="integer" optional="false" label="Discard reads shorter than this length" help="Set to 0 to keep all reads. (-l)">
+            <validator type="in_range" min="0" message="Minimum value is 0"/>
+        </param>
+        
+        <conditional name="operation">
+            <param name="collapse_map" type="select" label="Collapse reads and/or Map" help="(-m) and/or (-p)">
+                <option value="collapse_and_map">Collapse reads and Map</option>
+                <option value="only_map">Map</option>
+                <option value="only_collapse">Collapse</option>
+            </param>
+            <when value="collapse_and_map">
+                <expand macro="map_params"/>
+            </when>
+            <when value="only_map">
+                <expand macro="map_params"/>
+            </when>
+            <when value="only_collapse"/>
+        </conditional>
+    </inputs>
+    <outputs>
+        <data format="fasta" name="output_reads_collapsed" label="Collapsed reads of ${tool.name} on ${on_string}">
+            <filter>
+            (
+            operation['collapse_map'] == "collapse_and_map" or
+            operation['collapse_map'] == "only_collapse"
+            )
+            </filter>
+        </data>
+        <data format="tabular" name="output_mapping" label="Mapping output of ${tool.name} on ${on_string} in ARF format">
+            <filter>
+            (
+            operation['collapse_map'] == "collapse_and_map" or
+            operation['collapse_map'] == "only_map"
+            )
+            </filter>
+        </data>
+    </outputs>
+    <tests>
+        <test>
+            <param name="reads" value="reads.fa"/>
+            <param name="remove_non_canon" value="True"/>
+            <param name="clip" value="true"/>
+            <param name="adapter_seq" value="TCGTATGCCGTCTTCTGCTTGT"/>
+            <param name="discard_short_reads" value="18"/>
+            <param name="collapse_map" value="collapse_and_map"/>
+            <param name="genomeSource" value="history"/>
+            <param name="ownFile" value="cel_cluster.fa"/>
+            <output name="output_reads_collapsed">
+                <assert_contents>
+                    <has_text text=">seq_349713_x268"/>
+                    <has_text text="TCACCGGGTGTANATCAGCTAA"/>
+                    <has_text text=">seq_354255_x214"/>
+                    <has_text text="TAACCGGGTGAACACTTGCAGT"/>
+                    <has_text text=">seq_357284_x187"/>
+                </assert_contents>
+            </output>
+            <output name="output_mapping">
+                <assert_contents>
+                    <has_line_matching expression="^.*22\t1\t22\ttcaccgggtggaaactagcagt\tchrII:11534525-11540624\t22\t3060\t3081.*$"/>
+                    <has_line_matching expression="^.*22\t1\t22\ttcaccgggtggaaactagtagt\tchrII:11534525-11540624\t22\t3060\t3081.*$"/>
+                    <has_line_matching expression="^.*22\t1\t22\ttcaccgggtgtacatcagcgaa\tchrII:11534525-11540624\t22\t3631\t3652.*$"/>
+                    <has_line_matching expression="^.*22\t1\t22\ttcaccgggagaaaaactggtgt\tchrII:11534525-11540624\t22\t3382\t3403.*$"/>
+                    <has_line_matching expression="^.*25\t1\t25\ttcaccgggtggaaactagcagtggc\tchrII:11534525-11540624\t25\t3060\t3084.*$"/>
+                </assert_contents>
+            </output>
+        </test>
+    </tests>
+    <help>
+<![CDATA[
+**What MiRDeep2 Mapper does**
+
+The mapper module is designed as a tool to process deep sequencing reads and/or map them to the reference genome. 
+The module works in sequence space, and can process or map data that is in sequence fasta format. 
+A number of the functions of the mapper module are implemented specifically with Solexa/Illumina data in mind.
+
+**Example**
+
+Processing reads and mapping them to a genome.
+
+The -c option designates that the input file is a fasta file. The -j options removes entries with
+non-canonical letters (letters other than a,c,g,t,u,n,A,C,G,T,U,N). The -k option clips adapters. The -l option discards reads shorter than 18 nts.
+The -m option collapses the reads. The -p option maps the processed reads against the previously indexed genome (cel_cluster). The -s option
+designates the name of the output file of processed reads and the -t option designates the name of the output file of the genome mappings. Last,
+-v gives verbose output to the screen.
+
+    ``mapper.pl reads.fa -c -j -k TCGTATGCCGTCTTCTGCTTGT  -l 18 -m -p cel_cluster -s reads_collapsed.fa -t reads_collapsed_vs_genome.arf -v``
+
+]]>
+    </help>
+    <citations>
+        <citation type="doi">10.1093/nar/gkr688</citation>
+        <citation type="doi">10.1002/0471250953.bi1210s36</citation>
+    </citations>
+</tool>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/cel_cluster.fa	Tue Jan 27 09:06:06 2015 -0500
@@ -0,0 +1,132 @@
+>chrII:11534525-11540624
+tccaaaatattagaggccccacgaaaaggggagcagaacgaaaaggggat
+ctgcaaaaaggggatctgcgaaaaggggagatacgaaaaggggagatacg
+aaaaggggagcaacgaaaaggggatctggcactgtgccaaacgctatttt
+tctcaaagaaaacaatacaacgatgctccgatgttacgcgtcgcgtgttg
+ttaagcgtatcttctagaagaaaatttcaaaaatcaacgtgcgttgcgtg
+agaaaaattgcgttttgtgcgtttggcacagtgccagctccccttttcgt
+tgctccccttttcgtatctccccttttcgtatctccccttttcgcagatc
+ccctttttgcagatccccttttcgttctgctcccctcgtggggcctcaaa
+taatattgtcaatggagcgcagttgcgcacaccgaaatacgcacgaaatt
+tgaaattggcaggcctagaaagtctggatttaaaatatttatgcatatta
+acctgagtttcggcatgtttagataaatttagattaaaatttattaaata
+aaaatatttaaaatttattaaattcaacattatctttaattttacagaaa
+taaaaaccaaaaaaccaacgaagtgtaacttttcgacaataaatatttat
+aaattattcaattaattggaaatctatttatcacatctcatcgtgaacaa
+gcacatggctaaacaatgcctcgactttatccacccatcctggatttttc
+ctgttgaaaatcttcaaatccttcatagtctgctcaattgccttaacagc
+cttttcccttttcacatccttcgtcaattcctcaaccatcgcctctacaa
+gttgtgatcgtgaggccccttcaacgaatttcttgtccaatacatctctg
+agctgaaaaataagtccctttattcatgtgcaccacctgccactcattca
+ttttagatcctaatcctgtatttctctctctctctcactaatcgtcccgt
+catatctgacccactataatgaggggaccaccactttgccccagatttcg
+taatgagccaacatacactaggccctgttctagcacccccattgtgcatg
+ggagacacatcgtctgttggttcgggtcagctgagatgacgtggcagatg
+acgtcatgtttgttctctagcagatccctatcgtaaaataccgttctttg
+ttcgtttatgagcacttcttgggaaacaagaagaatattagagaatattg
+gattttaggaaatttcttgaccctaataatatgtatctcatggggctaat
+tacgaaagatttagagctcactaaagcagatgtggataagctggaactat
+agtcaattctcacgagatattattattagcttactcgttgaatttgatgc
+cgtgttaggtagaagccgagaacacgatgaaccttggaagttatgtagtc
+gagttttctggaagaaaaagtatatatagtttgataaaaagttacgtcat
+aagttattggtcccgagtgtgtacactagaaacttgcgcaatcagttggt
+caggtggtctaggacctttacatgtaatataattcattggtttgttgctc
+tagatctcaaagaatatggttttcctgctgagaaacaaaatttttttttc
+aaatgttcgcgatattatacgatttttttgcgctgaaaaatacggtatcc
+ggactcgacacgacagtttttcaataaattcggaaaggtacatatgcgcc
+tttgaagagtactgtaattttaaacatttgttgatgcagtaaatattctc
+acggatttttagaggtttttttttgaatatttatacagttatattagagt
+taaaaaaataaatctatttttatcgaaatttatgaaaaatctactcccca
+gaaacaaagtttgaatttacttaaaatgtatgtgcgcctttttaaattca
+acaaaaatttatcaaattttgtctttttaatcacttttacttttttttcg
+aaaaaaaaaaaaactttaaaaacaccgaaaattaaaatttttaattaccg
+taatcctttaaaggcgcacacctctttttcgcaatcataaaaatttacag
+gcacagaatttcctactgtaacgtgttttctcgatagaaacgtttctcca
+aatcgaaatttttattagcaatcatcaattcgtcatgtttctgtgctgga
+gcacattgttatgcagtgctcatgaatattcacagttgaaaatcgaattt
+ttttttcttatttttattaacttctctcctcactcaagtgcaatctcatt
+tcggcggaacgatgaaagcggactcgtttgaaacggattacactgctggc
+tggctccatcttttttatttctggtttttttcccgacacgggaggtcatc
+cgtccacgtcttcaatcttattcgcttctccttctatctatctctcttcc
+aaaaaaatggaacagattgtccgccttctactttccgcatgcgcctattc
+tagacatcgagaagaagcgagagaatccgaaaaactccgccgtccggcgc
+ctagcgttcatcccgtcgcatccaatttccttcacccctgtctccagtct
+ctaatctgtgtttcccagaccttctccttcttcttctcccctctttcttc
+cctttcttttctacgattcctagacctgcccggttgaccatcgggcccac
+catttatcgagcgcgtccgtctgttcgttgctgtgagcgcgcgcgcgcga
+gcgcacactgcacaccatttgaccgcaacgagccgagagagtgtgtgaaa
+tgaagagacgccgagtggacacgttgctctacaccaaacgcgctacacca
+aatgggcggagacccaatggtgcaccaagtcagcagtataaaaggaatgg
+aaatggtccattcagtcatcagttgtttttttattttctcttttctccca
+tcactttctcccttcttcccctctcctaatttccattcccaactattatt
+ctcggatcagatcgagccattgctggtttcttccacagtggtactttcca
+ttagaactatcaccgggtggaaactagcagtggctcgatcttttccactt
+gctccaccgctgtcggggaaccgcgccaattttcgcttcagtgctagacc
+atccaaagtgtctatcaccgggtgaaaattcgcatgggtccccgacgcgg
+aaagataaaatatcttaaaatcgattctagaaacccttggaccagtgtgg
+gtgtccgttgcggtgctacattctctaatctgtatcaccgggtgaacact
+tgcagtggtcctcgtggtttctctgtgagccaggtcctgttccggttttt
+tccgtggtgataacgcatccaaaagtctctatcaccgggagaaaaactgg
+agtaggacctgtgactcattccgatttctggagttttcccctacattcta
+ccattcagctactgattattgaattcctgatataccgagagcccagctga
+tttcgtcttggtaataagctcgtcattgagattatcaccgggtgtaaatc
+agcttggctctggtgtctccgaacctcctgtccgcacctcagtggatgta
+tgccatgatgataagatatcagaaatcctatcaccgggtgtacatcagct
+aaggtgcgggtacaggtgcatttgatatcaaggtgagttatttttaagtg
+ggtcccagagaccttggtggtttttctctgcagtgatagatacttctaac
+aactcgctatcaccgggtgaaaaatcacctaggtctggagcctcctgctc
+tttttttgctgtttttaaacttaaacttaaaactaacactttatcaaaat
+aaagtcttccaaaatcttttttctgatctgccggaagactttccatgaat
+ttgtccaaaactcgttgcactttatcctcgtcgtaatcatttgacaccat
+atctttggataactagaataattgaacattggtttaaaaaaattctctca
+aaaaaaaaatcacaaacctgatgaattttagcctcatctatagcagtatc
+tgcgagaagaatcgtaagattcattgataattctatatattttccaataa
+ttttatccgaagctggatgtgaagtttctacagtacctccgtggcataat
+actacaatggaagcaaaaagagcgacaattaggatcgtcattttagtgga
+gaatgatgaattgacccggctctttgggggttggaggattcattttcccc
+ttcaacaggtgctcaaataattaaagagaatagaaccgacgatatatggg
+tcaaatgtttatacagttgtgctactaaacgtattgttacacgcgttatt
+aataattagaattagaattatatcgttttgtacggattgagaatcccatt
+tgggtcgaaaatgttcttgagcttctttgtcaaaagtcgttcttcaggat
+cttttccgaatgtggagtacggtagcttcagttgaccgattccatgttca
+gctgaaattgacccgccgtgatcgacaacccattcgtagaggaagggata
+gagcctggaatttgaaattattaatagaattaaaattttataaaaaagaa
+aaatctcgaaacttacaatttttcaagttcttcattgtgtttttcagatg
+taatatttaaatgagtgtttccatctcccaaatgtccataagtgacaatt
+cttttagccaaagaaccacatcgttccttcatcacattcgtcaattcata
+ataattttccaatggtaaagaaacatcatgcttatagacatatccatctc
+tggtaaccgccaatggtgcactttctctcaattgccacatcttcgtagct
+tctgcagaagatccagcgagcactccgtcgataatcagattttttgagag
+gcattcatccaaaaatgcgctcattttctccatatcgtgatcttcattgg
+atcctgatgtttcgacaaggatcgagaatggggttggagcattcagtact
+gggtgcaatcctagattcgttttcaaacattccatcgtagcatcgtcgag
+aagttcgaaggaggaaaggatttcagtgaggctggattttgcaagcttca
+gtacttcgcagcattttttgaaggattcgatgcctgaaaaaaattagaaa
+ttgaaaaatttgaacccattatataaatattcaacctaccaagcatcgca
+ctttgtacacttttcggtttaggaaccgcagtcattgtgacgcttgtgat
+aacacccaactgcccttcacttcccaagaataggtgtggagtgtgcaaag
+ttgtgttgtccttccgaatgcttgatcccaaatgtagaacagttccatgt
+tcatcgggaagaaccaccgtgagcccgagaagatgtgcgtgaagacttcc
+gtatcgaatcaaccgaatccctcctgcacacgtggcaatatttcctccaa
+tctgacaggatcctttggctccgagatcaaaaggcatcatatatccgagt
+tttgcaagtttgttgtccaagtcttccagaataaaaccagaatcacactt
+gagaattcccattgtgtcgtcgaaagagaattgcttgttgattttattca
+ttgatataacaacttcatcatgtactggaattgatccaccaacgagtcct
+gtattccctccttgtgggactactgccaatttgttcttggagcaatacgc
+caatattgcagaaacctcttcggtgctcttcgggtagaggacgacactgc
+caggacctggaaattaaaacatttaatatttaaagtacctatttaatatt
+aaataaacctaatcttaaaatacaaatacctttaaattggcctgtccaat
+ctgtagtatgatttgtaatatcgtccttcttcactgcatcttgcccgaga
+aaattctcaaatgccattaaatccgactgcatcacttttgcaaatccttc
+atgtctggcggcaagaactgctgcgtagcttctagttggtcttctgattc
+gtggcaagattttcagaaacatctgaattcagaaacttttcaaaaaataa
+cttgaaacttcaaaagaaatagtaggagacaaagctcggctaggtgaccg
+
+>chrIII:2172325-2172669
+CAGGCAGTCAGTCAGTCTCTCTCCACTCACATTCAGTCAGTCAGTGACCA
+TCACCAGGTTGTGTGTGAGCCCCTTCCATTATTCTTCTGAACCCCCCTCC
+CAACGCGGGAAGACTCGCCGGCAATGACACTGGTTATCTTTTCCATCGTG
+GAATGCCCCCCATTGATTTTTTCCCCTTTTCGGGGGGAAAAAATTGGAAA
+CGAGAAAGGTATCGGGTGTCATAGCCGGCGTGATCATCTTCCTCAAGTAT
+TCCTCTGCTGATTTCGATATTCGGAGGAGCTCGGAGGCTGTTCAGCTGTA
+AAATTGGTTGATTAAGCTCAAAAATCGGCGTTAACGCGGCTTTCC
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/reads.fa	Tue Jan 27 09:06:06 2015 -0500
@@ -0,0 +1,756666 @@
+>nematode_1
+TCACCGGGTGTAAATCAGCTTGTCGTATGCCGTCT
+>nematode_2
+TCACCGGGTGAACACTTGCAGTTCGTATGACGTCT
+>nematode_3
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_5
+TCACCGGGTGGAAACTAGCTGTCGTATGCCGTCTT
+>nematode_6
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_7
+TCACCGGGGGGAAACTAGCAGTTCGTATGCTGTTT
+>nematode_8
+TCACCGGGTGAACACCTGCAGTTCGTATGCCGTCT
+>nematode_9
+TCACCGGGCGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_10
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_11
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_12
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_13
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_14
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_15
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_16
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_17
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_18
+TCACCGGGTGGAAACTAGCAGTCGTATGCCGTCAT
+>nematode_19
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_20
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_21
+TCACCGGGTGAAAATTCGCATGTCGTATGCCTTCT
+>nematode_22
+TCACCGGGAGGAAACTAGCAGTCGTATGCCGTCTT
+>nematode_23
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_24
+TCACCGAGTGAACACTTGCATCGTATGCCGTCTTT
+>nematode_25
+TCACCGGGTGGAAACTAGCAGTTTCGTATGCCGTC
+>nematode_26
+TCACCGGGTGGAAACTAGCAGTATCGTATGCCGTT
+>nematode_27
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTTT
+>nematode_28
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_29
+TCACCGGGCGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_30
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_31
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_32
+TCACCGGGTGGAAACTAGCAGATCGTATGCCGTCT
+>nematode_33
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_34
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_35
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_36
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_37
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_38
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_39
+AGCTGATTTCGTCTTGGTAATATCGTATGCCGTCT
+>nematode_40
+TCACCGGGTGGCAACTAGCAGTTCGTATTCCGTGT
+>nematode_41
+ACCGGGTGGAAACTAGCAGTTCGTATGCCGTCTTC
+>nematode_42
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_43
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_44
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_45
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_46
+TCACCGGGTGGAAACTATCAGTTCGTATGCCGTCT
+>nematode_47
+ACCGGGTGTACATCAGCTAATCGTATGCCGTCTTC
+>nematode_48
+TCACCGGGTGAACACTTGCAGTTTCGTATGCAGTC
+>nematode_49
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_50
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_51
+AGCTAATTTCGTCTTGGTAATATCGTATGCCGTCT
+>nematode_52
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_53
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_54
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_55
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_56
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_57
+ACCGGGTGAACACTTGCAGTTCGTATGCCGTCTTT
+>nematode_58
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_59
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_60
+TCACCGGGTGGAAACTAGCAGTTTCGTATGCCGTT
+>nematode_61
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_62
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_63
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_64
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_65
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_66
+TCACCGGGTGGAAACTAGCATTTCGTATGCCGTCT
+>nematode_67
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_68
+TCACCGGGTGTACATCAGCTATCGTATGCCGTCTT
+>nematode_69
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_70
+TCACCGGGTGTAGATCAGCTAATCGTATGCTGTCT
+>nematode_71
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_72
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_73
+ACCGGGTGGAAACTAGCAGTCGTATGCCGTCTTCT
+>nematode_74
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_75
+TCACCGCGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_76
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_77
+TCACCGGGTGAACACTTGCAGTTCGTATGCAGTCT
+>nematode_78
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_79
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_80
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_81
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_82
+TCACAGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_83
+TCACCGGGTGGAAACTAGCAGTTCGTATTCTGTCT
+>nematode_84
+TCACAGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_85
+TCACCGGGCGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_86
+TCACCGGGTGAACAATTGCAGTTCGTATGCCGTCT
+>nematode_87
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_88
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_89
+TCACCGGGTGGAAACTAGCAGTCGTATGCCGTCTT
+>nematode_90
+CACCGGGTGAACACTTGCAGTTCGTATGCCGTCTT
+>nematode_91
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_92
+TCACCGGGTGGAAACTAGCAGTTTCGTATGCCGTC
+>nematode_93
+TCACCGGGTGAACACTTGCATCGTATGCCGTCTTC
+>nematode_94
+TCACCGGGTGAACACTTGCAGTCGTATGCCGTCTT
+>nematode_95
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_96
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_97
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_98
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_99
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_100
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_101
+TCACAGGGTGAACACTTGCAGTTCGTATGCGGTCT
+>nematode_102
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_103
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_104
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_105
+TCACCGGGTGTACATCAGCTAATCGTATTCCGTCT
+>nematode_106
+TCACCGGGTGGAAACTAGCAGTTCGTATTCCGTCT
+>nematode_107
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_108
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_109
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_110
+TCACCGGGTGAACACTTGCAGTTCGTATGCAGTCT
+>nematode_111
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_112
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_113
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_114
+TCACCGGGAGGAAACTAGCAGTTCGTATGTCGTCT
+>nematode_115
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_116
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_117
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_118
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_119
+TCACCGGGTGGAAACTAGCAGTCGTATGCCGTCTT
+>nematode_120
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_121
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_122
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGCTT
+>nematode_123
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_124
+TCACCGCGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_125
+TCACCGGGTGGAAACTAGCAGTTCGTATGTCGTCT
+>nematode_126
+TCACCAGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_127
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_128
+TCACCGGGTGAACACTTGCAGTTCGTATTCCGTCT
+>nematode_129
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_130
+TCACCGGGTGGAAACTAGCAGTCGTATGCCGTCTT
+>nematode_131
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_132
+TCACCGGGTGGAAACTAGCAATTCGTATGCCGTCT
+>nematode_133
+TCACCGGGTGGAAACTAGCAGTCGTATGCCGTCTT
+>nematode_134
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_135
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_136
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_137
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_138
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_139
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_140
+TCACAGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_141
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_142
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_143
+TCACCGGGTGGAAACTAGCAGTATCGTATGCCGTC
+>nematode_144
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_145
+TCACCGGGTGTACATCCGCTATCGTATGCCGTCTT
+>nematode_146
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_147
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_148
+TCACCGGGTGTACATCAGCTAATCGTATCCGGTCT
+>nematode_149
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_150
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_151
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGCCT
+>nematode_152
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_153
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_154
+TCACCGGGTGGAAACTAGCAGTCGTATGCCGTCTT
+>nematode_155
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_156
+TCACCGGGTGTAAATCAGCTTGTCGTATGCCGTCT
+>nematode_157
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_158
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_159
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_160
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_161
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_162
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_163
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_164
+TCACCGGGGGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_165
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_166
+TCACCGGGTGTAAATCAGCTAATCGTATGCCGTTT
+>nematode_167
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_168
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_169
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_170
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_171
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_172
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_173
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_174
+TCACCGGGGGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_175
+TCACCGGGTGCACATCAGCTAATCGTATGCCGTCT
+>nematode_176
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_177
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_178
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_179
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_180
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_181
+TCACCGGGTGAACACTGGCAGTTCGTATGCCGTTT
+>nematode_182
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_183
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_184
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_185
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_186
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_187
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_188
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_189
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_190
+TCACCGGGGGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_191
+TCACCGGGTGAACACTTGCAGTTCGTATGCCTTCT
+>nematode_192
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_193
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_194
+TCACCGGGTGGTAACTAGCAGTTCGTATGCCGTCT
+>nematode_195
+TCACCGGGTGGAAACTAGCAGTTCGTATGACGCCT
+>nematode_196
+TCACCGGGAGAACACTTGCAGTTCGTATGCTGTCT
+>nematode_197
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_198
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_199
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_200
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_201
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_202
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_203
+TCACCGGGCGAACACTTGCAGTTCGTATGACGTCT
+>nematode_204
+TCACAGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_205
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_206
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_207
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_208
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_209
+TCACCGGGCGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_210
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_211
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_212
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_213
+TCACCGGGCGGAAACTAGCAGTTCGTATCCCTTCT
+>nematode_214
+TCACCGGGTGTACTTCAGCTAATCGTATGCCGTCT
+>nematode_215
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_216
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_217
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_218
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_219
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_220
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_221
+TCACCGGGTGGAAACTAGCAGTCGTATGCCGTCTT
+>nematode_222
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_223
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_224
+TCACCGGGAGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_225
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_226
+TCACCGGGTGGAAACTAGCAGTTCGTATGCTGTCT
+>nematode_227
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_228
+TCACCGGGGGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_229
+TCACCGGGTGGAAACTAGCAGTTTCGTATGCCGTC
+>nematode_230
+TCACAGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_231
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_232
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_233
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_234
+TCACCGGGTGAACACTTGCAGTTCGTATGCAGTCT
+>nematode_235
+TCACCGGGTGGAAACTAGCAGTCGTATGCCGTCTT
+>nematode_236
+TCACCGGGTGTACATCAGCTCGTATGCCGTCTTCT
+>nematode_237
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_238
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_239
+TCACCGGGTGGAAACTAGCAGTTTCGTATGCCGTC
+>nematode_240
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_241
+TCACCGGGTGGAAACTAGCAGTCGTATGCCGTCTT
+>nematode_242
+TCACCGGGTGTACATCAGCTAATTCGTATGCCGTC
+>nematode_243
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_244
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_245
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_246
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_247
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_248
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_249
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_250
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_251
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_252
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_253
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_254
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_255
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_256
+TCACCGGGTGGAAACTAGCAATTCGTATGCCGTCT
+>nematode_257
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_258
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTTT
+>nematode_259
+TCACCGGGTGGAAACTAGCAGTATCGTATGACGAC
+>nematode_260
+TCACCGGGTGAAAATTCGCATGTCGTATGCCTTCT
+>nematode_261
+TCACCGGGTGGAAACTAGCAGTTCGTATGACGTCT
+>nematode_262
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_263
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_264
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_265
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_266
+TCACCGGGTGGAAACTAGCAGTTCGTATGCTGTCT
+>nematode_267
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_268
+TCACCGGGTGAAAACTAGCAGTTCGTATGCCGTCT
+>nematode_269
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_270
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_271
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_272
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_273
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_274
+TCACCGGGTGAACACTTGCAGTCGTATGCCGGCTT
+>nematode_275
+TCATCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_276
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_277
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_278
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_279
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_280
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_281
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_282
+TCACCGGGTGAACACTTGCTGTTCGTATGCCGTCT
+>nematode_283
+TCACCGGGTGGAAACTAGCAGTTCGTATGTCGTCG
+>nematode_284
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_285
+TCACAGGGTGGAAACTAGCAGTTCGTATGCCGGCT
+>nematode_286
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_287
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_288
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_289
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_290
+TCACCGGGCGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_291
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_292
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_293
+TCACCGGGTGGAAACTAGCAGTATCGTATGCCGTC
+>nematode_294
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_295
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_296
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_297
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_298
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_299
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_300
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_301
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_302
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_303
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_304
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_305
+TCACCGGGCGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_306
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_307
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_308
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_309
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_310
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_311
+TCACCGGGTGGAAACTAGCAGTATCGTATGCCGTC
+>nematode_312
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_313
+TCACCGGGTGAACACTTGCAGTTTCGTATGCCGTC
+>nematode_314
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGGCT
+>nematode_315
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_316
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_317
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_318
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_319
+TCACCGGGTGGAAAATAGCAGTTCGTATGCCGTCT
+>nematode_320
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_321
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_322
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_323
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_324
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_325
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_326
+TCACCGGGTGGAAACTAGCAGTTTCGTATGCCGTC
+>nematode_327
+TCACCGGGAGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_328
+TCACCGGGTGGAAACTAGCAGTTTCGTATGCCGTC
+>nematode_329
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_330
+TCACCGGGTGTAAATCAGCTTCTCGTATGCCGTCT
+>nematode_331
+TCACCGGGTGGAAACTAGCAGTTCGTATGCTGTCT
+>nematode_332
+TCACCGGGTGTAAATCAGCTTGTCGTATGCCGTCT
+>nematode_333
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_334
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_335
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_336
+TCACCGGGCGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_337
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_338
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_339
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_340
+TCACCGGGTGGAAACTAGCAGTTTCGTATGACGTC
+>nematode_341
+TCACCGGGTGTACATCAGCTATCGTATGCCGTCTT
+>nematode_342
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_343
+TCACCGGGTGAACACTTGCAGATCGTATGCCGTCT
+>nematode_344
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_345
+TCACCGGGTGAAAACTAGCAGTTCGTATGCCGTCT
+>nematode_346
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_347
+TCACCGGGAGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_348
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_349
+TCACCGGGTGGAAACAAGCAGTTCGTATGCCTTCT
+>nematode_350
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_351
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_352
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_353
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_354
+TCACCGGGTGGAAACTAGCAGNTCGTATGCCGTCT
+>nematode_355
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_356
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_357
+TCACCGGGTGAAAATTCGCATGTTCGTATGCCGTC
+>nematode_358
+TCACCGGGTGTAAATCAGCTTGTCGTATGCCGTCT
+>nematode_359
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_360
+TCACCGGGTGAACACTTGCAGTCGTATGCCGTCTT
+>nematode_361
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_362
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_363
+TCGCCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_364
+TCACCGGGTGGAAACTAGCAGTCGTATGCCGTCTT
+>nematode_365
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_366
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_367
+TCACCGGGTGGCAACTAGCAGTTCGTATGCCGTCT
+>nematode_368
+TCACCGGGTGGAAACTAGCAGTTCGTATTTTGTCT
+>nematode_369
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_370
+TCACAGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_371
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_372
+TCACCGGGTGGAAACTAGCAGCTCGTATGCCGTCT
+>nematode_373
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_374
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_375
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_376
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_377
+TCACCGGGTGGAAAATAGCAGTTCGTATGCCGTCT
+>nematode_378
+TCACCGGGTGAAAACTTGCAGTTCGTATGCCGTCT
+>nematode_379
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_380
+TCACCGGGCGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_381
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_382
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_383
+TCACCGGGTGGAAACTAGCATCGTATGCCGTCTTC
+>nematode_384
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_385
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_386
+TCACCGGGTGGAAACTAGCAGTCGTATGCCGTCTT
+>nematode_387
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_388
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_389
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_390
+TCACCGGGTTAACACTTGCAGTTCGTATGCCGTCT
+>nematode_391
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_392
+TCACCGGGTGAACACTTGCACTTCGTATGCCGTCT
+>nematode_393
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_394
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_395
+TCACCGGGTGAACACTTGCATTTCGTATGCCGTCT
+>nematode_396
+TCACCGGGTGGAAACTAGCAGCTCGTATGCCGTCT
+>nematode_397
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_398
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_399
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_400
+TCACCGGGTGGAAATTAGCAGTTCGTATGCCGTCT
+>nematode_401
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_402
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_403
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_404
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_405
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_406
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_407
+TCACCGGGCGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_408
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_409
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_410
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCTTCT
+>nematode_411
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_412
+TCACCGGATGTACATCAGCTAATCGTATGCCGTCT
+>nematode_413
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_414
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_415
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_416
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_417
+TCACCGGGAGAAAAACTGGAGTTCGTATGCCGTCT
+>nematode_418
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_419
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_420
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_421
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_422
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_423
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_424
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_425
+TCACCGGATGGAAACTAGCAGTTCGTATGCCGCCT
+>nematode_426
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_427
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_428
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_429
+TCACCGGGTGGAAACTAGCAGTTCGTATGCAGTAT
+>nematode_430
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_431
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_432
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_433
+TCACCGGGTGAACTCTTGCAGTTCGTATGCTGTCT
+>nematode_434
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_435
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_436
+TCACCGGGTGGAAACTAGCAGTCGTATGCCTTCTT
+>nematode_437
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_438
+TCACCGGGTGGAAACTAGCAGTCGTATGCCGTCTT
+>nematode_439
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_440
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_441
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_442
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_443
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_444
+TCACCGGGTGGAAACTAGCATCGTATGCCGTCTTC
+>nematode_445
+TCACCGGGTGGAAACTAGCAGATCGTATGCCGTCT
+>nematode_446
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_447
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_448
+TCACCGGGGGGAAACTAGCAGTCGTATGCCGTCTT
+>nematode_449
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_450
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_451
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_452
+TCACCGGGTGAACACTTGCAGTCGTATGCCGTCTT
+>nematode_453
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_454
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_455
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_456
+TCACCGGGTGGAAACTAGCAGTCGTATGCCGTCTT
+>nematode_457
+TCACCGGCTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_458
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_459
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_460
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_461
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_462
+TCACCGGGTGGAAACGAGCAGTTCGTATGCTGTCT
+>nematode_463
+TCACCGGGTGAACACTTGTAGTTCGTATGCCGTCT
+>nematode_464
+TCACCGGGGGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_465
+TCACCGGGGGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_466
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_467
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_468
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_469
+TCACTGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_470
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_471
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_472
+TCACCGGGGGAAAATTCGCATGTCGTATGGCGTCT
+>nematode_473
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_474
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_475
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_476
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_477
+TCACCGGGGGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_478
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_479
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_480
+TCACCGGGAGAAAAACTGGAGCTCGTATGCCGTCT
+>nematode_481
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_482
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_483
+TCACCGGGTGGAAACTATCAGTTCGTATGCCGTCT
+>nematode_484
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_485
+TCACCGGGTGAACACTTGCAGTCGTATGCCGTCTT
+>nematode_486
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_487
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_488
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_489
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_490
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_491
+TCACCGGGTGGAAACTAGCAGTCGTATGCCGTCTT
+>nematode_492
+GCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_493
+TCACCGGGTGGAAACTAGCAGTCGTATGCCGTCTT
+>nematode_494
+TCACCGGGTGTACATCAGCTATCGTATGCCGTCTT
+>nematode_495
+TCACCGGGTGAACACTTGCATCGTATGCCGTCTTC
+>nematode_496
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_497
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_498
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_499
+TCACCGCGTGGAAACTAGCAGTTCGTATTCCTCCT
+>nematode_500
+TCACCGGGTGAAAATTCGCATCTCGTATGCCGTCT
+>nematode_501
+TCACCGGGTGGAAACTAGCAGTTCGTATGACGTCT
+>nematode_502
+TCACCGGGTGGAAACTAGCAGGTCGTATGCCGTCT
+>nematode_503
+TCACAGGGTGAAAATTCGCATTCGTATGCTGTCTT
+>nematode_504
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_505
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_506
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_507
+TCACCGGGTGAACACTTGCAGTCGTATGCCGTCTT
+>nematode_508
+TCACCGGGTGAACACTTGCAGTTCGTATGCCTTCT
+>nematode_509
+TCACCGGGTGGAAACTAGCAGTTTCGTATGCCGTC
+>nematode_510
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_511
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_512
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_513
+ACCGGGTGGAAACTAGCAGTTCGTATGCCGTCTTC
+>nematode_514
+TCACCGGGTGGAAACTAGCAGTCGTATGCCGTCTT
+>nematode_515
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_516
+AGCTGATTTCGTCTTGGTAATATCGTATGCCGTCT
+>nematode_517
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_518
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_519
+TCACCGGGTGAACACTTGCAGTATCGTATGCCGTC
+>nematode_520
+TCACCGGGTGGAAACTAGCAGTTCGTATGACGTCT
+>nematode_521
+TCACCGGGTGGAAACTAACAGTTCGTATGCAGTCT
+>nematode_522
+AGCTGATTTCGTCTTGGTAATATCGTATGTCGTCT
+>nematode_523
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_524
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_525
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_526
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_527
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_528
+ACCGGGTGTACATCAGCTAATCGTATGCCGTCTTC
+>nematode_529
+TCACCGGGTGAAAACTTGCAGTTCGTATGCCTTCT
+>nematode_530
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_531
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTAT
+>nematode_532
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_533
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_534
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_535
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_536
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_537
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_538
+TCACCGGGTGGAAACTAGCAGTTTCGTATTCCTTC
+>nematode_539
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_540
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_541
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_542
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTTT
+>nematode_543
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_544
+TCACCGGGTGGAAACTAGCAGTTCGTATGACGTCT
+>nematode_545
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_546
+TCACCGCGTGAACACTTGCAGTTCGTATGCCGCCT
+>nematode_547
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_548
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_549
+TCACCGGGTGTAAATCAGCTTGTCGTATGCCGTCT
+>nematode_550
+TCACCGCGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_551
+CACCGGGGGGAAACTAGCAGTTCGTATTCCGTCTT
+>nematode_552
+TCACCGGGTGAACACTTGCAGTTTCGTATGCCGTC
+>nematode_553
+TCACCGGGTGGAAACTAGCAGTTCGTATGCAGACT
+>nematode_554
+ACCGGGTGGAAACTAGCAGTTCGTATGCCGTCTTC
+>nematode_555
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_556
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_557
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_558
+TCACCGGGTGAACACTTGCAGTCGTATGCCGTCTT
+>nematode_559
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_560
+TCACCGGGTGGAAACTAGCAGATCGTATGGCGTCT
+>nematode_561
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_562
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_563
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_564
+TCACCGGGTGGAAACTAGCAGTTCGTATTCCGTCT
+>nematode_565
+TCACCGGGTGTACTTCAGCTAATCGTATGCCGTCT
+>nematode_566
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_567
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_568
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_569
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_570
+TCACCGGGTGGAAACTTGCAGTTCGTATGCCGTCT
+>nematode_571
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_572
+TCACCGGGTGGAAACTAGCAGTCGTATGGCGTCTT
+>nematode_573
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_574
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_575
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_576
+ACCGGGTGTACATCAGCTAATCGTATGCCGTCTTC
+>nematode_577
+TCACCGGGTGAACACTGGCAGTTCGTATGCCGTTT
+>nematode_578
+TCACAGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_579
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_580
+TCACCGGGAGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_581
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_582
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_583
+TCACCGGGTGAACACTTGCATCGTATGCCGGCTTT
+>nematode_584
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_585
+TAACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_586
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_587
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_588
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_589
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_590
+TCACCGGGTGGAAACTAGCAGTTTCGTATGCCGTC
+>nematode_591
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_592
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_593
+TCACCGGGTGGAAACTAGCAGTCGTATGCCGTCTT
+>nematode_594
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_595
+TCACCGGGTGGAAACTAGCAGTTCGTATGACGTCT
+>nematode_596
+TCACCGGGTGTAAATCAGCTTGTCGTATGCCGTCT
+>nematode_597
+TCACCGGGTGAACACGTGCAGTTCGTATGCCGTCT
+>nematode_598
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_599
+TCACCGGGTGTAAATCAGCTTGTCGTATGCCGTCT
+>nematode_600
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_601
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_602
+TCACAGGGTGGAAACTAGCAGTCGTATCCCGTCTT
+>nematode_603
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_604
+TCACCGGGTGTAAATCAGCTTGTCGTATGCCGTCT
+>nematode_605
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_606
+TCACCGGGTGGAAACTAGCAGTTCGTATGGCGTCT
+>nematode_607
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_608
+TCACCGGGTGGAATCTAGCAGTTCGTATGCCGTCT
+>nematode_609
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_610
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_611
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_612
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_613
+TCACCGGGTGAACACTTGCAGTTCGTATCCAGCAT
+>nematode_614
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_615
+TCACCGGGTGGAAACTAGCAGGTCGTATGCCGGCT
+>nematode_616
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_617
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_618
+TCACCGGGTGAACACTTGCATCGTATGCCTTTTTC
+>nematode_619
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_620
+TCACCGGGTGTACATCAGCTAATCGTATTCCGTCT
+>nematode_621
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_622
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_623
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_624
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_625
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_626
+TCACCGGGTGAACACTTGCAGTTTCGTATGCCGTC
+>nematode_627
+TCACTGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_628
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_629
+TCACCGGGTGAACACTTGCAGTTCGTATGTCGTCT
+>nematode_630
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_631
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_632
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_633
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_634
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_635
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_636
+TCACCGGGTGGAAACTAGCAGTTCGTATGCGTTTT
+>nematode_637
+TCACTGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_638
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_639
+TCACCGGGAGAAAAACTGGAGTTCGTATGCCGTCT
+>nematode_640
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_641
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_642
+TCACCGGGAGAACACTTGCAGTTCGTATGCCGTTT
+>nematode_643
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTAT
+>nematode_644
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_645
+TCACCGGGTGTACATCAGCTAATCGTATCCCGTCT
+>nematode_646
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_647
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_648
+TCACCGGGTGGAAACTAGCAGTCGTATTCCGTCTT
+>nematode_649
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGGCT
+>nematode_650
+ACCGGGTGGAAACTAGCAGTATCGTATGCCGCCTT
+>nematode_651
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_652
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_653
+TCACCGGGTGTACATCAGCTATCGTATGCCGTCTT
+>nematode_654
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_655
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_656
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_657
+CCACCGGGTGGAAACTAGCAGTTCGTATGGCGTCT
+>nematode_658
+TCACCGGGAGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_659
+TCACCGGGTGGAAACTAGCAGTTTCGTATGCCGTC
+>nematode_660
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_661
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_662
+TCACCGGGTGGAAACTAGCAGTTTCGTATGCGGTT
+>nematode_663
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_664
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_665
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_666
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_667
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_668
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_669
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_670
+TCACCGGGTGAACACTTTCAGTCGTATGCCGTCTT
+>nematode_671
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_672
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGCCT
+>nematode_673
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_674
+TCACCTGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_675
+TCACAGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_676
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_677
+TCACCGGGTGAACACTTGCATCGTATGCCGTCTTT
+>nematode_678
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTTT
+>nematode_679
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_680
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_681
+TCACCGGGTGTACATCAGCTAATCGTATGCCGCCT
+>nematode_682
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_683
+TCACTGGGTGTAAATCAGCTTGTCGTATGCCGTCT
+>nematode_684
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_685
+TCACCGGGTGAACACTTGCAGTCGTATGCCGTCTT
+>nematode_686
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_687
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_688
+TCACCGGGTGGAAACTATCAGTTCGTATGCGGTCT
+>nematode_689
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_690
+TCACCGGGTGAACACTTGCAGTCGTATGCCGTCTT
+>nematode_691
+TCACCGGGTGTACATCAGCTAATTCGTATGCCGTC
+>nematode_692
+TCACCGGGTGAACACTTGCAGTCGTATGCCGTCTT
+>nematode_693
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_694
+TCACCGGGTGAAAACTTGCAGTTCGTATGCCGTCT
+>nematode_695
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_696
+TCACCGGGTGAACACTTGCAGTATCGTATGCCGTC
+>nematode_697
+TCACCGGGTGTACATCATCTAATCGTATTCCGGCT
+>nematode_698
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_699
+TCACCGGGTGCACATCAGCTAATCGTATGCCGTCT
+>nematode_700
+TCACCGGGTGAACACTTGCAGTATCGTATGCCGTC
+>nematode_701
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_702
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_703
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_704
+TCACCGGGTGGAAACTAGCAGTTCGTATGACATCT
+>nematode_705
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_706
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_707
+TCACCGGGTGGAAACTTGCAGTTCGTATGTTGTCT
+>nematode_708
+TCACCGGGTGGACATCAGCTAATCGTATGCCGTCT
+>nematode_709
+GCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_710
+TCACCGGGTGTAAATCAGCTTGTCGTATGCCGTCT
+>nematode_711
+TCACAGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_712
+TCACCGGGGGGAAACTAGCAGTTCGTATGTCGTCT
+>nematode_713
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_714
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_715
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTTT
+>nematode_716
+TCACCGGGTGGAAACTAGCAGTTTCGTATGCCGTC
+>nematode_717
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_718
+TCACCGGGAGAACACTTGCAGTTCGTATGTTCTTT
+>nematode_719
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_720
+TCACCGGGAGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_721
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_722
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_723
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_724
+TCACCGGGTGTACATCAGCTAATCGTATGTCGGCT
+>nematode_725
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_726
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_727
+TCACCGGGTGGACACTAGCAGTTCGTATGCCGTCT
+>nematode_728
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_729
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_730
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_731
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_732
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_733
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_734
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_735
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_736
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_737
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_738
+TCACCGGGTGGAAACTGGCAGTTCGTATGCCGTCT
+>nematode_739
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_740
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_741
+TCACCGGGTGGAAACTAGCAGTCGTATGCCGTCTT
+>nematode_742
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_743
+TCACCGGGTGGAAACTAGCAGTTTCGTATGCCGTC
+>nematode_744
+TCACCGGGTGGAAACTAGCAGTCGTATGCCGTCTT
+>nematode_745
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_746
+TCACCGGGTGGAAACTAGCTCGTATGCCGTCTTCT
+>nematode_747
+TCACCGGGTGGAAACTAGCAGTCGTATGCCGTTTT
+>nematode_748
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGCCT
+>nematode_749
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_750
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_751
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_752
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_753
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_754
+TCACCGGGCGGAAACTAGCAGTTCGTATGCCTTCT
+>nematode_755
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_756
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_757
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_758
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_759
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_760
+TCACCGGGTGGAAACTAGCAGTTTCGTATGCCGTC
+>nematode_761
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_762
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_763
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_764
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_765
+TCACCGGGTGGAAACTAGCAGTCGTATGCCGTCTT
+>nematode_766
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_767
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_768
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_769
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_770
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_771
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_772
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_773
+TCACCGGGTGGAGACTAGCAGTTCGTATGCCGTCT
+>nematode_774
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_775
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_776
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_777
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_778
+TCAGCGGGAGAAAAACTGGAGTTCGTATGCTGTTT
+>nematode_779
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_780
+TCACCGGGCGAACACTTGCAGTTCGTATGACGTCT
+>nematode_781
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_782
+TCACCGGGTGGAAACTAGCAGTTTCGTATGCCGTC
+>nematode_783
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_784
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_785
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_786
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_787
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_788
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_789
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_790
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_791
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_792
+TCACCGGGTGGAAAGTAGCAGTTCGTATGCCGTCT
+>nematode_793
+TCACCGGGTGTACATCAGCTAATCGTATGCCTTCT
+>nematode_794
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_795
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_796
+TCACCGGGTGGAAACTAGCAGTTTCGTATGCCGTC
+>nematode_797
+TCACCTGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_798
+TCACCGGGAGGAAACTAGCAGTTCGTATGCCTTCT
+>nematode_799
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_800
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_801
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_802
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_803
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_804
+TCACCGGGTGGAAACTAGCAGNTCGTATGCCGTCT
+>nematode_805
+TCACCGGGGGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_806
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_807
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_808
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_809
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_810
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_811
+TCACCGGCTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_812
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_813
+TCACCGGGTGAACACTTGCATCGTATGCCGTCTTC
+>nematode_814
+TCACCGGGAGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_815
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_816
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_817
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_818
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_819
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_820
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_821
+TCACCGGGTGGAGACTAGCAGTTCGTATGCCGTCT
+>nematode_822
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_823
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGCCT
+>nematode_824
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_825
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_826
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_827
+TCACTGGGTGAACACTTGCAGTTCGTATTCTGTCT
+>nematode_828
+TCAGCGGGTGAACACTTGCAGTTCGTATGCCGTTT
+>nematode_829
+TCACCGGGTGGAAACTAGAAGTTCGTATGCCGTTT
+>nematode_830
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_831
+TCACCGGGGGGAAACTAGCAGTTCGTATGTCGTCT
+>nematode_832
+TCACCGGGGGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_833
+TCACCGGGTGTACATCAGCTATCGTATGCCGTCTT
+>nematode_834
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_835
+ACCGGGTGTACATCAGCTAATCGTATGCCGTCTTC
+>nematode_836
+TCACCGGGTGAACACTTGCAGTTCGTATGACGTCT
+>nematode_837
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_838
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_839
+TCACCGGGTGGACATCAGCTAATCGTATGTCGCCT
+>nematode_840
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_841
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_842
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_843
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_844
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_845
+TCACCGGGTGTAAATCAGCTTGTCGTATGCCGTCT
+>nematode_846
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_847
+TCACCGGGTGTACATCAGCTAATTCGTATGCCGTC
+>nematode_848
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_849
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_850
+TCACCGGGTGAACACTTGCAGTATCGTATGCCGTC
+>nematode_851
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_852
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_853
+TCACCGGGTGAAAACTTGCAGTTCGTATGCCGTCT
+>nematode_854
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_855
+TCACCGGGTGGGAACTAGCAGTTCGTATGGCGTTT
+>nematode_856
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_857
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_858
+TCACCGGGTGGGAACTAGCAGTTCGTATTCCTTCT
+>nematode_859
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_860
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_861
+TCACCGGGTGCAAACTAGCAGTTCGTATCCCGTCT
+>nematode_862
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_863
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_864
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGCTT
+>nematode_865
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTTT
+>nematode_866
+TCACCGGGGGGAAACTAGCAGTTCGTATGGCGTCT
+>nematode_867
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_868
+TCACCGGGTGGAAACTAGCAGTTTCGTATGCCGTC
+>nematode_869
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_870
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_871
+TCACCGAGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_872
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_873
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_874
+TCACCGGGTGAACACTTTCAGTTCGTATGCCGTCT
+>nematode_875
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_876
+TCACCGGGAGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_877
+TCACCGGGTGAACACTTTCAGTTCGTATGCCGTCT
+>nematode_878
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_879
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_880
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_881
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_882
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_883
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_884
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_885
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_886
+TCACCGGGTGAAAACTAGCAGTTCGTATGCCTCCT
+>nematode_887
+TCACCGGGTGGAAACTAGCAGTCGTATGCCGTCTT
+>nematode_888
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_889
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_890
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_891
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_892
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_893
+TCACCGGGTGAACACTTGCAGTTCGTATGTCGTCT
+>nematode_894
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_895
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_896
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_897
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_898
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_899
+TCACCGGGTGGAAACTAGCAGTCGTATGCCGTCTT
+>nematode_900
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_901
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_902
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_903
+TCACCGGGTGAACACTTGCAGTTTCGTATGCCGTC
+>nematode_904
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_905
+TCACCGGATGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_906
+TCAGCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_907
+TCACCGGGTGAACACTTGCATCGTATGCCGTCTTC
+>nematode_908
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_909
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_910
+TCACCGGGTGAACACTAGCAGTTCGTATGCCGTCT
+>nematode_911
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_912
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_913
+TCACCGGGAGAAAAACTGGAGTTCGTATGCCGTCT
+>nematode_914
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_915
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_916
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_917
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_918
+TCACCGGGTGAAAACTTGCATCGTATGCCGTCTTC
+>nematode_919
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_920
+TCACCGGGTGAACACTGGCAGTTCGTATGCCGTCT
+>nematode_921
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_922
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_923
+TCACCGGGTGGATACTAGCAGTTCGTATGCGGCCT
+>nematode_924
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_925
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_926
+TCACCGGGTGGAAACTAGGAGTTCGTATGACGCCT
+>nematode_927
+TCACCGGGTGAACACTTGCAGTTCGTATGTCGTCT
+>nematode_928
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_929
+TCACCGGGTGAACACTTGCAGTTTCGTATGCCGTT
+>nematode_930
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_931
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_932
+TCACAGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_933
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_934
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_935
+TCACAGGGTGGAAACTAGCAGTTCGTATGCCATAT
+>nematode_936
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_937
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_938
+TCACCGGGCGTACATCAGCTAATCGTATTCCGTCT
+>nematode_939
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_940
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_941
+TCACCGGGTGGAAAATAGCAGTTCGTATGCCGTCT
+>nematode_942
+TCACCGGGTGGAAACTAGCAGTTCGTATTCCGTCT
+>nematode_943
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_944
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_945
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_946
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_947
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_948
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_949
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_950
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_951
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_952
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_953
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_954
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_955
+TCACCGGGTGAACACTTGCAGTTTCGTATGCCGTC
+>nematode_956
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_957
+TCACCGGGTGTACATCAGCTAATCGTATTCCGTCT
+>nematode_958
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_959
+TCACCGGGTGGAAACTATCAGTCGTATGCCGTCTT
+>nematode_960
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_961
+TCACCGGGTGAACACTTGCAGTCGTATGCCGTCTT
+>nematode_962
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_963
+TCACCGGGTGGAAACTAGCAGTTCGTATGACGTCT
+>nematode_964
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_965
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_966
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_967
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_968
+TCACCGGCTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_969
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTTT
+>nematode_970
+TCACCGGGCGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_971
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGCTT
+>nematode_972
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_973
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_974
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_975
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_976
+TCACCGGGTGGAAAATAGCAGTTCGTATGGCGGTT
+>nematode_977
+TCACCGGGTGGAAACTAGCAGTATCGTATGCCGTC
+>nematode_978
+TCACCGGGTGAACACTTGCAGTATCGTATGCCGTC
+>nematode_979
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_980
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_981
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_982
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_983
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_984
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_985
+TCACCGGGTGGACACTAGCAGTTCGTATGTCGTCT
+>nematode_986
+TCACCGGGTGTACATTAGCTAATCGTATTCCGTCT
+>nematode_987
+TCACCGGGCGGAAACTAGCAGTTCGTATGTCGTCT
+>nematode_988
+TCACCGGGTGGAAACTAGCAGTTCGTATGTCGTCT
+>nematode_989
+TCACCGGGTGGAAACTAGCAGTTCGTATGTCGTTT
+>nematode_990
+CCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_991
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_992
+TCACCGGGTGTACATCAGCTTATCGTATGCCGTCT
+>nematode_993
+CACCGGGTGAACACTTGCAGTTTCGTATGCCGTCT
+>nematode_994
+TCACCGGGTGGAAACTAGCAGTTCGTATAACGTCT
+>nematode_995
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_996
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_997
+TCACCGGGTGGAAACTAGCAGCTCGTATGCCGTCT
+>nematode_998
+TCACCGCGTGGAAACTAGCAGTTCGTATCCCGCCT
+>nematode_999
+TCACCGGGTGGAAACTAGCAGTCGTATGCCGTCTT
+>nematode_1000
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1001
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1002
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1003
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1004
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_1005
+TCACCGGGTGGACATCAGCTAATCGTATGCCGTCT
+>nematode_1006
+TCACCGGGTGGAAACTAGCAGTTTCGTATGCCGTC
+>nematode_1007
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1008
+TCACCGGGAGAAAAACTGGAGTTCGTATGCCGTCT
+>nematode_1009
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1010
+CTCACCGGGTGAACACTTGCAGTTCGTATGCCGTC
+>nematode_1011
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1012
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_1013
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1014
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_1015
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1016
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1017
+TCACCGGGTGTACATCAGATAATCGTATGCTGTCT
+>nematode_1018
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1019
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1020
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1021
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_1022
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1023
+TCACCGGGTGTACATCAGCTAATCGTATGCCTTCT
+>nematode_1024
+TCACCGGGTGGAAACTAGCAGTTCGTATCCCGTCT
+>nematode_1025
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1026
+ACCGGGTGTACATCAGATAATCGTATGCCGTCTTT
+>nematode_1027
+TCACCGGGTGCAAACTAGCAGTCGTATGCCTTCTT
+>nematode_1028
+ACCGGGAGGAAACTAGCAGTTCGTATGCCGTCTTT
+>nematode_1029
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1030
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTAT
+>nematode_1031
+AGCTGATTTCGTCTTGGTAATATTCGTATGCCGTC
+>nematode_1032
+TCACAGGGTGGAAACTAGCAGTTCGTATGAAGTCT
+>nematode_1033
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1034
+TCACCGGGAGAAAAACTGGTGTTCGTATGCCGTCT
+>nematode_1035
+AGCTGATTTCGTCTTGGTAATATCGTATGCCTTTT
+>nematode_1036
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1037
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1038
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_1039
+ACCGGGTGTACATCAGCTAATCGTATGCCGTCTTT
+>nematode_1040
+TCACCGGGTGAAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1041
+TCACCGGGCGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1042
+TCACCGGGTGGAAACTAGCAGCTCGTATGACGTCT
+>nematode_1043
+CACCGGGTGAACACTTGCAGTTCGTATGCCGTCTT
+>nematode_1044
+TCACCGGGTGAACACTTGCAGTTCGTATGCTGTCT
+>nematode_1045
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_1046
+TCACCGGGTGAACACTTGCATCGTATGCCGTCTTC
+>nematode_1047
+TCACCGGGAGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1048
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_1049
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTAT
+>nematode_1050
+TCACCGGGTGGAAACTAGCAGGTCGTATGCCGTCT
+>nematode_1051
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1052
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1053
+TCACCGGGCGTACATCAGCTAATCGTATGCCGCCT
+>nematode_1054
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1055
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_1056
+TCACCGGGGGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1057
+TCACCGGGTGTACATTAGCTAATCGTATGACGTCT
+>nematode_1058
+TCACCGGGTGAACGCTTGCAGTTCGTATGCGGTAT
+>nematode_1059
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1060
+TCACCGGGTGAATACTTGCAGTTCGTATGCCGTCT
+>nematode_1061
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1062
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1063
+ACCGGGTGGAAACTAGCAGTTCGTATTCCGTCTTT
+>nematode_1064
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1065
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1066
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1067
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1068
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGCTT
+>nematode_1069
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1070
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1071
+TCACCGGGCGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1072
+TCACCGGGTGGAAACTAGCAGTCGTATGCCGTCTT
+>nematode_1073
+TCACCGGGGGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1074
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1075
+TCACCGGGGGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1076
+TCACCGGGCGGAAACTAGCAGTTCGTATTCCGTCT
+>nematode_1077
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1078
+TCACCGGGTGAACACTAGCAGTTCGTATGCCGTCT
+>nematode_1079
+TCACCGGGAGGAAACTAGCAGTTCGTATGCCTTTT
+>nematode_1080
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1081
+TCACCGGGTGGAAACTAGCAGTTTCGTATGCCGTC
+>nematode_1082
+TCACCGGGTGAACACTTGCAGTTCGTATGAAGTAT
+>nematode_1083
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGCCT
+>nematode_1084
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1085
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1086
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGCCT
+>nematode_1087
+TCACCGGGTGTAAATCAGCTGGTCGTATGCCGTCT
+>nematode_1088
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1089
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1090
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1091
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1092
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGGCT
+>nematode_1093
+TCACCGGGTGAACACTTGCATCGTATGCCGTCTTC
+>nematode_1094
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_1095
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1096
+TCACCGGGAGAACACTTGCAGTTCGTATGTTGTGT
+>nematode_1097
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGCCT
+>nematode_1098
+ACCGGGTGGAAACTAGCAGTTCGTATGCCGTCTTC
+>nematode_1099
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1100
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1101
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1102
+ACCGGGTGAACACTTGCAGTTCGTATGCCGTCTTC
+>nematode_1103
+TCACCGGGTGAACACTTGCATCGTATGCCGTCTTC
+>nematode_1104
+TCACCGGGTGAACACTTGCAGTTTCGTATGCCGTC
+>nematode_1105
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1106
+TCACCGGGTGGAAACTAGCAGGTCGTATGCCGTCT
+>nematode_1107
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTTT
+>nematode_1108
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1109
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1110
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1111
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1112
+TCACCGGGTGAACACTTGCAGTTTCGTATGTTGTC
+>nematode_1113
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1114
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1115
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1116
+TCACCGGGTGAAAATTCACATGTCGTATGCCGTCT
+>nematode_1117
+TCACCGGGTGGAAACTAGCAGTCGTATGCCGTCTT
+>nematode_1118
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_1119
+TCACCGGGTGGCAACTAGCAGTTCGTATGCCTGCT
+>nematode_1120
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1121
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1122
+TCACCGGGTGAAGACTTGCAGTTCGTATTCTTTCT
+>nematode_1123
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1124
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1125
+TCACAGGGTGGAAACTAGCAGTCGTATGCCGTCTT
+>nematode_1126
+TCACCGGGTGGAAACTAGCAGTTTCGTATGCCGTC
+>nematode_1127
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1128
+TCACCGGGTGTAAATCAGCTTGTCGTATGCCGTCT
+>nematode_1129
+TCACCGGGTGTACATCAGCTAATCGTATGCCGCTT
+>nematode_1130
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1131
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1132
+TCACCGGGTGGAAACTAGCAGTTCGTATCCCGTCT
+>nematode_1133
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1134
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1135
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1136
+TCACCGGGTGAACACTTGCATCGTATGCCGCCTTT
+>nematode_1137
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1138
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1139
+TCACCGGTTGGAAACTAGCAGTTCGTATTCCTTCT
+>nematode_1140
+TCACCGGGTGGAAACTAGCAGTTTCGTATGCCGTC
+>nematode_1141
+TCACCGGGTGTACATCAGCTCGTATGACGTCTTTT
+>nematode_1142
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_1143
+TCACCGGGTGTAAATCAGCTTGTCGTATGCCGTCT
+>nematode_1144
+TCACCGGGTGGAAACTAGCATCGTATGCCGTCTTC
+>nematode_1145
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1146
+TCACCGGGTGGAAACTAGCAGTATCGTATGCCGTG
+>nematode_1147
+TCACCGGGAGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1148
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_1149
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1150
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1151
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1152
+TCACCGGGTGGAAACTAGTCGTATGCCGTCTTCTT
+>nematode_1153
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1154
+TCACCGGGTGGAAACTAGCAGTCGTATTCCGTCTT
+>nematode_1155
+TCACCGGGTGAACAATTGCAGTTCGTATGACGACT
+>nematode_1156
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1157
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1158
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1159
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1160
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1161
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_1162
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1163
+TCACCGGGGGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1164
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1165
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1166
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1167
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1168
+TCACCGGGTGGAAACTAGCAGTTTCGTATGCCGTT
+>nematode_1169
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_1170
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1171
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1172
+TCACCGGGCGGAAACTAGCAGTTCGTATGCCATCT
+>nematode_1173
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1174
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1175
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1176
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1177
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1178
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1179
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_1180
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGCTT
+>nematode_1181
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1182
+TCACCGGGTGGAAACTAGCAGCTCGTATGCCGTCT
+>nematode_1183
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1184
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1185
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1186
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1187
+TCACCGGGTGGAAACTAGCATCGTATGCCGTCTTC
+>nematode_1188
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1189
+TCACCGGGTGAAAACTTGCAGTTCGTATGCCGTCT
+>nematode_1190
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1191
+TCACCGGGTGAGAATTCGCATGTCGTATGCCGTCT
+>nematode_1192
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1193
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1194
+TCACAGGGTGGAAACTAGCAGTTCGTATGCCTTCT
+>nematode_1195
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTTT
+>nematode_1196
+TCACCGGGAGAAAAACTGGAGTTCGTATGCCGTCT
+>nematode_1197
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_1198
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1199
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1200
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1201
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1202
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1203
+CACCGGGTGAACACTTGCAGTATCGTATGCCGTCT
+>nematode_1204
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1205
+TCACCGGGTGAAAATTCGCATGTCGTATGACGAAT
+>nematode_1206
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1207
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1208
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1209
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_1210
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1211
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1212
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1213
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_1214
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1215
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_1216
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1217
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1218
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1219
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1220
+TCACCGGGTGTAAATCAGCTTGTCGTATGCCGTCT
+>nematode_1221
+TCACCGGGTGAACACTTGCAGTTCGTATGGCGTTT
+>nematode_1222
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1223
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1224
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCTTCT
+>nematode_1225
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1226
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1227
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1228
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_1229
+TCACCGGGCGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1230
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1231
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1232
+TCACCGGGTGGAAACTAGCAGTCGTATGCCGACTT
+>nematode_1233
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_1234
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1235
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1236
+TCACCGGGTGAAAATTCGGATGTCGTATGCCGTTT
+>nematode_1237
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1238
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1239
+TCACCGGGCGTACATCAGCTAATCGTATGCCGGCT
+>nematode_1240
+TCACCGCGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_1241
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTTT
+>nematode_1242
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1243
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1244
+TCACCGGGGGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1245
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_1246
+TCACCGGGTGGAAACTAGCAGTCGTATGCCGTCTT
+>nematode_1247
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1248
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1249
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_1250
+TCACCGGGTGGAAACTAGCAGTTCGTATTCCGCCT
+>nematode_1251
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1252
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1253
+TCACCGGGTGGAAAATAGCAGTTCGTATGCCGTCT
+>nematode_1254
+TCACCGGGTGGAAACTAGCAGTTCGTATGCTGTCT
+>nematode_1255
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_1256
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1257
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1258
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1259
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1260
+TCACCGGGGGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_1261
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1262
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1263
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1264
+TCACCGGGTGAACACTGGCAGTTCGTATGCCGTCT
+>nematode_1265
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_1266
+TCACCGGGTGGAAAATAGCAGTTCGTATGCCGCCT
+>nematode_1267
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1268
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1269
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_1270
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1271
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1272
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1273
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1274
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1275
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1276
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1277
+TCACCGGGTGGAAACTGGCAGTTCGTATGCCGTCT
+>nematode_1278
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1279
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1280
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1281
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1282
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1283
+TCACCGGGTGGAAACTAGCAGTTTCGTATGCCGTC
+>nematode_1284
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1285
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1286
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1287
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1288
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1289
+TCACCGGGTGGAAACTAGCAGTATCGTATGCCGTC
+>nematode_1290
+TCACCGGGAGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_1291
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1292
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_1293
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_1294
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1295
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1296
+TCACCGGGTGAAAATTCGTATGTCGTATTCCGTTT
+>nematode_1297
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1298
+TCACCGGGTGAACACTTGCAGTTTCGTATGCCGTC
+>nematode_1299
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_1300
+TCACCGGGTGCAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1301
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1302
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_1303
+TCACCGGGTGTACATCAGCTAATCGTATGCTGTCT
+>nematode_1304
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1305
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_1306
+TCACCGGGGGAACACTTGCAGTTCGTATGCCTTCT
+>nematode_1307
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1308
+TCACTGGGTGGAAACTAGCAGTCGTATGCCGTCTT
+>nematode_1309
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_1310
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1311
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_1312
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1313
+TCACCGGGTGTACATCAGCTAATCGTATTCTGTTT
+>nematode_1314
+TCACCGGGTGAACACCTGCAGTTCGTATGCCGTCT
+>nematode_1315
+TCACCGGGTGAACACTTGCAGTTTCGTATGCCGTC
+>nematode_1316
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1317
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1318
+TCACCGGGTGGAAACTAGCAGGTCGTATGCCGTCT
+>nematode_1319
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGCCT
+>nematode_1320
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1321
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_1322
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1323
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1324
+TCACCGGGTGAACACTTGCAGTATCGTATGCCGTC
+>nematode_1325
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1326
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1327
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1328
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1329
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1330
+TCACCGGGTGGAAACTAGCAGTCGTATGACGACTT
+>nematode_1331
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1332
+TCACCGGGTGGAAACTAGCAGCTCGTATGCCCTCT
+>nematode_1333
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1334
+ACCGCGTGAACACTTGCAGTTCGTATGCCGTCTTC
+>nematode_1335
+TCACCGGGTGGAAACTAGCTGTTCGTATGCCGTCT
+>nematode_1336
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_1337
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1338
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1339
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTTT
+>nematode_1340
+TCACCGGGTGGAAACTAGCAGTTCGTATGTCGTTT
+>nematode_1341
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_1342
+TCACCGGGTGGAAACTAGCAGTATCGTATGCCGTC
+>nematode_1343
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1344
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1345
+TCACCGGGTGGAAACTAGCATCGTATGCCGTCTTC
+>nematode_1346
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1347
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1348
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTTT
+>nematode_1349
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1350
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1351
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1352
+TCACCGGGGGAACACTTGCAGTTCGTATGCCGTTT
+>nematode_1353
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_1354
+TCACCGGGTGGAAACGAGCAGTTCGTATGCCGTCT
+>nematode_1355
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1356
+TCACCGGGGGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1357
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1358
+TCACCGGGTGAACACTTGCAGTTCGTATCTCGTTT
+>nematode_1359
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1360
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1361
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1362
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1363
+TCACCGGGTGAACACTTGCAGTCGTATGCCGTCTT
+>nematode_1364
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_1365
+TCACCGGGTGAACACTTGCATCGTATGCCGTCTTC
+>nematode_1366
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1367
+TCACCGGGTGTACATCAGCTAATCGTATGACGTCT
+>nematode_1368
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1369
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_1370
+TCACCGGGTGGAAACTAGCAGTTTCGTATGCCGTC
+>nematode_1371
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1372
+TCACCGGGTGAACACTTGCATCGTATGCCGTCTTC
+>nematode_1373
+TCACCGGGTGGAAACTAGCAGCTCGTATGCCGCCT
+>nematode_1374
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1375
+TCACCGGGTGGAAACTAGCAGTTTCGTATTCCGTC
+>nematode_1376
+TCACCGGGTGAACACTTGCAGCTCGTATGCCGTCT
+>nematode_1377
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1378
+TCACCGGGTGGAAACTAGCAGTATCGTATGCCGCC
+>nematode_1379
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1380
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1381
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1382
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1383
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1384
+TCACCGGGTGGAAACTAGCAGTCGTATGCCGTCTT
+>nematode_1385
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1386
+TCACCGGGTGTAAATCAGCTTGTCGTATTCCGGCT
+>nematode_1387
+TCACCGGGAGAAAAACTGGAGTTCGTATGCCGTCT
+>nematode_1388
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCTTCT
+>nematode_1389
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1390
+TCACTGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_1391
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1392
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1393
+TCACCGGGTGGAAACTAGCAGTTCGTATACCGTCT
+>nematode_1394
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1395
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1396
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_1397
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1398
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1399
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1400
+AGTGGATGTATGCCATGATGATATCGTATGCCGTC
+>nematode_1401
+TCACCGGGTGGAAACTAGCAGTCGTATGCCGTCTT
+>nematode_1402
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_1403
+TNACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_1404
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_1405
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1406
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1407
+TCACCGGGTGGAAAGTAGCAGTTCGTATGCCGTCT
+>nematode_1408
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1409
+TCACCGGGTGGAAACTAGCAGTTTCGTATGCCGTC
+>nematode_1410
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1411
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1412
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_1413
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1414
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1415
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1416
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1417
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_1418
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1419
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1420
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1421
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1422
+TCACCGGGTGGAAACTAGCAGTTCGTATTCTGTTT
+>nematode_1423
+TCACCGGGTGTACATCAGCTAATTCGTATGCCGTC
+>nematode_1424
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1425
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1426
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_1427
+TCACCGGGGGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1428
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1429
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1430
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1431
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1432
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1433
+TCACCGGGTGGAAACTAGCAGTCGTATTCCGTCTT
+>nematode_1434
+TCACCGGGTGTACATCAGCTATCGTATGCCGTCTT
+>nematode_1435
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1436
+TCACCGGGTGCACACTTGCAGTTCGTATGCCGTCT
+>nematode_1437
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1438
+TCACCGGGTGAACACTTGCAGTTTCGTATGCCGTC
+>nematode_1439
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1440
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1441
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1442
+TCACCGGGTGAACACTGGCAGTTCGTATGCCGTCT
+>nematode_1443
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_1444
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1445
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1446
+TCACCGGGTGGAAACTAGCAGTTTCGTATGCAGTA
+>nematode_1447
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1448
+TCACCGGGTGAACACTTGCAGTTTCGTATGCCGTC
+>nematode_1449
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1450
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1451
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1452
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1453
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1454
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1455
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_1456
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTTT
+>nematode_1457
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1458
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1459
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1460
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1461
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1462
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1463
+TCACCGGGTGGAAACTAGCATTTCGTATGCCGTCT
+>nematode_1464
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1465
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1466
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_1467
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1468
+TCACCGGGTGAACACTTGCAGTATCGTATGCCGTC
+>nematode_1469
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1470
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1471
+TCACCGGGTGGAAACTAGCAGTCGTATGCCGTCTT
+>nematode_1472
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1473
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1474
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1475
+TCACCGGGTGAACACTTGCATCGTATGCCGTCTTC
+>nematode_1476
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1477
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1478
+TCACCGGGTGGAAACTAGCAGTCGTATGCCGTCTT
+>nematode_1479
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1480
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_1481
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1482
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1483
+TCACCGGGTGTAAATCAGCTTATCGTATGCCGTCT
+>nematode_1484
+TCACCGGGAGAAAAACTGGAGTTCGTATGCAGTCT
+>nematode_1485
+TCACCGGGTGAACACTTGCAGTCGTATGCCGTCTT
+>nematode_1486
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1487
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1488
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1489
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1490
+TCACCGGGAGAAAAACTGGAGTTCGTATGCCGTCT
+>nematode_1491
+TCACCGGGTGGAAACTAGCAGGTCGTATGCCGTCT
+>nematode_1492
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1493
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1494
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1495
+TCACCGGGTGAACACTTGCAGCTCGTATGCCGTCT
+>nematode_1496
+TCACCGGGTGGAAACTAGCAGTTCGTATGCATTCT
+>nematode_1497
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1498
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1499
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1500
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1501
+TCACCGGGCGGAAACTAGCAGTTCGTATGCAGAAT
+>nematode_1502
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGCCT
+>nematode_1503
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1504
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTAT
+>nematode_1505
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1506
+TCACCGGGTGAACACTTGCAGTCGTATGCCGTCTT
+>nematode_1507
+TCACCGGGTGAACACTTGCAGTTTCGTATGCCGTC
+>nematode_1508
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1509
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1510
+TCACCGGATGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1511
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1512
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1513
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGGCT
+>nematode_1514
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1515
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTGT
+>nematode_1516
+TCACCGGGTGAACACTAGCAGTTCGTATGCCGTCT
+>nematode_1517
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGCCT
+>nematode_1518
+TCATCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1519
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1520
+AGCTGATTTCGTCTTGGTAATATCGTATTCCGTTT
+>nematode_1521
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1522
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1523
+TCACCTGGTGTACATCAGCTAATCGTATCCCGCCT
+>nematode_1524
+ACCGGGCGAACACTTGCAGTTCGTATGCCGTGTTT
+>nematode_1525
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1526
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGCCT
+>nematode_1527
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGCCT
+>nematode_1528
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1529
+TCACCGGGTGTACATCAGCTAATCGTATGCCTTCT
+>nematode_1530
+AATCACCGGGTGAACACTTGCAGTTCGTATGCCGT
+>nematode_1531
+TCACCGGGAGAAAAACTGGAGTTCGTATGCCGTCT
+>nematode_1532
+TCACCGGGTGTAAATCAGCTTGTCGTATGCGGTCT
+>nematode_1533
+TCACCGGGTGGAAACTAGCAGTTCGTATGACGCCT
+>nematode_1534
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_1535
+ACCGGGTGGAAACTAGCAGTTCGTATGCCGTCTTC
+>nematode_1536
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1537
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGCCT
+>nematode_1538
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1539
+AGCCGATTTCGTCTTGGTAATATCGTATGCCGTTT
+>nematode_1540
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1541
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1542
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1543
+ACCGGGTGAACACTTGCAGTTCGTATGCCGTCTTC
+>nematode_1544
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_1545
+TCACAGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_1546
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1547
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1548
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1549
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1550
+TCACCGGGTGTAGATCAGCTAATCGTATGCCGTCT
+>nematode_1551
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1552
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1553
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1554
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1555
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTTT
+>nematode_1556
+TCACAGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1557
+CACCGGGTGAACACTTGCAGTTTCGTATGCCGTCT
+>nematode_1558
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1559
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1560
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_1561
+AATCACCGGGTGAACACTTGCAGTTCGTATGACGT
+>nematode_1562
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1563
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1564
+TCACCGGGTGGAAACTAGCAGTCGTATGCCGTCTT
+>nematode_1565
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1566
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_1567
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1568
+AACGGGTGTACATCAGCTAATCGTATGCCGTCTTT
+>nematode_1569
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1570
+TCACCGGGTGGAAAATAGCAGTCGTATGCCGTCTT
+>nematode_1571
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1572
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_1573
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1574
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1575
+TCACCGGGTGAACAATTGCAGTTCGTATTCTGTTT
+>nematode_1576
+TCACCGGGCGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1577
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_1578
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1579
+TCACCGGGTGAAACTTCGCATGTCGTATGCCGTCT
+>nematode_1580
+TCACCGGGTGAACACTGGCAGTTCGTATGCCGTCT
+>nematode_1581
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1582
+TCACCGCGTGAACACTTGCAGTTCGTATGCCTTCT
+>nematode_1583
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1584
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1585
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1586
+TCACCGGGTGAACAATTGCAGTTCGTATGCCGTTT
+>nematode_1587
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1588
+TCACCGGGTGGAAACTAGCAGTTTCGTATGCCGTC
+>nematode_1589
+TCACCGGGTGAACACTTGCAGTCGTATGCCGTCTT
+>nematode_1590
+TCACCGGGTGGAAACTAGCAGTCGTATGCCGTCTT
+>nematode_1591
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_1592
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTAT
+>nematode_1593
+AGCTGATTTCGTCTTGGTAATATCGTATGCCGTCT
+>nematode_1594
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1595
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1596
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1597
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1598
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1599
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1600
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1601
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_1602
+TCACCGGGGGAAAATTCGCATTCGTATGCCGTCTT
+>nematode_1603
+TCACAGGGTGGAAACTAGCAGTTCGTATGCGGTCT
+>nematode_1604
+TCACCGGGTGAACACTTGCAGTTCGTATACCGTCT
+>nematode_1605
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_1606
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCAACG
+>nematode_1607
+TCACCGGGTGAACACTTACAGTTCGTATGCCGTCT
+>nematode_1608
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1609
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1610
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1611
+TCACCGGGAGGAAACTAGCAGTTCGTATGCTGTCT
+>nematode_1612
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1613
+TCACCGGGGGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1614
+TCACCGGGAGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1615
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1616
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1617
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_1618
+TCACCGGGTGAAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1619
+TCACCGGGTGGAAACTAGCAGTCGTATGCCGTCTT
+>nematode_1620
+TCACCGGGAGAAAAACTGGAGTTCGTATGCCGTCT
+>nematode_1621
+TCACCGGGTGGAAACTACCAGTTCGTATGCCGTCT
+>nematode_1622
+TCACCGGGTGTACATCAGCTATCGTATGCCGTCTT
+>nematode_1623
+TCACCGGGTGGAAACTAGCAGTTCGTATTCCGTCT
+>nematode_1624
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1625
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1626
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1627
+TCACCGGGTGGAAAATAGCAGTTCGTATGCCGTCT
+>nematode_1628
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_1629
+TCACCGGGTGAACACTTGCAGTATCGTATGTCGTT
+>nematode_1630
+TCACCGCGTGGAAACTAGCAGTTCGTATTCCGTTT
+>nematode_1631
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1632
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTTT
+>nematode_1633
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1634
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1635
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_1636
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1637
+TCACCGCGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1638
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1639
+TCACCGGGTGGAAAATAGCAGTTCGTATGCTGCCT
+>nematode_1640
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1641
+TCACCGGGTGAAAATTAGCATGTCGTATGCCGTCT
+>nematode_1642
+TCACCGGGTGGAAACTAGCAGTTCGTATGTCGTCT
+>nematode_1643
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1644
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1645
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1646
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_1647
+TCACCGGGTGGAAACTAGCAGTATCGTATGCCGTC
+>nematode_1648
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1649
+TCACCGGGCGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1650
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1651
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1652
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_1653
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1654
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1655
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCTTCT
+>nematode_1656
+TCACAGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1657
+CTCACCGGGTGAACACTTGCAGTTCGTATGCCGTC
+>nematode_1658
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1659
+TCACCGGGCGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1660
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1661
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTTT
+>nematode_1662
+TCACCGGGAGAAAAACTGGAGTTCGTATGCCGTCT
+>nematode_1663
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGCTT
+>nematode_1664
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1665
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1666
+TCACAGGGTGAACACTTGCAGTTCGTATTCCGTCT
+>nematode_1667
+TCACCGGGTGAACACTTGCATCGTATGCGGTGTTC
+>nematode_1668
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_1669
+TCAACGGGTGAACACTTGCAGTTCGTATGCTGTTT
+>nematode_1670
+TCACCGGGTGAACACTAGCAGTTCGTATGCCGTTT
+>nematode_1671
+TCACCGGGGGGAAACTAGCAGTTCGTATGTCGTCT
+>nematode_1672
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1673
+TTACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1674
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1675
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1676
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTTT
+>nematode_1677
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1678
+TCACAGGGTGGAAACTAGCAGTTCGTATGGCGTCT
+>nematode_1679
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1680
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_1681
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1682
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1683
+TCACCGGGTGAACACTTGCAGTTCGTATGTCGTTT
+>nematode_1684
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1685
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1686
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1687
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1688
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1689
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1690
+TCACCGGGTGAACACTGGCAGTTCGTATGCCGTTT
+>nematode_1691
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1692
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1693
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1694
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1695
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_1696
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1697
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_1698
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1699
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1700
+TCACCGGGTGAACACTTGCTGTTCGTATGCCGTCT
+>nematode_1701
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_1702
+TCACCGGGTGGAAACTAGCAGTCGTATGCCGTCTT
+>nematode_1703
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_1704
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1705
+ACCCGGTGAAAATTCGCATGTCGTATGCCTTTTTT
+>nematode_1706
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1707
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1708
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1709
+TCACCGGGTGGAAACTAGCAGTTCGTATGTCGTCT
+>nematode_1710
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTTT
+>nematode_1711
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1712
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_1713
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGCCT
+>nematode_1714
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1715
+TCACCGGGGGGAAACTAGCAGTTCGTATGCCGCCT
+>nematode_1716
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1717
+TCACCGGGTGGAAACTAGCAGTTCGTATGTCGTCT
+>nematode_1718
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1719
+TCACCGGGTGGAAACTAGCAGTCGTATGCCGTCTT
+>nematode_1720
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1721
+TCACCGGGGGAACACTTGCAGTTCGTATGCCGCCT
+>nematode_1722
+TCACCGGGTGGAAACTAGCATCGTATGCCGTCTTC
+>nematode_1723
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCTTTT
+>nematode_1724
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1725
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1726
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1727
+TCACCGGGTGGAAACTAGCAGTTTCGTATGCTGTC
+>nematode_1728
+TCACCGGGCGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1729
+TCACAGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1730
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1731
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1732
+TCACCGGGTGAACACTTGCAGTTCGTATGTCTTCT
+>nematode_1733
+TCACCGGGTGAAAATTCGCATTTCGTATGCCGTCT
+>nematode_1734
+TCACCGGGTGGAAACTAGCAGTCGTATGCCGTCTT
+>nematode_1735
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1736
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1737
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1738
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_1739
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1740
+TCACCGGGTGGAAACTAGCAGTTCGTATGACGTCT
+>nematode_1741
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_1742
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1743
+TCACCGGGTGGAAACTAGCATTTCGTATGCCGTCT
+>nematode_1744
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_1745
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1746
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1747
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1748
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1749
+TCACAGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1750
+TCACCGGGTGAACACTTGCAGTTTCGTATGCCGTT
+>nematode_1751
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1752
+TCACCGGGGGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1753
+TCACCGGGTGGAATCTAGCAGTTCGTATGTCTTCT
+>nematode_1754
+TCACCGGGTGTACACTTGCAGTTCGTATGCCGTCT
+>nematode_1755
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1756
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1757
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1758
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1759
+TCACCGGGTGAACACTTGCAGTCGTATGCCGTCTT
+>nematode_1760
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1761
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1762
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1763
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1764
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1765
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1766
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1767
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1768
+TCACCGGGTGTAAATCAGCTTGTCGTATGCCGTCT
+>nematode_1769
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1770
+TCACCGGGTGAATACTTGCAGTTCGTATGCCGTCT
+>nematode_1771
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1772
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1773
+TCACCGGGTGGAAACTAGCAGTTCGTATTCCGTCT
+>nematode_1774
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1775
+TCACCGGGTGAACACTTGCAGTTTCGTATGCCGTC
+>nematode_1776
+TCACCGGGTGTAAATCAGCTTGTCGTATGCCGTCT
+>nematode_1777
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1778
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_1779
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_1780
+TCACCGGGTGGAAAATAGCAGTTCGTATGCCGTCT
+>nematode_1781
+TCACCGGGTGGAAACTAGCAGTTCGTATTCCGTCT
+>nematode_1782
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1783
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_1784
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1785
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1786
+TCACCGGGTGGAAACTAGCAGTCGTATGCCGTCTT
+>nematode_1787
+TCACCGGGTGTACATCAGATAATCGTATGCCGTCT
+>nematode_1788
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1789
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_1790
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1791
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1792
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1793
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_1794
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1795
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1796
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1797
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1798
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_1799
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1800
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1801
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1802
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1803
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1804
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTTT
+>nematode_1805
+TCACCGGGAGAAAAACTGGAGTTCGTATGCCGTCT
+>nematode_1806
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1807
+TCACCGGGTGAACACTTGCAGTTCGTATGACGTCT
+>nematode_1808
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1809
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_1810
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1811
+TCACCGGGTGAACACTTGCAGTCGTATGCCGTCTT
+>nematode_1812
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_1813
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_1814
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1815
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1816
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1817
+TCACCGGGTGGAAACTAGCAGTTTCGTATGCCGTC
+>nematode_1818
+TCACCGGGTGAACACTTGCAGTTCGTATGCCTTCT
+>nematode_1819
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1820
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1821
+TCACCGGGGGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1822
+TCACAGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1823
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_1824
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1825
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1826
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_1827
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1828
+TCACCGGGTGAACACTTGCATCGTATGCCGTCTTC
+>nematode_1829
+TCACCGGGTGGAAACTCGCAGTTCGTATGCCGTCT
+>nematode_1830
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTTT
+>nematode_1831
+TCACCGGGTGAAAATTCGCATGTCGTATGTCGTCT
+>nematode_1832
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1833
+TCACCGGGTGGAAACTAGCAGTTTCGTATGCCGTC
+>nematode_1834
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1835
+TCACCGGGTGGAAACTAGCAGTTCGTATTCCGTCT
+>nematode_1836
+TCACCGGGTGGAAACTAGCAGTCGTATGCCGTCTT
+>nematode_1837
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1838
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1839
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1840
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1841
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_1842
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1843
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_1844
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1845
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1846
+TCACCGGGTGAACACTTGCAGTTCGTATGCCTGCT
+>nematode_1847
+TCACCGGGTGGAAACTAGCAGTATCGTATGCCGTC
+>nematode_1848
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_1849
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1850
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_1851
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1852
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCTTCT
+>nematode_1853
+TCACCGGGTGGAAACTAGCAGTTCGTATGTCTTCT
+>nematode_1854
+TCACCGGGTGAACACTTGCAGTTTCGTATGCCGTC
+>nematode_1855
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1856
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1857
+TCACCGGGCGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1858
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1859
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1860
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1861
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1862
+TCACTGGGTGTACATCAGCTATCGTATGCCGTCTT
+>nematode_1863
+TCACCGGGTGTAAATCAGCTTCGTATGCCGTCTTC
+>nematode_1864
+TCACCTGGTGGAAACTAGCAGTTCGTATGCCTTCT
+>nematode_1865
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1866
+TCACCGGGTGGGAACTAGCAGTTCGTATGCCGTCT
+>nematode_1867
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1868
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1869
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1870
+TCACCGGGTGAACACTTGCAGTTTCGTATGCCGTC
+>nematode_1871
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1872
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1873
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1874
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1875
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1876
+TCACCGGGTGGAAACTAGCAGTTCGTATGCGGTTT
+>nematode_1877
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1878
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_1879
+TCACCGGGTGAACACTTGCATCGTATGCCGTCTTC
+>nematode_1880
+TCACAGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1881
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1882
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1883
+TCACCGGGTGGAAACTAGCAGTTTCGTATGCCGTC
+>nematode_1884
+TCACCGGGTGGAAACTAGCAGTCGTATGCCGTCTT
+>nematode_1885
+TCACCGGGTGTACATCAGCTAAATCGTATGCCGTC
+>nematode_1886
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1887
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1888
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1889
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1890
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_1891
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1892
+TCACCGGGTGGAAACTAGCAGTTCGTATGTCGTCT
+>nematode_1893
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTTT
+>nematode_1894
+TCACCGGGTGGAAACTAGCAGTCGTATGCCGTCTT
+>nematode_1895
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_1896
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1897
+TCACCGGGGGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1898
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1899
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1900
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1901
+TCACCGGGTGGAACCTAGCAGTTCGTATGCCGTCT
+>nematode_1902
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1903
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1904
+TCACCGGGTGGAAACTAGCAGTTTCGTATGCCGTC
+>nematode_1905
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1906
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1907
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1908
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1909
+TCACCGGGCGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1910
+TCACCGCGTGAACACTTGCAGTTCGTATGGCGTGT
+>nematode_1911
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1912
+TCATCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1913
+TCACCGGGGGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1914
+TCACCGGGAGAAAAACTGGAGTTCGTATGCCGTCT
+>nematode_1915
+TCACCGGGTGGAATCTAGCAGTTCGTATGCCGTCT
+>nematode_1916
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_1917
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1918
+TCACCGGGTGGAGACTAGCAGTTCGTATGCCGTCT
+>nematode_1919
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1920
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1921
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1922
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1923
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1924
+TCACCGGGTGGAAACTAGCAGTTTCGTATGAAGTC
+>nematode_1925
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1926
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1927
+TCACCGGGTGGAAACTAGCAGTTCGTATTCCGTCT
+>nematode_1928
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1929
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1930
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1931
+TAACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_1932
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1933
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1934
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_1935
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1936
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1937
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_1938
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1939
+TCACCGGGTGTACATCATCTAATCGTATTTCGTCT
+>nematode_1940
+TCACCGGGAGAAAAACTGGAGTTCGTATGCCGTCT
+>nematode_1941
+TCACCGGGTGGAAACTAGCAGTATCGTATGTCGTC
+>nematode_1942
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1943
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1944
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1945
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1946
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1947
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1948
+TCACCGGGTGGAAACTAGCAGTTCGTATCCCGTCT
+>nematode_1949
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1950
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1951
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1952
+TCACCGGGTGGAAACTAGCAGTTTCGTATGCCGTC
+>nematode_1953
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1954
+TCACCGGGGGAACACTTGCAGTTCGTATGCCTTCT
+>nematode_1955
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1956
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1957
+TCACCGGGTGAACACTTGCAGTTCGTATTCTGTCT
+>nematode_1958
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1959
+TCACCTGGTGTACATCAGCTAATCGTATGCCGTTT
+>nematode_1960
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1961
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1962
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1963
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1964
+TCACCGGGAGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1965
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1966
+TCACCGGGTGGAAACTAGCATTTCGTATTCCGTTT
+>nematode_1967
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1968
+TCACCGGGTGGAAACTAGCAGTTCGTATTCCGCCT
+>nematode_1969
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1970
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1971
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1972
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1973
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1974
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1975
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1976
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1977
+TCACCGGGTGGAAACTAGCAGTTTCGTATGCCGTC
+>nematode_1978
+TCACCGGGTGGAAACTAGCAGTTCGTATGACGTCT
+>nematode_1979
+TCACCGGGTGGAAACTAGCAGTATCGTATGCCGTC
+>nematode_1980
+TCACCGGGTGGAAAATAGCAGTTCGTATGCCGTCT
+>nematode_1981
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1982
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1983
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1984
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1985
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTTT
+>nematode_1986
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_1987
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCTTCT
+>nematode_1988
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1989
+TCACCGGGTGGAATCTAGCAGTTCGTATTCCGTTT
+>nematode_1990
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1991
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_1992
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1993
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1994
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1995
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1996
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_1997
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1998
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_1999
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2000
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2001
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_2002
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2003
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2004
+TCACCGGGTGGAAACTAGCAGTATCGTATGCCGTC
+>nematode_2005
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_2006
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2007
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2008
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2009
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2010
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_2011
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2012
+TCACCGCGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2013
+TCACCGGGAGAAAAACTGGAGTCGTATGCCGTCTT
+>nematode_2014
+TCACCGGGGGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2015
+TCACCGGGCGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2016
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2017
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2018
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_2019
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_2020
+TCACCGGGTGGAAACTAGCATCGTATGCCGTCTTC
+>nematode_2021
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_2022
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2023
+TCACCGGGCGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2024
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2025
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGCTT
+>nematode_2026
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2027
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2028
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2029
+TCACCGGGAGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2030
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2031
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2032
+TCACCAGGTGGAAACTAGCAGTTCGTATGCCCTCT
+>nematode_2033
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2034
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2035
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2036
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2037
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2038
+TCACCGGGTGGAAACTAGCAGTTTCGTATGCCGTC
+>nematode_2039
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2040
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2041
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2042
+TCACCGGGTGTAAATCAGCTTTTCGTATGCCGTCT
+>nematode_2043
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2044
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2045
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2046
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2047
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2048
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2049
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2050
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2051
+TCACCGGGTGGAAACTAGCAGTTTCGTATGCCGAC
+>nematode_2052
+TCACCGGGTGGAAACTAGCAGTTCGTATTCCGTCT
+>nematode_2053
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTAT
+>nematode_2054
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2055
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2056
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2057
+TCACCGGGTGGAAACTAGCATTTCGTATGCCGTTT
+>nematode_2058
+TCACCGGGTGGAAACTAGCAGTTTCGTATGCCGTC
+>nematode_2059
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2060
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2061
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2062
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2063
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2064
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2065
+TCACCGGGTGAAAATTCGCATGTCGTATTCTGTCT
+>nematode_2066
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTTT
+>nematode_2067
+TCACCGGGTGGAAACTATCAGTTCGTATGTCGTCT
+>nematode_2068
+TCACCGGGGGGAAACTAGCATCGTATGCCGTCTTC
+>nematode_2069
+TCACCGGGCGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2070
+TCACCGGGTGGAACCTAGCAGTTCGTATGCCGTCT
+>nematode_2071
+TCACCGGGGGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2072
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2073
+TCACCGGGTGAACACTTGCAGTTCGTATTCCGTCT
+>nematode_2074
+TCACCGGGCGAACACTTGCAGTTCGTATCCTCTTT
+>nematode_2075
+TCACCGGGTGAACACTTGCAGTTCGTATGCTGTCT
+>nematode_2076
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2077
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2078
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2079
+TCACCGGGGGGAAACTAGCAGTTCGTATGCCGTTT
+>nematode_2080
+ACCGGGTGAACACTTGCAGTTCGTATGCCGTCTTC
+>nematode_2081
+TCAACGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2082
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2083
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2084
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTTT
+>nematode_2085
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2086
+ACCGGGTGGAAACTAGCAGTTCGTATGCCGTCTTC
+>nematode_2087
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_2088
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2089
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGCCT
+>nematode_2090
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2091
+TCACCGGGAGGAAAACTGGAGTTCGTATTCCGCTT
+>nematode_2092
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2093
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_2094
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2095
+ATCACCGGGTGAACACTTGCATCGTATGCCGTCTT
+>nematode_2096
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2097
+TCACCGGGTGGAAACTAGCAGTTCGTATGACGTCT
+>nematode_2098
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2099
+TCACCGGGAGAAAAACTGGTGTTCGTATGCCGTCT
+>nematode_2100
+TCACCGGGTGGAAACTAGCAGTCGTATGCCGTCTT
+>nematode_2101
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCCTCT
+>nematode_2102
+TCACCGGGAGAAAAACTGGAGTTTCGTATGCTGTC
+>nematode_2103
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2104
+TCACCGGGTGTACATCAGCTAATCGTATCCCGTCT
+>nematode_2105
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_2106
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_2107
+TCACCGGGTGTAAATCAGCTTTCGTATGCCGTCTT
+>nematode_2108
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2109
+TCACCGGGAGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2110
+TCACCGGGTGAAGACTTGCAGTTCGTATGCCGTCT
+>nematode_2111
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2112
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTTT
+>nematode_2113
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2114
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2115
+TCACCGGGTGAACACTTGCAGTTTCGTATTCCGTC
+>nematode_2116
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2117
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_2118
+TCACCGGGTGAACACTTGCAGTCGTATGCCGTCTT
+>nematode_2119
+TCACCGGGCGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2120
+ACCGGGTGAACACTTGCAGTTCGTATGCCGTCTTC
+>nematode_2121
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2122
+TCACCGGGTGGAAACTAGCAGTTTCGTATGCCGTC
+>nematode_2123
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2124
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2125
+TCACCGGGTGAACACTTGCAGTCGTATGCCGTCTT
+>nematode_2126
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2127
+TCACCGGGTGAACACTTGAAGTTCGTATGCCGTCT
+>nematode_2128
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2129
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2130
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2131
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2132
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2133
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2134
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_2135
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2136
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2137
+TCACCGGGTAAACACTTGCAGTTCGTATGCCGTTT
+>nematode_2138
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2139
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2140
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2141
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2142
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2143
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2144
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2145
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2146
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2147
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2148
+TCACCGGGTGGAAACTAGCAGTTCGTATGTCGTCT
+>nematode_2149
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_2150
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2151
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2152
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2153
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2154
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2155
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2156
+TCACCGGGTGAACACTTGCAGCTCGTATCCCGTCT
+>nematode_2157
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2158
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2159
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2160
+TCACCGGGGGAAAATTCGCATGTCGTATGCCGTAT
+>nematode_2161
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2162
+TCACCGGGTGGAAACTACCAGTTCGTATGTCGTCT
+>nematode_2163
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2164
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2165
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2166
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_2167
+TCACCGGGTGCAAATTCGCATGTCGTATGCTGTTT
+>nematode_2168
+TCACCGGGGGGAAACTAGCAGTTCGTATTCCGTCT
+>nematode_2169
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2170
+TCACCGGGAGAACACTTGCAGTTCGTATGTTGTTT
+>nematode_2171
+TCACCGGGTGTAAATCAGCTTTCGTATGCCGTCTT
+>nematode_2172
+TCACCGGGGGAACACTTGCAGTTCGTATGTCGTCT
+>nematode_2173
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2174
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_2175
+TCACCGGGTGGAAACTAGCAGTCGTATTCCGTCTT
+>nematode_2176
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2177
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2178
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2179
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2180
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2181
+TCACCGGGTGTACATCAGCTAATCGTATTCCGTCT
+>nematode_2182
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2183
+TCACCGGGCGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2184
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2185
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2186
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2187
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGCCT
+>nematode_2188
+TCACCGGGTGTAAATTAGCTTGTCGTATGCCGTCT
+>nematode_2189
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2190
+TCACCGGGTGGAGACTAGCAGTTCGTATGCCGTCT
+>nematode_2191
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2192
+TCACCGGGTGAACACTTGCAGTTCGTATGCTGTCT
+>nematode_2193
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2194
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_2195
+TCACCGGGTGAAAACTTGCAGTTCGTATGCCGTCT
+>nematode_2196
+TCACCGGGTGGAAACTAGCAGTTTCGTATGCCGTC
+>nematode_2197
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2198
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2199
+TCACCGGGTGGAAACTAGCTGTTCGTATGCCGTCT
+>nematode_2200
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_2201
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTTT
+>nematode_2202
+TCACCGGGTGGAAACTAGCCGTTCGTATGCCGCCT
+>nematode_2203
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2204
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2205
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2206
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2207
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2208
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2209
+TCACCGGGTGAACACTTGCAGTATCGTATGCCGTC
+>nematode_2210
+TCACAGGGTGGAAACTAGCAGTTCGTATGCTGTTT
+>nematode_2211
+TCACCGGGGGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2212
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2213
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2214
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2215
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2216
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_2217
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2218
+TGACCGGGTGTACATCAGCTAATCGTATGCCGACT
+>nematode_2219
+TCACCGGGTGGAAACTAGCAGTTCGTATGCGGTCT
+>nematode_2220
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTTT
+>nematode_2221
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTTT
+>nematode_2222
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_2223
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTTT
+>nematode_2224
+TCACCGGGGGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2225
+TCACCGGGCGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2226
+TCACCGGGTGGAAAATAGCAGTTCGTATGCCGTTT
+>nematode_2227
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2228
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2229
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2230
+TCACCGGGTGAACACTTGCAGTTCGTATCCCGTCT
+>nematode_2231
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2232
+TCACCGGGTGAACACTTGCTGTTCGTATGCCGTCT
+>nematode_2233
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2234
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2235
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_2236
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2237
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2238
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2239
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2240
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2241
+TCACCGGGTGAACACTTGCAGTATCGTATGCAGTA
+>nematode_2242
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2243
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2244
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2245
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2246
+TCACCGGGTGTACACTTGCAGTTCGTATGCCGTCT
+>nematode_2247
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2248
+TCACCGGGTGGTAACTAGCAGTTCGTATGATGCCT
+>nematode_2249
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2250
+TCACCGGGTGAACAATTGCAGTTCGTATGCCGTCT
+>nematode_2251
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2252
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_2253
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2254
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTTT
+>nematode_2255
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2256
+TCACCGGGTGGAAACTAGCAGTTCGTATTCCGTCT
+>nematode_2257
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2258
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2259
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2260
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2261
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2262
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_2263
+TCACAGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2264
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2265
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2266
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2267
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2268
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2269
+TCACCGGGTGGAAACTAGCACTTCGTATTCCGTCT
+>nematode_2270
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2271
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGGCT
+>nematode_2272
+TCACCGGGTGGAAACTAGCAGCTCGTATGCCGTCT
+>nematode_2273
+TCACCGGGTGTACATCAGCTAATCGTATTCCGTCT
+>nematode_2274
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2275
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2276
+TCACCGGGTGCAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2277
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2278
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2279
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_2280
+TCACCGGATGTACATCAGCTAATCGTATGCCGCTT
+>nematode_2281
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2282
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2283
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2284
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2285
+TCACCGGGTGGAAGCTAGCAGTTCGTATGCTGTCT
+>nematode_2286
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2287
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2288
+TCACCGGGTGGAAACTAACAGTTCGTATGCTGTCT
+>nematode_2289
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2290
+TCACCGGGTGTAAATCAGCTTGTCGTATGCCGTCT
+>nematode_2291
+TCACCGGGTGGAAACTAGCAGTGCTCGTATGCCGT
+>nematode_2292
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_2293
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2294
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2295
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2296
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2297
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2298
+TCACCGGGTGAACACTTGCAGTCGTATGCCGTCTT
+>nematode_2299
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2300
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2301
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2302
+TCACCGGGTGAACACTTGCATCGTATGCCGTCTTC
+>nematode_2303
+TCACCGGGTGGAAACTAGCAGTTCGTATTCCGTCT
+>nematode_2304
+TCACCGGGTGGAAACTAGCAGTCGTATGCCGTCTT
+>nematode_2305
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2306
+TCACCGGCTGAACACTTGCAGTTCGTATGCTGTTT
+>nematode_2307
+TCACCGGGTGGAAACTAGCAGTCGTATGCCGTCTT
+>nematode_2308
+TCACCGGGTGGAAACTAGCAGTGTCGTATGCCGTC
+>nematode_2309
+TCATCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2310
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2311
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2312
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_2313
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_2314
+TCACCGGGTGAACACTTGCAGTCGTATGCCGTCTT
+>nematode_2315
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2316
+TCACCGGGTGATCACTTGCAGTCGTATGCAGTATT
+>nematode_2317
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2318
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2319
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2320
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2321
+TCACCGGGTGGAAAATAGCAGTTCGTATGCCGTCT
+>nematode_2322
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2323
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2324
+TCACCGGGTGAACACTTGCAGTTTCGTATGCCGTC
+>nematode_2325
+TCACCGGGTGTACATCAGCTATCGTATGCCGTCTT
+>nematode_2326
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_2327
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2328
+TCACCGGGTGAATACTTGCAGTTCGTATGCCGTAT
+>nematode_2329
+TCACCGGGTGGAAACTAGCAGTTCGTATTCCGTCT
+>nematode_2330
+TCACCGGGTGGAAACTATCAGTTCGTATGCCGTCT
+>nematode_2331
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2332
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2333
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2334
+TCACCGGGTGGAAACTAGCAGTTCGTATGCGGTCT
+>nematode_2335
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2336
+TCACCGGGTGGAAACTAGCAGTATCGTATGCCGTC
+>nematode_2337
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2338
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2339
+TCACCGGGTTAACACTTGCAGTCGTATGCCGTCTT
+>nematode_2340
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2341
+TCACCGGGTGAACACTTGCAGTTCGTATTCCGTCT
+>nematode_2342
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2343
+TCACCGGGTGTACATCATCTAATCGTATTCTGTTT
+>nematode_2344
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_2345
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2346
+TCACCGGGGGGAAACTAGCAGTTCGTATTCCGTCT
+>nematode_2347
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2348
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2349
+TCACCGGGTGGAAACTAGCAGTCGTATGCCGTCTT
+>nematode_2350
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2351
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2352
+TCACCGGGTGGAAACTAGCAGTTCGTATTCCGTCT
+>nematode_2353
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2354
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_2355
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2356
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTTT
+>nematode_2357
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2358
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTTT
+>nematode_2359
+TCACCGGGTGGAAACTAGCAGTTTCGTATTTCTTT
+>nematode_2360
+TCACCGGGTGGAAACTAGCAGTTCGTATGACGTCT
+>nematode_2361
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2362
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_2363
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2364
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2365
+TCACCGGGTGTAAATCAGCTTTTCGTATGCCGTCT
+>nematode_2366
+TCACCGGGTGGAAACTAGCAGTTTCGTATGCCGTC
+>nematode_2367
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2368
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2369
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2370
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2371
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2372
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2373
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2374
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2375
+TCACCGGGTGAACACTTGCAGTTCGTATGCTGTCT
+>nematode_2376
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2377
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2378
+TCACCGGGTGAACACTTGCATCGTATGCCGTCTTT
+>nematode_2379
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2380
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2381
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2382
+TCACCGGGTGGAAACTAGCAGTTCGTATTCCGTCT
+>nematode_2383
+TCACCGGGTGAACACTTGCACTTCGTATGCCGTCT
+>nematode_2384
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2385
+TCACCGGGTGGAAACTAGCAGTCGTATGCCGTCTT
+>nematode_2386
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2387
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2388
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2389
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2390
+TCACCCGGTGGAAACTAGCAGTTCGTATTGAGTAT
+>nematode_2391
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2392
+TCACCGGGTGGAAACTAGCAGATCGTATGCCGTCT
+>nematode_2393
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2394
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTTT
+>nematode_2395
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2396
+TCACCGGGTGGAAACTAGCAGTTTCGTATGCCGTC
+>nematode_2397
+TCACCGGGTGAACACTTGCAGTTCGTATGGCGTTT
+>nematode_2398
+TCACCGGGTGGAAACTAGCAGTCGTATGCCGTCTT
+>nematode_2399
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2400
+TCACCGGGTGGAAACTAGCAGTTCGTATGCTGTGT
+>nematode_2401
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2402
+TCACCGGGTGGAAACTAGCAGTATCGTATGCCGTC
+>nematode_2403
+TCACCGGGTGAACACTTGCAGTCGTATGCCGTCTT
+>nematode_2404
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2405
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2406
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2407
+TCACCGGGTGAACACTTGCTGTTCGTATGCCGTCT
+>nematode_2408
+TCACCGGGTGTACATCAGCTACTCGTATTCCGTCT
+>nematode_2409
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_2410
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2411
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2412
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2413
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2414
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2415
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2416
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2417
+TCACCGGGTGGAAACTAGCATTTCGTATGCCGTCT
+>nematode_2418
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2419
+TCACCGGGCGGAAACTAGCAGTTCGTATTCCGTCT
+>nematode_2420
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2421
+TCACCGGGGGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2422
+TCACCGGGGGTACATCAGCTAATCGTATGCCGTCT
+>nematode_2423
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2424
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_2425
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_2426
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2427
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2428
+TCACCGGGTGAACACTTGCAGTCGTATGCCGTCTT
+>nematode_2429
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_2430
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2431
+TCACCGGGTGTACATCAGCTAATCGTATGTCGTTT
+>nematode_2432
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2433
+TCACCGGGTGTACATCAGCTAATCGTATTCCGTCT
+>nematode_2434
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2435
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2436
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2437
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2438
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2439
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2440
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2441
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2442
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2443
+TCACCGGGTGGAAACTAGCAGTTCGTATCCCGTCT
+>nematode_2444
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2445
+TCACCGGGTGGAAAATAGCAGTTCGTATGACGTCT
+>nematode_2446
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2447
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_2448
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2449
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2450
+TCACCGGGTGGAAAATAGCAGTTCGTATGCCGTCT
+>nematode_2451
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2452
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2453
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2454
+GCACCGGGTGGAAACTAGCAGTTCGTATTATGCCG
+>nematode_2455
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_2456
+TCACAGGGTGGAAACTAGCAGTTCGTATGCTGTCT
+>nematode_2457
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2458
+TCACCGGGTGTAAATCAGCTTGTCGTATGCCGTCT
+>nematode_2459
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2460
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_2461
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2462
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_2463
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2464
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2465
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2466
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_2467
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2468
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2469
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2470
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2471
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2472
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2473
+TCACCGGGTGTACATCAGCTAATCGTATTCCGTCT
+>nematode_2474
+TCACCGGGTGAAAATTCGCATGTCGTATGCCTTTT
+>nematode_2475
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2476
+ACCGGGTGAACACTTGCAGTATCGTATGCCGTCTT
+>nematode_2477
+TCACCGCGTGGAAACTAGCAGTTCGTATGCTGTCT
+>nematode_2478
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTTT
+>nematode_2479
+TCACCGGGAGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2480
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2481
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2482
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2483
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2484
+TCACCGGGTGGAAACTAGCAGTCGTATGCCGTCTT
+>nematode_2485
+TCACCGGGGGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2486
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2487
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2488
+TCACCGGGGGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2489
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2490
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2491
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2492
+TCACCGGGTGGAAACTAGCAGCTCGTATGCTGTCT
+>nematode_2493
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2494
+TCACCGGGTGGAAACTAGCAGTATCGTATGCCGTC
+>nematode_2495
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2496
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2497
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2498
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2499
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2500
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_2501
+TCACCGGGTGGAAACTAGCAGTCGTATGCCGTCTT
+>nematode_2502
+TCACCGGGTGAACACTTGCAGTTTCGTATGCCGTC
+>nematode_2503
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2504
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2505
+TCACCGGGTGGAGACTAGCAGTTCGTATGCCGTTT
+>nematode_2506
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2507
+TCACCGGGTGAACACTTGCAGTTTCGTATGCCGTC
+>nematode_2508
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2509
+TCACCGGGTGAACACTTGCATCGTATGCCGTCTTC
+>nematode_2510
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_2511
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGACT
+>nematode_2512
+TCACCGGGGGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2513
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_2514
+TCACCGGGTGGCAACTAGCAGTTCGTATGCCGTCT
+>nematode_2515
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2516
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2517
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2518
+TCACCGGGTGGAAAATAGCAGTTCGTATGCCGTCT
+>nematode_2519
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2520
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2521
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2522
+TCACCGGGTGAACACTTGCAGTCGTATGCCGTCTT
+>nematode_2523
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2524
+TCACCGGGAGAAAAACTGGAGTCGTATGCCGTCTT
+>nematode_2525
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2526
+TCACCGGGTGGAAACTAGCATCGTATGCCGTCTTC
+>nematode_2527
+TCACCGGGTGGAAACTAGCAGTTCGTATTCCGTCT
+>nematode_2528
+TTACCGGGTGAACACTTGCAGTTCGTATTCCGTCT
+>nematode_2529
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2530
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2531
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2532
+TCACCGGGTGAACACTTGCAGTTCGTATTCCGTCT
+>nematode_2533
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_2534
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2535
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2536
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2537
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2538
+TCACCGGGTGGAAACTAGCAGTTCGTATGTCGTCT
+>nematode_2539
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2540
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2541
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2542
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2543
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2544
+TCACCGGGTGGAAACTAGCAGTTCGTATGTCGTCT
+>nematode_2545
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_2546
+TCACCGGGTGGAAACTAGCAGTATCGTATGCCGCC
+>nematode_2547
+TTACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2548
+TCACCGGGTGGAAACTAGCAGTTCGTATTCCGTCT
+>nematode_2549
+TCACAGGGTGAACACTTGCAGTTCGTATGACGTCT
+>nematode_2550
+GCACCGGGTGAACACTTGCATCGTATGCCGTTTTC
+>nematode_2551
+TCACCGGGTGAACACTTGCAGTCGTATGCCGTCTT
+>nematode_2552
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2553
+TCACCGGGTGGAAATTAGCAGTTCGTATGCTGTCT
+>nematode_2554
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2555
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2556
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2557
+TCACCGGGCGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2558
+ACCGGGTGGAAACTAGCAGTCGTATGCCGTCTTCT
+>nematode_2559
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2560
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_2561
+TCACCGGGTGTAAATCAGCTTGTCGTATGCCGTCT
+>nematode_2562
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2563
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2564
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2565
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2566
+TCACCGGGTGAACACTTGCAGATCGTATGCCGTCT
+>nematode_2567
+TCACCGGGGGAACACTTGCAGTTCGTATGCTGTCT
+>nematode_2568
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTTT
+>nematode_2569
+TCACCGGGTGAACACCTGCAGTTCGTATGCCGTCT
+>nematode_2570
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_2571
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2572
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2573
+TCACCGGGTGGCAACTAGCAGTTCGTATGCCGTCT
+>nematode_2574
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2575
+TCACCGGGTGGAAACTAGCAGTTTCGTATGCCGTC
+>nematode_2576
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2577
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2578
+TCACCGGGTGTACATCAGCTAATCGTATGACGTCT
+>nematode_2579
+TCACCGGGTGGAAACTAGCAGTTCGTATGACGTCT
+>nematode_2580
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2581
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2582
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2583
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2584
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2585
+TCACCGGGTGGAAACTAGCAGTTCGTATTCCGTCT
+>nematode_2586
+TCACCGGGTGGTAACTAGCAGTTCGTATGCCGTCT
+>nematode_2587
+TCACCGGGTGAACACTTGCAGTTCGTATGCAGGTT
+>nematode_2588
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2589
+TCACCGGGTGGCAACTAGCAGTTCGTATGCCGCCT
+>nematode_2590
+AGCTGATTTCGTCTTGGTAATATCGTATGCCGTCT
+>nematode_2591
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2592
+TCACCGGGTGGAACCTAGCAGTTCGTATGCCTTCT
+>nematode_2593
+TCACCGGGTGAAAACTTGCAGTCGTATGCCGTATT
+>nematode_2594
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2595
+TCACCGGGTGGAAACTAGCAGCTCGTATGCCGTTT
+>nematode_2596
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2597
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2598
+TCACCGGGTGGAAACTAGCAGTTCGTATGCTGTTT
+>nematode_2599
+TCACCGGGTGGAAACTATCAGTTCGTATGCCGTCT
+>nematode_2600
+TCACCGGGTGGAAACTAGCAGTTCGTATGCAGTCT
+>nematode_2601
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2602
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2603
+ACCGGGTGTACATCACCTAATCGTATGCCCTCTTC
+>nematode_2604
+TCACCGGGTGGAAACTAGCAGTTCGTATGTCGTCT
+>nematode_2605
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2606
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2607
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2608
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2609
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2610
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2611
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2612
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_2613
+TCACCGGGAGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2614
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2615
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2616
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2617
+TCACCGGGTGGAAACTAGCATCGTATGCCGTCTTC
+>nematode_2618
+TCACCGGGTGTACATCAGCTATTCGTATGCCGTCT
+>nematode_2619
+TCACCGGGTGGAAACTAGCAATTCGTATGCCGTCT
+>nematode_2620
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2621
+TCACCGGGGGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2622
+ATCACCGGGTGAACACTTGCAGTTCGTATGCCGTC
+>nematode_2623
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2624
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2625
+TCACCGGGTGGAAACTAGCAGGTCGTATGCCGTCT
+>nematode_2626
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_2627
+TCACCGGGTGGCAACTAGCAGTTCGTATGCTGTCT
+>nematode_2628
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2629
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2630
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2631
+TCACCGGGTGGAAACTAGCATTCGTATGCCGTCTT
+>nematode_2632
+CACCGGGTGAACACTTGCAGTTCGTATGCCGTCTT
+>nematode_2633
+TCACCGGGTGGAAATTAGCAGTTCGTATGTCGTCT
+>nematode_2634
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2635
+ACCGGGAGGAAACTAGCAGTTCGTATGCCGACTTC
+>nematode_2636
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2637
+TCACCGGGTGGAAACTAGCAGTTTCGTATGTCGTC
+>nematode_2638
+TCACCGGGAGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2639
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2640
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2641
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2642
+TCACCGGGTGAACACTTGCATCGTATGCCGTCTTC
+>nematode_2643
+TCACCGGGCGAACACTTGCAGTTCGTATGCTGTCT
+>nematode_2644
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_2645
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2646
+AGCTGATTTCGTCTTGGTAATATCGTATTCCGTCT
+>nematode_2647
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2648
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2649
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2650
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2651
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2652
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2653
+TCACCGGGAGTACATCAGCTAATCGTATGCCGTTT
+>nematode_2654
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2655
+TCACCGGGTGGAAACTAGCAGTATCGTATGCCGTC
+>nematode_2656
+TCACCGGGTGAACACTTGCAGTCGTATGCCGTCTT
+>nematode_2657
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2658
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTTT
+>nematode_2659
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2660
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2661
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_2662
+AGCTGATTTCGTCTTGGTAATATCGTATGCCGTCT
+>nematode_2663
+TCACCGGGTGTACATCAGCTAATCGTATGCCGCCT
+>nematode_2664
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2665
+TCACCGGGTGGAAACTAGCAGTTCGTATGTCGTCT
+>nematode_2666
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2667
+TCACCGGGTGGAAACTAGCAGTCGTATGCCGTCTT
+>nematode_2668
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2669
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2670
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2671
+TCACCGGGTGGAAACTAGCAGTTTCGTATGCCGTC
+>nematode_2672
+TCACCGGGTGAACACTTGCAGTTCGTATGCGGTTT
+>nematode_2673
+TCACCGGGTGTACATCAGCTAATCGTATGCAGTCT
+>nematode_2674
+TCACCGGGTGAACACTTGCATCGTATGCCGTCTTC
+>nematode_2675
+TCACCGGATGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2676
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2677
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2678
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2679
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2680
+TCACCGGGTGGAAACTAGCAGTTCGTATGCTGTGT
+>nematode_2681
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2682
+TCACCGGGTGTAAATCAGCTTGTCGTATGCCGTCT
+>nematode_2683
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2684
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2685
+TCACCGGGCGGAAACTAGCAGTTCGTATGCGGTCT
+>nematode_2686
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2687
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2688
+TCACCGGGTGAACACTGGCAGTTCGTATGCCGTCT
+>nematode_2689
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2690
+TCACCGGGTGGAAACTAGCAGTTCGTATTCCGTCT
+>nematode_2691
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTTT
+>nematode_2692
+TCACAGGGTGTACATCAGCTAATCGTATGACGTCT
+>nematode_2693
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2694
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2695
+TCACCGGGTGAACACTTGCAGTCGTATGCCGTCTT
+>nematode_2696
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2697
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2698
+TCACCGGGTGAACACTTGCATCGTATGCCGTCTTC
+>nematode_2699
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTTT
+>nematode_2700
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2701
+TCACCGGGTGGAAACTAGCAGTTCGTATGCTGTCT
+>nematode_2702
+TCACCGGGTGGAAACTAGCAGCTCGTATGCCGTCT
+>nematode_2703
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2704
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2705
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_2706
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2707
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2708
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2709
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2710
+TCACCGGGTGAACACTTGCAGTTTCGTATGCCGTC
+>nematode_2711
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_2712
+TNACCGGGAGAAAAACTGGAGTTCGTATGCCGTCT
+>nematode_2713
+TCACCGGGTGGGAACTAGCAGTTCGTATGCCGTCT
+>nematode_2714
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2715
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2716
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2717
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2718
+TCACCGGGTGTAAATCAGCTTGTCGTATGCCGTCT
+>nematode_2719
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2720
+TCACCGGGTGTACATCCGCTAATCGTATTCCGTCT
+>nematode_2721
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTTT
+>nematode_2722
+TCACCTGGTGGAAACTAGCAGTCGTATGCCGTCTT
+>nematode_2723
+TCACCGGGTGAACACTTGCAGTTCGTATGCTGTCT
+>nematode_2724
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2725
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2726
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2727
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2728
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_2729
+ACCGGGTGGAAACTAGCAGTTTCGTATGTCGTCTT
+>nematode_2730
+TCACCGGGTGTACATCAGCTATTCGTATGCCGTCT
+>nematode_2731
+TCACCGGGTGTACATCAGCTAATCGTATGCAGTCT
+>nematode_2732
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2733
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2734
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2735
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2736
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2737
+TCACCGGGTTGAAACTAGCAGTCGTATGTCGTCTT
+>nematode_2738
+TCACCGGGTGGAAACTAGCAGTATCGTATGCCGTT
+>nematode_2739
+TCACCGGGCGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2740
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2741
+TCACCGGGTGCACATCAGCTAATCGTATGCCGTCT
+>nematode_2742
+TCACCGGGTGGAAACTTGCAGTTCGTATGCCGTCT
+>nematode_2743
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2744
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2745
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_2746
+TCACCGGGTGGACATCAGCTAATCGTATTCTGTTT
+>nematode_2747
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2748
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_2749
+TCACCGGGTGTACATTAGCTAATCGTATGCCGTCT
+>nematode_2750
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2751
+TCACCGGGTGGAAACTAGCAGTTTCGTATGCCGTC
+>nematode_2752
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2753
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2754
+TCACCGGGTGGAAACTAGAAGTTCGTATGCCGTCT
+>nematode_2755
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2756
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2757
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2758
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2759
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2760
+TCACCGGGTGTACACTTGCAGTTCGTATGCCGTCT
+>nematode_2761
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2762
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2763
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2764
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_2765
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2766
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2767
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2768
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_2769
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2770
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2771
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2772
+TCACAGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_2773
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2774
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2775
+TCACCGGGTGGAAACTAGCAGTTTCGTATGCCGTC
+>nematode_2776
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_2777
+TCAACGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2778
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2779
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2780
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2781
+TCACCGGGGGGAAACTAGCAGTCGTATGCCGTCTT
+>nematode_2782
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_2783
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2784
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_2785
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2786
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2787
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2788
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_2789
+TCACCGGGTGAACACTTGCAGTTTCGTATGCCGTT
+>nematode_2790
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2791
+TCACCGGGTGTACACTTGCAGTTCGTATTCCTTCT
+>nematode_2792
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2793
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2794
+TCACCGGGTGGAAACTAGCAGTATCGTATGCCGTC
+>nematode_2795
+TCACCGGGTGAACCCTTGCAGTTCGTATTCCGTCT
+>nematode_2796
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_2797
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2798
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2799
+TCACCGGGAGAAAAACTGCAGTTCGTATGCCGTCT
+>nematode_2800
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2801
+TCACCGGGTGAAAACTTGCAGTTCGTATGCCGTCT
+>nematode_2802
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_2803
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2804
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2805
+TCACCGGGTGGAAACTAGCAGTTCGTATGTCGTCT
+>nematode_2806
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2807
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2808
+TCAGCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2809
+TCACCGGGTGAACACTTGCAGTTTCGTATGCCGTC
+>nematode_2810
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2811
+TCACCGGGAGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2812
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2813
+TCACAGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2814
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2815
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2816
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2817
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2818
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2819
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGCCT
+>nematode_2820
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2821
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2822
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2823
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2824
+TCACAGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2825
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2826
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2827
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2828
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2829
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2830
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2831
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2832
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2833
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2834
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2835
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2836
+TCACCGGGTGTATATCAGCTAATCGTATGACGTGT
+>nematode_2837
+TCACCTGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2838
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2839
+TCACCGGGTGGAAACTAGCAGTTTCGTATGCCGTC
+>nematode_2840
+TCACCGGGTGAACACTTGCAGTTCGTATGCGGTCT
+>nematode_2841
+TCACCGGGTGGAAACTAGCAGTTCGTATTCCTTTT
+>nematode_2842
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2843
+TCACCGGGTGGAAACTAGCATCGTATGCCGTCTTT
+>nematode_2844
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2845
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2846
+TCACCGGGTGGAAACTAGCAGGTCGTATGACGTCT
+>nematode_2847
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2848
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_2849
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2850
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2851
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_2852
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2853
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2854
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2855
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2856
+TCACCGGGTGAACACTTGCAGCTCGTATGCCGTCT
+>nematode_2857
+TCACCGGGTGGAAAATAGCAGTTCGTATGCCGTTT
+>nematode_2858
+TCCCCGGGTGGAAACTAGCAGTTCGTATGTCGTCT
+>nematode_2859
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2860
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2861
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2862
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2863
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2864
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2865
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2866
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2867
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_2868
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2869
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_2870
+TCACCGGGTGGAAACTAGCAGTCGTATGCCGTCTT
+>nematode_2871
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2872
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2873
+TCACCGGGTGAACACTTGCAGTTCGTATGTCGTCT
+>nematode_2874
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2875
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2876
+TCACCGGGTGTACATCAGCTAAATCGTATGCCGTC
+>nematode_2877
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2878
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2879
+TCACCGGGTGGAAACTAGCAGTCGTATGTGGTGTT
+>nematode_2880
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2881
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2882
+TCACCGGGTGGAAACTAGCATCGTATGTCGTCTTT
+>nematode_2883
+TCACCGGGTGAACACTTGCAGTTCGTATGCGGTCT
+>nematode_2884
+TCACCGGGTGCACATCAGCTAATCGTATTGCGTCT
+>nematode_2885
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2886
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2887
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2888
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2889
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2890
+TCACCGGGTGGAAACTAGCAGTTCGTATGCTGTCT
+>nematode_2891
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2892
+TCACCGGGAGGAAACTAGCAGTTCGTATGCTGTCT
+>nematode_2893
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2894
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2895
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2896
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2897
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2898
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2899
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2900
+TCACCGGGTGAACACTTGCAGTATCGTATGCCGTC
+>nematode_2901
+TCACCGGGTGAAGACTTGCAGTTCGTATGCCGTCT
+>nematode_2902
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2903
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2904
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_2905
+TCACCGGGTGGAAACTAGCAGTTTCGTATGCCGGC
+>nematode_2906
+TCACCGGGTGAAAATTCGCATGTCGTATGCGGTCT
+>nematode_2907
+TCACCGGGTGGAAACTAGCAGTTTCGTATGCCGTC
+>nematode_2908
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_2909
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2910
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2911
+TCACCGGGCGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2912
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2913
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2914
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2915
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2916
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2917
+TCACCGGATGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_2918
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2919
+TCACCGGGGGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_2920
+TCACCGGGAGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2921
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2922
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2923
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGCTT
+>nematode_2924
+TCACCGGGTGAAAATTCGCATGTCGTATTCCGTCT
+>nematode_2925
+TCACCGGGTGAACACTTGCAGTTCGTATTCTGTCT
+>nematode_2926
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2927
+TCACCGGGTGGAAACTAGCAGTTTCGTATTCTGTT
+>nematode_2928
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2929
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2930
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2931
+TCACCGGGTGAAAACTTGCAGTTCGTATGCCGTCT
+>nematode_2932
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2933
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_2934
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2935
+TCACCGGGTGTACATCAGCTAATCGTATTCCGTCT
+>nematode_2936
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2937
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2938
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2939
+TCACCGGGTGGAAACTAGCAGTTCGTATGTCGTGT
+>nematode_2940
+TCACCGGGTGAACACTTGCTGTTCGTATGAAGTAT
+>nematode_2941
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_2942
+TCACCGGGTGAACACTTGCAGTATCGTATGCCGTC
+>nematode_2943
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2944
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2945
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2946
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2947
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_2948
+TCACCGGGTGGAAACTAGCAGTTCGTATGACGTCT
+>nematode_2949
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2950
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2951
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2952
+TCACCGGGTGAACACTTGCTGTTCGTATCCCGTCT
+>nematode_2953
+TCACCGGGTGTACATCAGCTATTCGTATGCCGTCT
+>nematode_2954
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2955
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_2956
+TCACCGGGTGAACACTTGCATTTCGTATGCCGTCT
+>nematode_2957
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_2958
+TCACCGGGTGGAAACTAGCAGGTCGTATGCCGTCT
+>nematode_2959
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2960
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2961
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2962
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTTT
+>nematode_2963
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_2964
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2965
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2966
+TCACCGGGCGGAAACTAGCAGTTCGTATGCCGTTT
+>nematode_2967
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2968
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2969
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2970
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2971
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2972
+TCACCGGGTGAACACTTGCAGTATCGTATGCCGTC
+>nematode_2973
+TCACCAGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_2974
+TCACTGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2975
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2976
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2977
+TCACCGGGTGAAAATTCGCATGTCGTATCCCGCCT
+>nematode_2978
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2979
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2980
+TCACCGGGTGGAAACTAGCAGTCGTATGCCGTCTT
+>nematode_2981
+TCACCGGGTGAACACTTGCAGTTTCGTATGCCGTC
+>nematode_2982
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2983
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2984
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2985
+TCACCGGGTGAACACTCGCAGTTCGTATGCCGCCT
+>nematode_2986
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2987
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2988
+TTACCGGGTGGAAACTAGCAGTTCGTATGTCGTCT
+>nematode_2989
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2990
+TCACCGGGTGAAAATTCGCATGTCGTATGCTGTCT
+>nematode_2991
+TCACCGGGGGGAAACTAGCAGTTCGTATGTCGTCT
+>nematode_2992
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_2993
+TCACCGGGTGAACACTTGCAGTCGTATGCCGTCTT
+>nematode_2994
+TCACCGGGTGGAAACTAGCAGTTTCGTATTCCGCT
+>nematode_2995
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2996
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2997
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_2998
+TCACCGGGTGGAAACTAGCAGTATCGTATGCCGTC
+>nematode_2999
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3000
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3001
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3002
+TCACCGGGTGGAAACTAGCAGTTCGTATGACGCGT
+>nematode_3003
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3004
+TCACCGGGTGAACACTTGCATCGTATGCCGTCTTT
+>nematode_3005
+TCACCGGGTGGAAACTAGCAGTTTCGTATGCCGTC
+>nematode_3006
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3007
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3008
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_3009
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3010
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3011
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_3012
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3013
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3014
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3015
+TCACCGGGTGAAAATTCGCAGGTCGTATGCCGTCT
+>nematode_3016
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3017
+TCACCGGGTGAACACTTGCAGATCGTATGTCGTCT
+>nematode_3018
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3019
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3020
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3021
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3022
+TCACCGGGTGGAAACTAGCAGTTCGTATTCCGTCT
+>nematode_3023
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3024
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3025
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3026
+TCACCGGGTAGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3027
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3028
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3029
+TCACCGGGTGGAAACTAGCAGTTCGTATGCTGTAT
+>nematode_3030
+TCACCGGGCGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3031
+GCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3032
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3033
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3034
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3035
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3036
+TTACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3037
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3038
+TCACTGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_3039
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3040
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_3041
+TCACCGGGTGAACACTTGCAGTTTCGTATGCCGTC
+>nematode_3042
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3043
+TCACAGGGTGGAAACTAGCAGTTCGTATGCCTTCT
+>nematode_3044
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3045
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3046
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_3047
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3048
+TCACCGGGTGAACACTTGCATCGTATGCCGTCTTT
+>nematode_3049
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3050
+TCACCGGGTGGAAACTAGCAGTCGTATGCCGTCTT
+>nematode_3051
+TCACCGGGTGGAAACTAGCAGTTCGTATGTCGTCT
+>nematode_3052
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCTCTT
+>nematode_3053
+ACACCGGGTGGAAACTAGCAGTTCGTATGCCGCCT
+>nematode_3054
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3055
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3056
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3057
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3058
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3059
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3060
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3061
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3062
+TCACCAGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_3063
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3064
+TCACCGGGTGTACATCAGCTAATCGTATGCCTTCT
+>nematode_3065
+TCACCGGGTGGAAACTAGCAGATCGTATGCCGTCT
+>nematode_3066
+TCACCGGGTGAACACTTGCAGTTCGTATGCGGTCT
+>nematode_3067
+TCACCGGGAGAACACTTGCATCGTATGCCGTGTTC
+>nematode_3068
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3069
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3070
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3071
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3072
+TCACCGGGTGTACATCAGCTAATTCGTATGCCGTC
+>nematode_3073
+TCACCGGGTGGAAACTAGCAGTTCGTATGAGGTCT
+>nematode_3074
+TCAACGGGTGGAAACTAGCATCGTATCTCGTCTTT
+>nematode_3075
+TCACCGGGAGAAAAACTGGAGTTCGTATGCCGTCT
+>nematode_3076
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3077
+TCACCGGGTGAAAATTCGCATTTCGTATGCCGTCT
+>nematode_3078
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3079
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3080
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_3081
+TCACCGGGGGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3082
+AATCACCGGGTGTACATCAGCTAATCGTATGCCGT
+>nematode_3083
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3084
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3085
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3086
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_3087
+TCACCGGATGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3088
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3089
+TCACCGGGAGGAAACTAGCAGTTCGTATGCTGTCT
+>nematode_3090
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3091
+TCACCGGGAGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3092
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3093
+TCACCGGGTGGAAACTGGCAGTTCGTATCCCGTTT
+>nematode_3094
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3095
+TCACCGGGGGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3096
+TCACGGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3097
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_3098
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3099
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3100
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3101
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3102
+TCACCGGGTTGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3103
+TCACCGGGTGGAAACTAGCAGTCGTATGCCGTCTT
+>nematode_3104
+TCACCGGGTGGAAACTAGCAGTCGTATGCCGTCTT
+>nematode_3105
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3106
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3107
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3108
+ACCGGGTGTAAATCAGCTTTTCGTATGCCGTCTTC
+>nematode_3109
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3110
+TCATCGGGTGAACACTTGCAGTTCGTATGCTGTCT
+>nematode_3111
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3112
+TCACCGGGTGGAAACTAGCAGTTTCGTATGCCGTC
+>nematode_3113
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3114
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3115
+TCGCCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3116
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3117
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3118
+TCACCGGGTGGAAACTAGCAGTTTCGTATGCCGTC
+>nematode_3119
+TCACCGGGTGGAAACTAGCAGTTCGTATGTCGTCT
+>nematode_3120
+AGCTGATTTCGTCTTGGTAATATCGTATGCCGTCT
+>nematode_3121
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3122
+TCACCGGGTGGTAACTAGCAGTTCGTATGCCGTCT
+>nematode_3123
+TCACCGGGTGGAAACTAGCAGTTCGTATTCTGTCT
+>nematode_3124
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3125
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_3126
+TCACCGGGTGCACATCAGCTAATCGTATGTCTTCT
+>nematode_3127
+TCACCGGGTGCACACTTGCAGTTCGTATGCCGTCA
+>nematode_3128
+TCACCGTGTGGAAACTAGCAGTCGTATGACGTCTT
+>nematode_3129
+AGCTGATTTCGTCTTGGTAATATCGTATGCCGTCT
+>nematode_3130
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3131
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3132
+GGCTAGATCTTTTCCACTTCGTATTCCGTCTTCTG
+>nematode_3133
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3134
+TCACCGGGTGAACACTTGCAGTTCGTATTCCGTCT
+>nematode_3135
+TCACCGGGAGTACATCAGCTAATCGTATGCGGTCT
+>nematode_3136
+ACCGGGTGAACACTTGCAGTTCGTATGCCGTCTTC
+>nematode_3137
+ACCGGGTGAACACTTGCAGTTCGTATGCCGTCTTC
+>nematode_3138
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3139
+TCACCGGGTGGAAACTAGCAGTTCGTATGACGTCT
+>nematode_3140
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3141
+AGCTGATTTCGTCTTGGTAATTCGTATGCCGTCTT
+>nematode_3142
+TCACCGGGTGGAAACTAGCAGTTCGTATGTCGTCT
+>nematode_3143
+ACCGGGTGGAAACTAGCAGTTCGTATGCCGTCTTC
+>nematode_3144
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3145
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTAT
+>nematode_3146
+ACCGGGTGTACATCAGCTAATCGTATGCCGCCTTC
+>nematode_3147
+AGCTGATTTCGTCTTGGTAATATCGTATGCCGTCT
+>nematode_3148
+TCACCGTGTGGAAACTAGCAGTTCGTATGCCTTCT
+>nematode_3149
+TCACCTGGTGTAAATCAGCTTGTCGTATGCCGTCT
+>nematode_3150
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3151
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3152
+TCACCGGGTGGAAAATAGCAGTTCGTATGCCGTCT
+>nematode_3153
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3154
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3155
+TCACCGGGTGTAAATCAGCTTGTCGTATGCTTTCT
+>nematode_3156
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3157
+TCACCGGGTGGAAACTAGCATCGTATGCCGTCTTC
+>nematode_3158
+TCACCGGGTGGAAACTAGCAGTCGTATGCCGTCTT
+>nematode_3159
+TCACCGGGTGAAAACTTGCAGTTCGTATGCCGTCT
+>nematode_3160
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_3161
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3162
+TCACCGGCTGTACATCAGCTATCGTATTCCGTTTT
+>nematode_3163
+AGCTGATTTCGTCTTGGTAATATCGTATGCCGTCT
+>nematode_3164
+AATCACCGGGTGAACACTTGCAGTTCGTATGCCGT
+>nematode_3165
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3166
+TCACCGGGTGGAAACTAGCAGTATCGTATGCCGTC
+>nematode_3167
+TCACCGGGTGGAAACCAGCAGTTCGTATGCCGTCC
+>nematode_3168
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3169
+TCACCGGGTTTACATCAGCTAATCGTATGCCGTCT
+>nematode_3170
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3171
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3172
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3173
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_3174
+TCACCGGGTGTACATCAGCTAATCGTATGTCGTCT
+>nematode_3175
+TCACCGGGTGAAAATTCGCATGTCGTATCCCGTCT
+>nematode_3176
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3177
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3178
+TCACAGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3179
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3180
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3181
+TCACCGGGTGAACACTTGCAGTCGTATGCCGTCTT
+>nematode_3182
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_3183
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3184
+TCACCGGGTGAACACTTGCAGCTCGTATGCCGTCT
+>nematode_3185
+TCACCGGGTGGTAACTAGCAGTTCGTATGCTGTTT
+>nematode_3186
+TCACCGGGTGGAAACTAGCAGTTTCGTATGCCGTT
+>nematode_3187
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3188
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_3189
+TCGCCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3190
+TCACCGGGCGAACACTTGCATCGTATGCCGTCTTC
+>nematode_3191
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3192
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3193
+TCACCGGCTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3194
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3195
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3196
+TCACCGGGTGAACACTTGCAGTATCGTATGCCGTC
+>nematode_3197
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3198
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_3199
+TCACAGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3200
+CCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3201
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3202
+TCACCGGGTGGAAACTAGCAGCTCGTATGACATAT
+>nematode_3203
+TCACCGGGTGGAAACTAGCAGTTTCGTATGCCGTC
+>nematode_3204
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3205
+CACCGGGTGTACATCAGCTAAATCGTATGCCGTTT
+>nematode_3206
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3207
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3208
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3209
+TCACAGGGTGGAAACTAGCAGTTCGTATGCCGTTT
+>nematode_3210
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3211
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3212
+TCACCGGGTGGAAACTAGAAGTTCGTATGACGTAT
+>nematode_3213
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3214
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3215
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_3216
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3217
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3218
+TCACCGGGTGAAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3219
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3220
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTTT
+>nematode_3221
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3222
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3223
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3224
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3225
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_3226
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_3227
+TCACCGGGTGAACACTTGCAGTCGTATGCCGTCTT
+>nematode_3228
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3229
+TCACCGGGTGTACATCAGCTATCGTATGCCGTCTT
+>nematode_3230
+TCACAGGGTGGAAACTAGCAGTTCGTATGCCTTTT
+>nematode_3231
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3232
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_3233
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3234
+TCACCGGGGGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3235
+TCACCGGGTGGAAACTAGCAGTATCGTATGCATAT
+>nematode_3236
+TCACCGGGAGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3237
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3238
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3239
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3240
+TCAGCGGGTGGAAACTAGCAGTTCGTATGCTGTCT
+>nematode_3241
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3242
+TCACCGCGTGAACACTTGCAGTTCGTATGCTGTCT
+>nematode_3243
+TCACCGGGTGGAATCTAGCAGTCGTATGCCGTCTT
+>nematode_3244
+TCACCGGGTGAAAACTTGCAGTTCGTATGCCGTCT
+>nematode_3245
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_3246
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3247
+TCACCGGGTGAACACTTGCAGTTCGTATGTCGTCT
+>nematode_3248
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3249
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3250
+TCACCGGGTGGAAACTAGAAGTTCGTATGCCGTCT
+>nematode_3251
+TCACCGGGTGTACATAAGCTAATCGTATGTCGTTT
+>nematode_3252
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_3253
+TCACAGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3254
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3255
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3256
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3257
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3258
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_3259
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3260
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3261
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3262
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3263
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_3264
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3265
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3266
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3267
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3268
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3269
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3270
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3271
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3272
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGCCT
+>nematode_3273
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3274
+CACCGGGTGGAAACTAGCAGTTCGTATGCCGTCTT
+>nematode_3275
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3276
+TCACAGGGTGGAAACTAGCAGTTCGTATGCCGTTT
+>nematode_3277
+TCACCGGGTGGAAACTAGCAGTTCGTATGACGACT
+>nematode_3278
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3279
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3280
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3281
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3282
+TCACCGGGTGTAAATCAGCTTGTCGTATGCCGTCT
+>nematode_3283
+TCACCGGGTGAAGATTCGCATGTCGTATGCCGTCT
+>nematode_3284
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3285
+TCACCGGGCGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3286
+TCACCGGGTGGAAACTAGCAGTCGTATGCCGTCTT
+>nematode_3287
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3288
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3289
+TCACCGGGTGGAAACTAGCAGTTTCGTATGCCGTC
+>nematode_3290
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3291
+TCACCGGGAGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3292
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3293
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3294
+TCACCGGGTGAACACTTGCAGTATCGTATGCCGTC
+>nematode_3295
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3296
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3297
+TCATCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3298
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3299
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3300
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_3301
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3302
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTTT
+>nematode_3303
+TCACCGGGTGGAAACTAGCAGTCGTATGCCGTCTT
+>nematode_3304
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3305
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3306
+TCACCGGGTGTAAATCAGCTTGTCGTATGCCGTCT
+>nematode_3307
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3308
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3309
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_3310
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3311
+TCACCGGGTGAACACTTGCATTCGTATGCGTCCTT
+>nematode_3312
+TCACCGGGTGGAAACTAGCAGTTCGTATGACGTCT
+>nematode_3313
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3314
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3315
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3316
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3317
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3318
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3319
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3320
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3321
+TCACCGGGTGGAAACTAGCAGTCGTATGTCGTCTT
+>nematode_3322
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3323
+TCCGGGTGGAAACTAGCAGTTCGTATGCCGTCTTT
+>nematode_3324
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3325
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3326
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3327
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3328
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3329
+TCACCGGGGGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3330
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3331
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3332
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3333
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_3334
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3335
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_3336
+TCAGCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_3337
+TCACAGGGTGAACACTTGCAGTTCGTATGCCGTTT
+>nematode_3338
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3339
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3340
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3341
+TCACCGGGTGGAAACTAGCAGTTTCGTATGCCGTC
+>nematode_3342
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3343
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3344
+TCACCGGGTGGAAACTAGCAGTTCGTATGTTGTCT
+>nematode_3345
+TCACCGGGTGTACATCAGCTAATCGTATGGCGTTT
+>nematode_3346
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3347
+CACCGGGTGTACATCAGCTAATCGTATGCCGTCTT
+>nematode_3348
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3349
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3350
+TCACCGGGGGTACATCAGCTAATCGTATGCCGTCT
+>nematode_3351
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_3352
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_3353
+TCACCGGGCGGAAACTAGCAGTTCGTATGACGTCT
+>nematode_3354
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3355
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3356
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3357
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3358
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3359
+TCACCGGGTGGGAACTAGCAGTTCGTATGCCGTCT
+>nematode_3360
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3361
+TCACCGGGAGAACACTTGCAGTTCGTATGTTGTCT
+>nematode_3362
+TCACCGGGGGAACACTTGCAGTTCGTATGCTGTCT
+>nematode_3363
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3364
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_3365
+TCACCGGGTGGAAACTAGCAGTTTCGTATGCCGTC
+>nematode_3366
+TCACCGGGTGTACATCAGCTAATTCGTATGCCGTC
+>nematode_3367
+TCACAGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3368
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3369
+TCACCGGGGGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3370
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3371
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3372
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3373
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3374
+TCACCGGGTGGAAACTAGCAGTTTCGTATGCCGTC
+>nematode_3375
+TCACCGGGCGAACACTTGCAGTTCGTATGCCGCCT
+>nematode_3376
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3377
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3378
+TCACCGGGTGGAAACTAGAAGTTCGTATGCCGTCT
+>nematode_3379
+TCACCGGGCGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3380
+TCACTGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3381
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3382
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_3383
+TCACCGGGAGAAAAACTGGAGTCGTATGCCGTCTT
+>nematode_3384
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3385
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3386
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3387
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGCCT
+>nematode_3388
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3389
+TCACCGGGTGGAAACTAGCAGTCGTATGCCGTCTT
+>nematode_3390
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3391
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_3392
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3393
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3394
+TCACCGGGTGTACATCAGCTATTCGTATGCCGTCT
+>nematode_3395
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3396
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3397
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3398
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3399
+TCACCGGGTGGAAACTAGCAGTCGTATGCCGTCTT
+>nematode_3400
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3401
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3402
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTTT
+>nematode_3403
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3404
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3405
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3406
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3407
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_3408
+TCACCGGGTGTAAATCAGCTTGTCGTATGCCGTCT
+>nematode_3409
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3410
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3411
+TCACCGGGCGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3412
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_3413
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3414
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3415
+TCACCGGGTGAACACTTGCATCGTATGCCGTCTTT
+>nematode_3416
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3417
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_3418
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3419
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3420
+TCACCGGGTGGAAACTAGCAGTTCGTATGTCGTCT
+>nematode_3421
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3422
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3423
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3424
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3425
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3426
+TCACCGGGTGGAAAATAGCAGTTCGTATTCCGTCT
+>nematode_3427
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3428
+TCACCGGGTGAACACTTGCTGTTCGTATGCCGTCT
+>nematode_3429
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3430
+TCACCGGGTGGAAACTAGCAGTTCGTATGCTGTCT
+>nematode_3431
+TCACCGGGTGGAAACTAGCTGTTCGTATGCCCTCT
+>nematode_3432
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3433
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_3434
+TCACCGGGAGAAAAACTGGAGTTCGTATGCCGTCT
+>nematode_3435
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3436
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_3437
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3438
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3439
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_3440
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_3441
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3442
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTTT
+>nematode_3443
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3444
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_3445
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_3446
+TCACCGGGTGGAAACTAGCAGTCGTATGACGTCTT
+>nematode_3447
+TCACCGGGTGGAAACTAGCAGTCGTATGCCGTCTT
+>nematode_3448
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3449
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_3450
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_3451
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3452
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3453
+TCACCGGGTGGAAACTAGCAGTTCGTATGCTGTCT
+>nematode_3454
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3455
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3456
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3457
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3458
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3459
+TCACCGGGCGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3460
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3461
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTTT
+>nematode_3462
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3463
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3464
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3465
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3466
+TCACCGGGGGAACACTTGCAGTTCGTATGGCGTCT
+>nematode_3467
+TCACCGGGTGAACACTTTCAGTTCGTATGTTGTCT
+>nematode_3468
+TCACCGGGTGAACACTTGCAGTTCGTATGCTGTCT
+>nematode_3469
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_3470
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3471
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3472
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3473
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3474
+TCACCGGGTGGAAACTAGCAGTTCGTATGGCGTCT
+>nematode_3475
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_3476
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3477
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_3478
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_3479
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3480
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3481
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3482
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3483
+TCACCGGGTGGAAACTAGCAGTTTCGTATGCCGTC
+>nematode_3484
+TCACCGGGTGTAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3485
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3486
+TCACCGGGGGAACACTTGCAGTTCGTATGCCGTTT
+>nematode_3487
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_3488
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3489
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3490
+TCACAGGGTGGAAACTAGCAGTTCGTATGCCGCTT
+>nematode_3491
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3492
+TCACCGGGTGGAAACTAGCAGTTTCGTATGCCGTT
+>nematode_3493
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3494
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3495
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_3496
+TCACCGGGTGGAAACTAGCAGTTCGTATGCTGTCT
+>nematode_3497
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3498
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3499
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3500
+TCACCGGGTGGAAACTAGCAGTTTCGTATGCCGTC
+>nematode_3501
+TCACCGGGTGGAAACTAGCAGTCGTATGCCGTCTT
+>nematode_3502
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_3503
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3504
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_3505
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3506
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3507
+TCACCGGGTGGAAACTAGCAGTTTCGTATGCCGTC
+>nematode_3508
+TCACCGGGTGTAAATCAGCTTGTCGTATGCCTTCT
+>nematode_3509
+TCACCGGGTGGAAACTAGCAGNTCGTATGCCGTCT
+>nematode_3510
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_3511
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3512
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3513
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_3514
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3515
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_3516
+TCACCGGGTGAAAATTCGCATCGTATGCCGTCTTC
+>nematode_3517
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3518
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3519
+TCACCGGGGGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3520
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3521
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_3522
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3523
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3524
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3525
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3526
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3527
+TCACCGGGTGAACACTTGCAGTATCGTATGCCGTT
+>nematode_3528
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3529
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3530
+CACCGGGTGAACACTTGCAGTTCGTATGCCGTCTT
+>nematode_3531
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3532
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3533
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3534
+TCACCGGGTGAACACTTGCAGTCGTATGCCCTCTT
+>nematode_3535
+TCACCGGGTGTATATCAGCTTCGTATGCCGTCTTT
+>nematode_3536
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGCCT
+>nematode_3537
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3538
+TCACCGGGTGGAAACTAGCAGTCGTATGCCGTCTT
+>nematode_3539
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3540
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3541
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3542
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTGT
+>nematode_3543
+TCACCGGGTGGAAACTAGCAGTTTCGTATGCCGTC
+>nematode_3544
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3545
+TCACCGGGTGAACACTTGCAGTTCGTATGCTGTCT
+>nematode_3546
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3547
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3548
+TCACCGGGGGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3549
+TCACCGGGTGAAAACTTGCAGTTCGTATGCCGTCT
+>nematode_3550
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3551
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3552
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3553
+TCACCGGGTGAACACTTGCAGTCGTATGCCGTCTT
+>nematode_3554
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3555
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3556
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3557
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3558
+TCACCGGGTGAACACTTGCAGTCGTATTCCGGTTT
+>nematode_3559
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGGCT
+>nematode_3560
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGCTT
+>nematode_3561
+TCACCGGGTGGAAACTAGCAGTCGTATGCCTTTTT
+>nematode_3562
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3563
+TCACCGGGTGTACATCAGCTCATCGTATGCCGTCT
+>nematode_3564
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3565
+TCACCGGGTGAACACTTGCAGTTTCGTATGCCGTT
+>nematode_3566
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3567
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCCTTT
+>nematode_3568
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3569
+TCACCGGGGGAACACTTGCAGTTCGTATGTCGTCT
+>nematode_3570
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3571
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3572
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3573
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3574
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3575
+TCACCGGGTGAACACTTGCAGTTCGTATGCTGTCT
+>nematode_3576
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3577
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3578
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3579
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_3580
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3581
+TCACCGGGGGGAAACTAGCAGTTCGTATGCTGTCG
+>nematode_3582
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3583
+TCACCGGGTGGAAACTAGCAGTCGTATGCCGTCTT
+>nematode_3584
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3585
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3586
+TCACCGGGTGGAAACTAGCAGTTTCGTATGCCGTC
+>nematode_3587
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3588
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3589
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3590
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3591
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3592
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3593
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3594
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3595
+TCACCGGGTTAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3596
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3597
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3598
+TCACCGGGTGAACACTTGCAGTTCGTATGTCGTCT
+>nematode_3599
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3600
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3601
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3602
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3603
+TCACCGGGTGGAAACTAGCAGTCGTATGCCGTCTT
+>nematode_3604
+TCACAGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3605
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_3606
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3607
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3608
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3609
+TCACCGGGTGAACACTTGCAGGTCGTATGTCGTCT
+>nematode_3610
+TCACCGGGTGAAAATTCGCATGTCGTATGCCTTCT
+>nematode_3611
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3612
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3613
+TCACCGGGTGGAAACTATCAGTTCGTATGCCGTCT
+>nematode_3614
+TCACCGGGTGTACTTCAGCTAATCGTATGCCGTCT
+>nematode_3615
+TCACCGGGTGAACACTTGCATCGTATGCCGTCTTC
+>nematode_3616
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3617
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3618
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3619
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3620
+TCACCGGGTGGCAACTAGCAGTTCGTATGTCGTCT
+>nematode_3621
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3622
+GCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3623
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3624
+TCACCGGGAGAAAAACTGGAGATCGTATGCCGTCT
+>nematode_3625
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3626
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3627
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3628
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3629
+TCACCGGGTGGAAACTAGCAGATCGTATGCCGCCT
+>nematode_3630
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_3631
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3632
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_3633
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3634
+TCACCGGGTGAACACTTGCAGTCGTATGCCGTCTT
+>nematode_3635
+TCACCGGGTGGAAACTAGCAGTCGTATGCCGTCTT
+>nematode_3636
+GCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3637
+TCACCGGGTGAACACTTGCATCGTATGCCGTCTTC
+>nematode_3638
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3639
+TCACCGGGTGGAAATTAGCAGTTCGTATGCCGTGT
+>nematode_3640
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3641
+TCACCGGGTGGAAACTAGCAGTCGTATGCCGTCTT
+>nematode_3642
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3643
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3644
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3645
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3646
+CACCGGGTGAACACTTGCAGTTCGTATGCCGTCTT
+>nematode_3647
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3648
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3649
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3650
+TCACCGGGTGGAAACTAGCAGTTCGTATGCAGTCT
+>nematode_3651
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3652
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3653
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3654
+TCACCGGGTGGAAACTCGCAGTTCGTATGCCGTCT
+>nematode_3655
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3656
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCTTCT
+>nematode_3657
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3658
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3659
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_3660
+TCACCGGGTGTAAATCAGCTTGTCGTATTCCGTCT
+>nematode_3661
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3662
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3663
+TCACCGGGTGAACACTTGCAGTCGTATGCCGTCTT
+>nematode_3664
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3665
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3666
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3667
+TCACCGGGTGAACACTTGCAGTATCGTATGCCGTC
+>nematode_3668
+TCACCGGGTGTACATCAGCTATCGTATGCCGTCTT
+>nematode_3669
+TCACCGGGTGGAAACTAGCAGATCGTATGTTGTTT
+>nematode_3670
+TCACCGGGTGTAAATCAGCTTGTTCGTATGCCGTC
+>nematode_3671
+TCACCGGGTGAACACTTGCAGTTTCGTATGCCGTC
+>nematode_3672
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3673
+TCTCCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3674
+TCACCGGGTGGAAACTAGCAGTTTCGTATGCCGTC
+>nematode_3675
+TCACCGGGTGAACACTTGCCGTTCGTATGCCGTCT
+>nematode_3676
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3677
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3678
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_3679
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3680
+TCACAGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3681
+TCACCGAGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_3682
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3683
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3684
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_3685
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3686
+TCACCGGGTGGAAACTAGCAGTTCGTATTCCGTTT
+>nematode_3687
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3688
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3689
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3690
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3691
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3692
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3693
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_3694
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3695
+TCACCGGGTGGAAACTAGCATTTCGTATGGCGTTT
+>nematode_3696
+TCACCGGGTGCAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3697
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3698
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3699
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_3700
+TCACCGGGTGGAAACTAGCTGTCGTATGTCGTCTT
+>nematode_3701
+TCACCGGGTGGAAACTAGCAGTTCGTATCCCGTCT
+>nematode_3702
+AATCACCGGGTGAACACTTGCAGTTCGTATGCCGT
+>nematode_3703
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3704
+ACCGTGTGAACACTTGCAGTTCGTATTCCGTCTTT
+>nematode_3705
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3706
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3707
+TCACCGGGTGGAAACTAGCAGTCGTATTCCGTCTT
+>nematode_3708
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGCCT
+>nematode_3709
+TGACCGGGTGGAAACTAGCAGTTCGTATCCCGACT
+>nematode_3710
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3711
+TCACCGGGTGAACACTTGCAGTTCGTATGACGTCT
+>nematode_3712
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGCCT
+>nematode_3713
+TCACCGGGGGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3714
+TCACCGGGTGAAAATTCGCATGTCGTATGCTGTCT
+>nematode_3715
+TCACCGGGTGGAGACTAGCAGTTCGTATGACGTCT
+>nematode_3716
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3717
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3718
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3719
+TCACCGGGCGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3720
+TCACCGGGTGAACACTTGCAGTTCGTATGACGGCT
+>nematode_3721
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3722
+TCACCGGGTGGAAACTAGCAGTTCGTATGTCGTCT
+>nematode_3723
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3724
+TCACCGGGTGTAAATTCGCATGTCGTATGCCGTCT
+>nematode_3725
+AGCTGATTTCGTCTTGGTAATATCGTATGCCGTCT
+>nematode_3726
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3727
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGCCT
+>nematode_3728
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3729
+ACAGGGTGAACACTTGCAGTTCGTATGCCGTCTTT
+>nematode_3730
+TCACCGGGTGGAAACTAGCAGGTCGTATGCAGTAT
+>nematode_3731
+TCACCGGGTGTAAATCAGCTTGTCGTATGCCGTCT
+>nematode_3732
+TCACCGGGTGAATACTTGCAGTCGTATGCCGTCTT
+>nematode_3733
+TCACCGGGTGGAAACTAGCAGTATCGTATGCCGTC
+>nematode_3734
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3735
+TCACCGGGTGGAAACTAGCAGTCGTATGCCGTCTT
+>nematode_3736
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3737
+TCACCGGGTGAACACTTGCAGTTTCGTATGCCGTC
+>nematode_3738
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3739
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3740
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3741
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3742
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3743
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3744
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3745
+CTCACCGGGTGGAAACTAGCAGTTCGTATGCCGTC
+>nematode_3746
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3747
+TCACCGGGTGTACATCAGCCAATCGTATGCCGTCT
+>nematode_3748
+TCACCGGGAGAAAAACTGGAGTTCGTATGCCGTCT
+>nematode_3749
+TCACCGGGTGGAAACTAGCAGTCGTATGCCGTCTT
+>nematode_3750
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3751
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3752
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3753
+CACCGGGTGGAAACTAGCAGTTCGTATACCATATT
+>nematode_3754
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3755
+AGCTGATTTCGTCTTGGTAATATCGTATGCCGTCT
+>nematode_3756
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3757
+ACCGGGTGTACATCAGCTAATCGTATGCCGTCTTT
+>nematode_3758
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_3759
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3760
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3761
+TCACCGGGTGTACATCAGCTAATCGTATGCCTTCT
+>nematode_3762
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3763
+TCACCGGGTGGAAACTAGCAGTCGTATGCCGTTTT
+>nematode_3764
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3765
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3766
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_3767
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3768
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3769
+TCACCGGGTGAACACTTGCATCGTATGCCGTCTTC
+>nematode_3770
+TCACCGGGGGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3771
+TCACCGGGTGAACACTTGCAGTTCGTATGACGTCT
+>nematode_3772
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3773
+TCACCGGGTGGAAACTAGCACTCGTATGCCGTCTT
+>nematode_3774
+TCACCGGGTGGAAACTACCAGTTCGTATGCCGTCT
+>nematode_3775
+TCACCGGGTGGAAACTAGCAGTTCGTATTCCGTCT
+>nematode_3776
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3777
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3778
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3779
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3780
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3781
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3782
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3783
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3784
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3785
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_3786
+TCACCGGGTGGATACTAGCAGTTCGTATGCCGTCT
+>nematode_3787
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3788
+TCACCGGGTGGAAACTAGCAGTCGTATGCCGTCTT
+>nematode_3789
+TCACCGGGTGAACACTTGCAGTATCGTATGCCGTC
+>nematode_3790
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_3791
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3792
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3793
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3794
+ACCGGGTGAAAATTCGCATGTCGTATGCCGTCTTC
+>nematode_3795
+TCACCGGGTGGAAACTAGCAGTTCGTATTCCGTCT
+>nematode_3796
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTTT
+>nematode_3797
+TCATCGGGTGGAAACTAGCAGTTCGTATGCTGTCT
+>nematode_3798
+TCACCGGGTGAAAATTCGCATGTCGTATGCGGTCT
+>nematode_3799
+ACCGGGTGGAAACTAGCAGTCGTATGTCGTCTTCT
+>nematode_3800
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3801
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3802
+TCACCGGGTGAAAACTTGCAGTTCGTATGCCGTCT
+>nematode_3803
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3804
+TCACCGGGTGAACACTGGCAGTTCGTATGCCGTCT
+>nematode_3805
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3806
+TCACCGCGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3807
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3808
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3809
+TCACAGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3810
+TCACCGGGGGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3811
+TCACCGGGTGAAAATTAGCATGTCGTATGCCGTCT
+>nematode_3812
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3813
+CCACCGGGTGAACACTTGCAGTTCGTATGTCCTCT
+>nematode_3814
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3815
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3816
+TCACCGGGTGTACATCAGCTAATCGTATTCCGTCT
+>nematode_3817
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3818
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3819
+TCACCGGGTGGACACTTGCAGTTCGTATGTCGTTT
+>nematode_3820
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3821
+TCACCGGGTGGAAACTAGCAGTATCGTATGCCGTT
+>nematode_3822
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3823
+TCATCGGGTGAACACTTGCAGTTCGTATTCCGTCT
+>nematode_3824
+TCACAGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3825
+TCACCGGGTGTACATCAGCTAATCGTATCCCGCTT
+>nematode_3826
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_3827
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3828
+TCACCGGGTGGAAACTAGCAGTTTCGTATGCCGTC
+>nematode_3829
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_3830
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3831
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_3832
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_3833
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3834
+TCACCGGGGGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_3835
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3836
+TCACCGGGTGTACATCAGCTTATCGTATGCCGTCT
+>nematode_3837
+TCACCGGGTGAACACTTGCAGTTTCGTATGCCGTT
+>nematode_3838
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3839
+TCACCGGGTGGAAACTAGCAGTCGTATGCCGTCTT
+>nematode_3840
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3841
+TCACCGCGTGAAAATTCGCATGTCGTATCCCGTCT
+>nematode_3842
+TCACCGGGTGAACACTTGCATCGTATGCCGTCTTC
+>nematode_3843
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGCCT
+>nematode_3844
+TCACCGGGAGGAAACTAGCAGTTCGTATGTCGTCT
+>nematode_3845
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3846
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3847
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3848
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3849
+TCACCGGGTGGAAACTAGCAGTTCGTATGCTGTCT
+>nematode_3850
+TCACCGGGTGAAAATTCGCATTCGTATGCCGTCTT
+>nematode_3851
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3852
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3853
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3854
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3855
+TCACCGGGTGGAAACTGGCAGTTCGTATGCCTTTT
+>nematode_3856
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3857
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3858
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3859
+TCAACGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3860
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCTTCT
+>nematode_3861
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_3862
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3863
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3864
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_3865
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3866
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3867
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3868
+TCACCGGGTGAATACTTGCAGTTCGTATGGTGTCT
+>nematode_3869
+TCACCGGGTGTACATCAGCTAATCGTATGACGTCT
+>nematode_3870
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3871
+TCACCGGGTGAAAACTTGCAGTTCGTATGCCGTCT
+>nematode_3872
+TGACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3873
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3874
+TCACCGGGTGAACACTTGCAGTTTCGTATGCCGTC
+>nematode_3875
+TCACCGGGTGTACATCAGCCAATCGTATGCCGTCT
+>nematode_3876
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_3877
+TCACCGGGTGAACACTTGCAGTTCGTATGCTGTCT
+>nematode_3878
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3879
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3880
+TCACCGGGTGAACACTTGCAGTCGTATGCCGTCTT
+>nematode_3881
+TCACCGGGAGAAAAACTGGAGTTCGTATGCCGTCT
+>nematode_3882
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3883
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3884
+TCACCGGGTGAACACTTGCAGTTCGTATGACGTTT
+>nematode_3885
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3886
+TCACCGCGTGGAAACTAGCAGTTCGTATGCCGTTT
+>nematode_3887
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3888
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3889
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3890
+TCACCGGGTGGAAACTAGCAATCGTATGCCGTCTT
+>nematode_3891
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3892
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3893
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCTTCT
+>nematode_3894
+TCACCGGGTGGAAACTAGCAGTCGTATGCCGTCTT
+>nematode_3895
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_3896
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3897
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_3898
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3899
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3900
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3901
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3902
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3903
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3904
+TCACCGCGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3905
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3906
+TCACCGGGTGTAAATCAGCTTGTCGTATGCCTTCT
+>nematode_3907
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_3908
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3909
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3910
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3911
+TCACCGGGTGGAAACTAGCAGTTCGTATCCCGTCT
+>nematode_3912
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3913
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3914
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3915
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3916
+TCACCGGGTGAACACTTGCAGTATCGTATGCCGTC
+>nematode_3917
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3918
+TCACCGGGAGGAAACTAGCAGTTCGTATGACGTCT
+>nematode_3919
+TCACCGGGTGTAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3920
+ATCACCGGGTGAACACTTGCAGTTCGTATGCCGTC
+>nematode_3921
+TCACAGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3922
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3923
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3924
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3925
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3926
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3927
+TGACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3928
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3929
+TCACCGGGTGGAAACTAGCAGTCGTATGCCGTCTT
+>nematode_3930
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3931
+TCACCGGGTGAACACTTGCATTTCGTATGTCGTCT
+>nematode_3932
+TCACCGGGTGTACATCAGCTAATTCGTATGTCGTC
+>nematode_3933
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCTTCT
+>nematode_3934
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3935
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3936
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3937
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3938
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3939
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3940
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3941
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3942
+TCACCGGGTGGAAACTAGCAGTTTCGTATGCCGTC
+>nematode_3943
+TCACCGGGCGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3944
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3945
+TCACCGGGTGAACACTTGCAGTCGTATGCCGTCTT
+>nematode_3946
+ACCGGGTGGAAACTAGCAGTCGTATGCCGTCTTCT
+>nematode_3947
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3948
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_3949
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3950
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCTTCT
+>nematode_3951
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3952
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_3953
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTTT
+>nematode_3954
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3955
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3956
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3957
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3958
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_3959
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_3960
+TCACAGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_3961
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3962
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3963
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3964
+TCACCGGGTGAACACTTGCAGTTCGTATGCTGTCT
+>nematode_3965
+TCACCGGGTGAACACTTGCAGTATCGTATGCCGTC
+>nematode_3966
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3967
+TCACCGGGTGGAAACTAGCATCGTATGCCGTCTTC
+>nematode_3968
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3969
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3970
+TCACCGGGTGGAAACTAGCAGCTCGTATGCCGTCT
+>nematode_3971
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3972
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3973
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3974
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3975
+TCACCGGGTGGAAACTAGCAGTCGTATGCCGTCTT
+>nematode_3976
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3977
+TCACCGGGTGAAAATTCGCATGTCGTATGCCTTCT
+>nematode_3978
+TCACCGGGTGCAAACTAGCAGTTCGTATGCCTTCT
+>nematode_3979
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3980
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_3981
+TCACAGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3982
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3983
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3984
+TCACCGGGTGAACACTTGCAGTATCGTATGCCGTC
+>nematode_3985
+TCACCGGGTGAACACTTGCAGTTCGTATTCCGTCT
+>nematode_3986
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_3987
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3988
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_3989
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3990
+TCACCGGGAGAACACTTGCAGTCGTATCCCGTCCT
+>nematode_3991
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3992
+TCACCGGGTGAACTCTTGCAGTTCGTATGCCGTCT
+>nematode_3993
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3994
+TCACCGGGTGAAAATTCGCATGTCGTATGCCTTCT
+>nematode_3995
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3996
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3997
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_3998
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_3999
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4000
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGCCT
+>nematode_4001
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4002
+AACGGGTGGAAACTAGCAGTTCGTATGCTGTCTTC
+>nematode_4003
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4004
+TCACCGGGTGGAAACTAGCATTTCGTATCCCGTTT
+>nematode_4005
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4006
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_4007
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4008
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4009
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4010
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4011
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGCCT
+>nematode_4012
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4013
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4014
+TCACCGGGTGGAAACTAGCAGTTCGTATGGCGTGT
+>nematode_4015
+TCACCGGGTGGAAACTCGCAGTTCGTATGCAGTCT
+>nematode_4016
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4017
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_4018
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4019
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_4020
+TCACCGGGTGGAAACTAGCAGTTTCGTATGCCGTC
+>nematode_4021
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4022
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_4023
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4024
+TCACCGGGTGGCAACTAGCAGTTCGTATGCCGTTT
+>nematode_4025
+TCACCGGGTGGAAACTAGCAATCGTATGCCGTCTT
+>nematode_4026
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4027
+TCACCGGGTGGAAACTAGCAGCTCGTATGGCGTCT
+>nematode_4028
+TCACCGGGAGTACATCAGCTAATCGTATGCCGTTT
+>nematode_4029
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4030
+TCACCGGGTGAACACTTGCTGTTCGTATGCCGTCT
+>nematode_4031
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4032
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4033
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4034
+TCACCGGGTGGAAACTAGCAGTCGTATGCCGTCTT
+>nematode_4035
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4036
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4037
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4038
+TCACCGGGTGAACACTTGCAGTCGTATGCCGTCTT
+>nematode_4039
+TCACCGGGTGTAAATCAGCTTGTCGTATGCCGTCT
+>nematode_4040
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4041
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4042
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4043
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4044
+TCACCGGGTGAACACTTGAAGTTCGTATGCCGTCT
+>nematode_4045
+TCACAGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4046
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_4047
+TCACCGGGTGAACACTTGCAGTTCGTATGGCGTCT
+>nematode_4048
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_4049
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_4050
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4051
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4052
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4053
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4054
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTTT
+>nematode_4055
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4056
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGCCT
+>nematode_4057
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_4058
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_4059
+TCACCGGGTGGAAACTAGCAGTTCGTATGTCGTCT
+>nematode_4060
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4061
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4062
+TCACCGGGAGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4063
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4064
+TCACCGGGTGAACACTTGCAGTTTCGTATGCCGTC
+>nematode_4065
+TCAGCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4066
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4067
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_4068
+TCACCGGGAGAAAAACTGGAGTTCGTATGCCGTCT
+>nematode_4069
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4070
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4071
+TCACCGGGTGTACATCAGTTAATCGTATGCCGTCT
+>nematode_4072
+TCAACGGGTGGAAACTAGCAGTTCGTATTTTGTCT
+>nematode_4073
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4074
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4075
+TCACCGGGTGGAAACTAGCAGTATCGTATGCCGTC
+>nematode_4076
+TCACCGGGTGGAAACTAGCAGTCGTATGCCGTCTT
+>nematode_4077
+TCACCGGGGGAAAATTCGCATGTCGTATGTCGTCT
+>nematode_4078
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4079
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4080
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4081
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4082
+TCACCGGGTGGAAACTAGCAGTTCGTATGACGTCT
+>nematode_4083
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4084
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4085
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4086
+TCACCGGGTGGAAACTAGCAGTTTCGTATGCCGTC
+>nematode_4087
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4088
+TCACCGGGTGAACACTTGCAGTTCGTATGTCTTCT
+>nematode_4089
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4090
+TCACCGGGTGAACACTTGCAGTTTCGTATGCCGTC
+>nematode_4091
+TCACAGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4092
+TCACCGGGTGAAAACTCGCATGTCGTATGCCGTCT
+>nematode_4093
+TCACCGGGTGAACACTTGCAGCTCGTATGCCGTCT
+>nematode_4094
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4095
+TCACCGGGTGTACATCAGCTAATCGTATGGCGTCT
+>nematode_4096
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4097
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4098
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4099
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_4100
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTAT
+>nematode_4101
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTAT
+>nematode_4102
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4103
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4104
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4105
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4106
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4107
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4108
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4109
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4110
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4111
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_4112
+TCACCGGGTGAACACTTGCAGTCGTATTCCCTCTT
+>nematode_4113
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4114
+TCACCGGGCGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4115
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4116
+TCACCGGGTGGAAAATAGCAGTTCGTATGCCGTCT
+>nematode_4117
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4118
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4119
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4120
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4121
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4122
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4123
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4124
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGGTT
+>nematode_4125
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4126
+TCACCGGGTGAACACTTGCAGTTCGTATGCCTTCT
+>nematode_4127
+TCACCGGGTGGAAACTAGCAGTTTCGTATGCCGTT
+>nematode_4128
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4129
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4130
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4131
+TNACCGGGTGGAAACTAGCAGTTCGTATCCCGTCT
+>nematode_4132
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4133
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_4134
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_4135
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4136
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTTT
+>nematode_4137
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4138
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4139
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_4140
+TCACCGGGTGTACATCAGCTAATCGTATGCGGTCT
+>nematode_4141
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4142
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4143
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCTTCT
+>nematode_4144
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4145
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4146
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_4147
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4148
+TCACCGGGCGAACACTTGCAGTTCGTATGCCGCCT
+>nematode_4149
+TCACCGGGAGAAAAACTGGAGTTCGTATGCCGTCT
+>nematode_4150
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_4151
+TCACCGGGTGTAAATCAGCTTGTCGTATGCCGTCT
+>nematode_4152
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4153
+TCACCGGGTGAACACTTGCAGTATCGTATGCCGTC
+>nematode_4154
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4155
+TCACCGGGTGTACATCAGCTAATTCGTATGCCGTC
+>nematode_4156
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4157
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4158
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4159
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4160
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4161
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4162
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4163
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4164
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTTT
+>nematode_4165
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4166
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4167
+TCACCGGGTGGAAACTAGCAGTTCGTATGCAGTCT
+>nematode_4168
+TCACAGGGTGGAAACTAGCAGTTCGTATGCAGTAT
+>nematode_4169
+TCACCTGGTGGAAACTAGCAGTTCGTATTCCGCCT
+>nematode_4170
+TCACCGGGCGGAAACTAGCAGTTCGTATGCTGTCT
+>nematode_4171
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4172
+TCACCGGGTGAACACTTGCAGTCGTATGCCGTCTT
+>nematode_4173
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4174
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4175
+TCACCGGGCGGAAACTAGCAGTTCGTATGCCGCCT
+>nematode_4176
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4177
+TCACCGGGTGGAAACTAGCAGTTTCGTATGCCGTC
+>nematode_4178
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4179
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4180
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4181
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4182
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4183
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4184
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4185
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4186
+TCACCGGGTGAAGACTTGCAGTTCGTATGCCGTCT
+>nematode_4187
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4188
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4189
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4190
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4191
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_4192
+TCACCGGGTGGAAACTAGCATTTCGTATGCCCTCT
+>nematode_4193
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4194
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4195
+TCACCGGGAGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4196
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4197
+TCACAGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4198
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4199
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4200
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4201
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_4202
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4203
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4204
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4205
+TCACCGGGCGTAAATCAGCTTGTCGTATGCCGTCT
+>nematode_4206
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4207
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4208
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4209
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4210
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_4211
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4212
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4213
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4214
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4215
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4216
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_4217
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4218
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4219
+TCACCGGGAGAAAAACTGGAGTTCGTATGCCGTCT
+>nematode_4220
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4221
+GCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_4222
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4223
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4224
+TNACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4225
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4226
+TCACCGGGTGAACACTTGCTGTTCGTATGCCGTCT
+>nematode_4227
+TCACCGGGTGGAAACTCGCAGTCGTATGCCGTCTT
+>nematode_4228
+TCACCGGGTGGAAACTAGCAGTTTCGTATGTCGTC
+>nematode_4229
+TCACCGGGTGTACATCAGCTAATCGTATGACGTCT
+>nematode_4230
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_4231
+TCACCGGGTGGAAACTAGCAGTTCGTATGACGTCT
+>nematode_4232
+TCACCGGGTGGAAACTAGCAGATCGTATGCCGTCT
+>nematode_4233
+TCACCGGGTGGAAACTAGCAGTTCGTATGCAGTAT
+>nematode_4234
+TCACCGGGTGGAAACTAGCAGTTCGTATGCTGTCT
+>nematode_4235
+TCACCGGGTGAACACTTGCAGTTCGTATGCAGAAT
+>nematode_4236
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4237
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4238
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4239
+TCACCGGGTGGAAACTAGCAGTTTCGTATTCTGTA
+>nematode_4240
+TCACCGGGTGGAAACTAGCAGCTCGTATGCCGTCT
+>nematode_4241
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4242
+TCACCGGGTGAACTCTTGCAGTTCGTATGCTGCTT
+>nematode_4243
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4244
+TCACCGGGTGGAAACTAGCAGATCGTATGCCGTCT
+>nematode_4245
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4246
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4247
+TCACCGGGTGGAAACTAGCAGTTCGTATGACGTAT
+>nematode_4248
+TCACCGGGTGTAAATCAGCTAATCGTATGCAGTCT
+>nematode_4249
+TCACCGGGTGGAAACTAGCAGATCGTATGCCGTCT
+>nematode_4250
+TCACCGGGCGAACACTTGCAGTTCGTATTCCGTCT
+>nematode_4251
+TCACCGGGTGAATATTCGCATGTCGTATGCCGTCT
+>nematode_4252
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4253
+TCACCTGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4254
+TCACCGCGTGTACATCAGCTAATCGTATGCTGTCT
+>nematode_4255
+AGCTGATTTCGTCTTGGTTATTCGTATGCCGTCTT
+>nematode_4256
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4257
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4258
+ACCGGGTGGAAACTAGCAGTTCGTATGCCGTCTTC
+>nematode_4259
+ACCGGGTGGAAACTAGCAGTTCGTATGCCGTCTTC
+>nematode_4260
+TCACCGGGTGAACACTTGCAGTTCGTATGACGTCT
+>nematode_4261
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4262
+ACCGGGTGAAAATTCGCATGTCGTATGCCGTCTTC
+>nematode_4263
+TCACCGGGTGAAAACTTGCAGTTCGTATGCCGTCT
+>nematode_4264
+TCACCGGGTGGAAACTAGCAGTATCGTATGCCGTC
+>nematode_4265
+TCACCGGGCGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4266
+ACCGGGTGAACACTTGCAGTTCGTATGCCGTCTTC
+>nematode_4267
+TCACCGGGTGGAAACTAGAAGTTCGTATGTCGTCT
+>nematode_4268
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4269
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4270
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_4271
+ACCGGGTGGAAACTAGCAGTTCGTATGCCGTTTTT
+>nematode_4272
+TCACCGGGTGGAAACTAGCAGTTCGTATGAAGTAT
+>nematode_4273
+TTACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_4274
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_4275
+ACCGGGTGAACACTTGCAGTTCGTATGCCGTCTTT
+>nematode_4276
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4277
+TCACCGGGTGGAAATTAGCAGTTCGTATGCCGTCT
+>nematode_4278
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4279
+ATCACCGGGTGGAAACTAGCAGCTCGTATGCCGTC
+>nematode_4280
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_4281
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4282
+ACCGGGTGAACACTTGCAGTTCGTATGTCGTCTTT
+>nematode_4283
+CACCGGGTGAACACTTGCAGTTCGTATGCCGTCTT
+>nematode_4284
+TCACCGGGTGTAAATCAGCTTGTCGTATGCCGTCT
+>nematode_4285
+TCACCGGGTGAACACTTGCAGTTCGTATGCTGTTT
+>nematode_4286
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4287
+TCACCGGGGGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4288
+TCACCGGGCGGAAACTAGCAGTTCGTATGCCTTTT
+>nematode_4289
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_4290
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4291
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4292
+TCACCGGGAGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4293
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4294
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4295
+TCACCGAGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4296
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_4297
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4298
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_4299
+ACCGGGTGAACACTTGCAGTTCGTATGCCGTCTTT
+>nematode_4300
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4301
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4302
+TCACCGGGTGAACACTTGCAGTTCGTATGCCTTTT
+>nematode_4303
+TCACCGGGTGGAAACTAGCAGTATCGTATGGTGTT
+>nematode_4304
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTTT
+>nematode_4305
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4306
+TCACCGGGTGGACACTTGCAGTTCGTATGCCGTCT
+>nematode_4307
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4308
+TCACCGGGTGTAAATCAGCTTGTCGTATGCCGTCT
+>nematode_4309
+TCACCGGGTGGAAACTAGCAGTTCGTATGTCGTCT
+>nematode_4310
+TCACCGCGTGAACACTTGCAGTTCGTATGCGGTCT
+>nematode_4311
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4312
+CACCGGGGGAACACTTGCAGTTCGTATGCCGTCTT
+>nematode_4313
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4314
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4315
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4316
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4317
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4318
+TCACCGGGTGCAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4319
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4320
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4321
+TCACCGGGGGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4322
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4323
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4324
+TCACAGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4325
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4326
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4327
+TCACCGGGAGGAAACTAGCAGTTCGTATTCCGTCT
+>nematode_4328
+TCACCGGGTGGAAACTAGCAGTTCGTATTCCGTCT
+>nematode_4329
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4330
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4331
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4332
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4333
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4334
+TCACCGGGTGAACACTTGCAGTCGTATGCCGTCTT
+>nematode_4335
+TCACCGGGTGGAAACTAGCAGTTCGTATGCAGTTT
+>nematode_4336
+TCACCGGGTAAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4337
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4338
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4339
+TCACCGGGTGTACATCATCTAATCGTATGTCGTCT
+>nematode_4340
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4341
+TTACCGGGTGAACACTTGCAGTTCGTATGCTGTTT
+>nematode_4342
+TCACCGGGTGAACACTTGCAGTATCGTATGCCGTC
+>nematode_4343
+TCACCGGGTGGAAACTAGCAGTTTCGTATGCCGTC
+>nematode_4344
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4345
+TCACCGGGTGAACACTTGCATCGTATGCCGTCTTC
+>nematode_4346
+TCACCGGGTGGACATCAGCTAATCGTATGCCGTCT
+>nematode_4347
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4348
+TCACCGGGTGAACACTTGCAGTCGTATGCCGTCTT
+>nematode_4349
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4350
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4351
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_4352
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4353
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4354
+TGACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_4355
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4356
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_4357
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_4358
+TCACCGGGTGTACATCAGCTATCGTATTCCTTGTT
+>nematode_4359
+TCACCTGGTGGAAACTAGCAGTTCGTATTCCCGCT
+>nematode_4360
+TCAACGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_4361
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4362
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4363
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4364
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4365
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4366
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4367
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4368
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_4369
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4370
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4371
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4372
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4373
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_4374
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4375
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4376
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4377
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4378
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4379
+TCACCCGGTGAACACTTGCAGTTCGTATTCCGTCT
+>nematode_4380
+TCACCGGGTGGAAACTAGCAGTTCGTATGTCGTTT
+>nematode_4381
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4382
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4383
+TCACCGGGTGGAAACTAGCAGTCGTATGCCGTCTT
+>nematode_4384
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4385
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4386
+TCACCGGGTGAACACTTGCAGCTCGTATGCCGTCT
+>nematode_4387
+TCAACGGGTGGAAACTAGCAGTTCGTATGCCTTCT
+>nematode_4388
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4389
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_4390
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_4391
+TCACCGGGTGGACACTTGCAGTTCGTATGCGGCTT
+>nematode_4392
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4393
+TCACCGGGTGGAGACTAGCAGTTCGTATTCCGTCT
+>nematode_4394
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_4395
+TCACCGGGTGGAAACTAGCAGTCGTATGCCGTCTT
+>nematode_4396
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4397
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4398
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4399
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4400
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4401
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4402
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_4403
+TCACCGGGTGAACACTTGTAGTTCGTATGACGTCT
+>nematode_4404
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4405
+TCACCGGGTGAACACTTGCAGTTCGTATGCTGTGT
+>nematode_4406
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_4407
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4408
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4409
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4410
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_4411
+TCACCGGGTGGAAACTAGCAGTTCGTATGACGTCT
+>nematode_4412
+TCACCGGGTGAACACTTGCAGTATCGTATGCCGTT
+>nematode_4413
+TCACCGGGTGGAAACTAGCAGTCGTATGCCGTCTT
+>nematode_4414
+TCACCGGGTGGAAACTAGCAGTTTCGTATGCCGTC
+>nematode_4415
+TCACCGGGTGAACACTTGCATCGTATGCCGTCTTC
+>nematode_4416
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4417
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4418
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4419
+TCACCGCGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4420
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4421
+TCACCGCGTGAACACTTGCAGTTCGTATCCCGTCT
+>nematode_4422
+TCACCGGGGGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4423
+TCACCGGGTGTAAATCAGCTTGATCGTATGCCGTC
+>nematode_4424
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4425
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4426
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4427
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4428
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4429
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4430
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4431
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4432
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_4433
+TCACAGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4434
+TCACAGGGTGGAAACTAGCAGTTCGTATGCGGTTT
+>nematode_4435
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4436
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4437
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4438
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_4439
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4440
+TCACAGGGTGGAAACTAGCAGTTCGTATGCCCTCT
+>nematode_4441
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4442
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_4443
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4444
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4445
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_4446
+TCACCGGGAGGAAACTAGCAGTCGTATGCTTTTTT
+>nematode_4447
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4448
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGCCT
+>nematode_4449
+TCACCGGGTGGAAACTACCAGTTCGTATTCCTTCT
+>nematode_4450
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4451
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4452
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4453
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4454
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4455
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_4456
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_4457
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4458
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4459
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_4460
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4461
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4462
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4463
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4464
+TCACCGGGTGGAAACTAGCAGTTTCGTATGCCGTC
+>nematode_4465
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4466
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4467
+TCACCGGGCGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4468
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4469
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4470
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4471
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4472
+TCACCGGGTGGAAACTTGCAGTCGTATGCCGTCTT
+>nematode_4473
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4474
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4475
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4476
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4477
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4478
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4479
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4480
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_4481
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4482
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4483
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_4484
+TCACCGGGTGAACACTTGCAGTTCGTATGACGTCT
+>nematode_4485
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4486
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4487
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4488
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4489
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4490
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4491
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTTT
+>nematode_4492
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_4493
+TCACCGGGTGTAAATCAGCTAATCGTATGCCGTCT
+>nematode_4494
+TCACCGGGTGTACATCAGCTATCGTATGCCGTCTT
+>nematode_4495
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_4496
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4497
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4498
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_4499
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4500
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4501
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4502
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4503
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4504
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_4505
+TCACCGGCTGGAAACTAGCAGTTCGTATGCCGGCT
+>nematode_4506
+TCACCGGGTGAAAATTCGCATGTCGTATCCCGTCT
+>nematode_4507
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4508
+TCACCGGGTGAACACTTGAAGTTCGTATGCCGTCT
+>nematode_4509
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4510
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4511
+TCACCGGGTGGAAACTAGCAGTCGTATGCCGTCTT
+>nematode_4512
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_4513
+TCACCGGGTGGAATCTAGCAGTTCGTATGCCGTCT
+>nematode_4514
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4515
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4516
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4517
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4518
+TCACCGGGTGAACACTTGCATCGTATGCCGTCTTC
+>nematode_4519
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4520
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4521
+TCACAGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4522
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4523
+TCACCGGGTGGAAACTAGCAGTTCGTATGACGTAT
+>nematode_4524
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4525
+TCACCGGGTGAATACTTGCAGTTCGTATGCCGTCT
+>nematode_4526
+TCACCGGGTGGAAACTAGCAGTTCGTATACCGTCT
+>nematode_4527
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4528
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4529
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4530
+TCACCGGGTGGAAACTAGCAGTTCGTATGCTGTCT
+>nematode_4531
+TCACCGGGTGGAAACTAGCATCGTATGCCGTCTTC
+>nematode_4532
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4533
+TCACCGGGTGGATACTAGCAGTTCGTATGCCGTCT
+>nematode_4534
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_4535
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4536
+TCACCGGGTGGTAACTAGCAGTTCGTATGTTGTCT
+>nematode_4537
+GCACCGGGTGGAAACTAGCAGTTCGTATGCCGTTT
+>nematode_4538
+TCACCGGGTGGAAACTAGCAGTTTCGTATGCCGTC
+>nematode_4539
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4540
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4541
+TCACCGGGTGGAAACTAGCAGTATCGTATGCCGTC
+>nematode_4542
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4543
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4544
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_4545
+TCACCGGGCGTAAATCAGCTTGTCGTATGCCGTCT
+>nematode_4546
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4547
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4548
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4549
+TCACCGGGTGTACATCAGCTAATCGTATGCTGTCT
+>nematode_4550
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_4551
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4552
+TCACCGGGTGTACATCAGCTAATCGTATGCGGTCT
+>nematode_4553
+TCACCGGGTGGAAACTAGCAGTCGTATGCCGTCTT
+>nematode_4554
+TCACCGGGTGAAAATTCGCATGTCGTATGCTGTCT
+>nematode_4555
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4556
+TCACCGGGTGGAAACTAGCATCGTATGCCGTCTTC
+>nematode_4557
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4558
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTTT
+>nematode_4559
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_4560
+TCACCGGGTGGAAACTAGCAGTCGTATGCCGTCTT
+>nematode_4561
+TCACCGGGTGGAAACTAGCAGTATCGTATGCCGTT
+>nematode_4562
+TCATCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4563
+TCACCGGGTGGAAACTAGCAGTCGTATGCCGTCTT
+>nematode_4564
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4565
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4566
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4567
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4568
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4569
+TCACCGGGTGAAAATTCGTATGTCGTATGACGTCT
+>nematode_4570
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_4571
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4572
+TCACCGGGTGGAAACTAGCAGTCGTATGCCGTCTT
+>nematode_4573
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_4574
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4575
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_4576
+TCACCGGGTGGAAACTAGCAGTCGTATGCCGTCTT
+>nematode_4577
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4578
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_4579
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4580
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_4581
+TCACCGGGTGGAAATTAGCAGTTCGTATGCCTTCT
+>nematode_4582
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4583
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4584
+TCACCGGGGGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4585
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTTT
+>nematode_4586
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4587
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_4588
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4589
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4590
+TCACCGCGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4591
+TCACCGGGTGAACACTTCCAGTTCGTATGCCGTCT
+>nematode_4592
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4593
+TCACCGGGTGGAAACTAGCAGTCGTATGCCGTCTT
+>nematode_4594
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4595
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_4596
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4597
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4598
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4599
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_4600
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4601
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4602
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4603
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4604
+TCACCGGGTGGAAACTAGCAGTTCGTATGCAGTCT
+>nematode_4605
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4606
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4607
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4608
+TCACCGGGTGTACATCAGCTATCGTATTCCGTCTT
+>nematode_4609
+TCACCGGGTGAACACTTGCAGCTCGTATGCCGTCT
+>nematode_4610
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_4611
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4612
+TCACCGGGTGGAAACTAGCAGTCGTATGCCGTCTT
+>nematode_4613
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4614
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4615
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_4616
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4617
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4618
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4619
+TCACCGGGTGGAAACTAGCAGGTCGTATGCCGGTT
+>nematode_4620
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_4621
+TCACCGGGTGAAAATTCGCATGTCGTATTCCGTCT
+>nematode_4622
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_4623
+TCACCGGGTGAACACTTGCAGTTTCGTATGCCGTC
+>nematode_4624
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4625
+TCACAGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4626
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4627
+TCACCGGGTGAACACTTGCAGTTTCGTATGCCGTC
+>nematode_4628
+TCACCGCGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4629
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4630
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4631
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4632
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_4633
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTTT
+>nematode_4634
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4635
+TCACAGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4636
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4637
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4638
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4639
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4640
+TCACCGGGTGTACATCAGCTATCGTATGCCGTCTT
+>nematode_4641
+TCACCGGGTGAACACTTGCAGTTTCGTATGCCGTC
+>nematode_4642
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4643
+TCACCGGGTGGAAACTAGGAGTTCGTATGCTGTCT
+>nematode_4644
+TCACCGGGTGGAAACTAGCAGTTCGTATGTCGTCT
+>nematode_4645
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4646
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_4647
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4648
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4649
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4650
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4651
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4652
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_4653
+TCACCGGGTGTAAATCAGATTGTCGTATGCCGTCT
+>nematode_4654
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4655
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4656
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4657
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4658
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4659
+TNACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_4660
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4661
+TCACCGGGTGGAAACTAGCAGTTCGTATGCAGTAT
+>nematode_4662
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4663
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4664
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4665
+TNACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4666
+TCACCGGGTGAACACTTGCAGTATCGTATGCCGTT
+>nematode_4667
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4668
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4669
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4670
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4671
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4672
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_4673
+TCACCGGGTGGAAACTAGCAGTCGTATGCCGTCTT
+>nematode_4674
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_4675
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4676
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4677
+TCACCGGGTGGAAACTAGCAGTTTCGTATGCCGTC
+>nematode_4678
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4679
+TCACCGGGTGAACACTTGCAGTTCGTATGCTGTCT
+>nematode_4680
+TCACCGGGTGGAAACTAGCAGTCGTATGCCGTCTT
+>nematode_4681
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4682
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4683
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4684
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_4685
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4686
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4687
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4688
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4689
+TCACCGGGTGGAAACTAGCAATCGTATGCCGTCTT
+>nematode_4690
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4691
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4692
+TCACCGGGTGTAAATCAGCTTGTCGTATGCTGTCT
+>nematode_4693
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4694
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4695
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4696
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4697
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4698
+TCAACGGGTGGAAACTAGCAGTTCGTATGCTGTCT
+>nematode_4699
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4700
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4701
+TCACCGGGTGAACACTTGCAGTATCGTATGCCGTC
+>nematode_4702
+TCACCGGGAGGAAACTAGCAGTTCGTATACCGCCT
+>nematode_4703
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4704
+TCACCGGGTGAAAATTCACATGTCGTATGCCGTCT
+>nematode_4705
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4706
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4707
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4708
+TCACCGGGTGGAAACTAGCAGTCGTATGCCGTCTT
+>nematode_4709
+TCACCGGGTGGAAACTAGCAGTCGTATGCCGTCTT
+>nematode_4710
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_4711
+GCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4712
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4713
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4714
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4715
+TCACCGGGGGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4716
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4717
+TCACCGGGTGGAAAATAGCAGTTCGTATGCCGTCT
+>nematode_4718
+TCAACGGGTGAACACTTGCAGTTCGTATGCCGTGT
+>nematode_4719
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4720
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4721
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4722
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4723
+TCACCGGGTGAACACTTGCATTTCGTATACCGTCT
+>nematode_4724
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4725
+TCACCGGGTGGAAACTAGCAGTCGTATGCCGTCTT
+>nematode_4726
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4727
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4728
+TCACCGGGTGAACACTTGCAGTTCGTATGCTGTTT
+>nematode_4729
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4730
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4731
+TCACCGGGTGGAAACTAGCAGTTTCGTATGCCGTC
+>nematode_4732
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4733
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4734
+TCACCGGGTGGAAACTAGCAGTTTCGTATGCCGTC
+>nematode_4735
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4736
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4737
+TCACCGGGTGGAAACTAGCAGTTCGTATGTCGTCT
+>nematode_4738
+TCACCGGGTGGAAACCAGCAGTTCGTATCCCGTCT
+>nematode_4739
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4740
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4741
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4742
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4743
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4744
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_4745
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4746
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4747
+TCACCGGGTGGAAACTAGCAGTTCGTATTCCGTCT
+>nematode_4748
+TCACCGGGGGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4749
+TCACCGGGTGAACACTTGCAGTCGTATGCCGTCTT
+>nematode_4750
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4751
+TCACCGGGTGAACACTTGCAGTTCGTATGCGGTCT
+>nematode_4752
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4753
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_4754
+TCACCGGGTGGAAACTAGCATCGTATGCCGTCTTC
+>nematode_4755
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4756
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4757
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4758
+TCACCGGCTGGAAACTAGCAGTCGTATGCCGTGTT
+>nematode_4759
+TCACCGGGTGGAAACTAGCAGTCGTATGCCGTCTT
+>nematode_4760
+TCACCGGGCGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4761
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4762
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4763
+AGCTGATTTCGTCTTGTTAATATCGTATGCCGTCT
+>nematode_4764
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4765
+GCACCGGGTGGAAACTAGCAGTTCGTATGGCTCTT
+>nematode_4766
+TCACCGGGTGGAAACTAGCAGTATCGTATGCAGCC
+>nematode_4767
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4768
+TCACCGGGTGGAAACTAGCAGTTCGTATGAAGACT
+>nematode_4769
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGGCT
+>nematode_4770
+TCACCGGGTGGAAACTCGCAGTTCGTATTCCGCCT
+>nematode_4771
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4772
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGCCT
+>nematode_4773
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4774
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4775
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGACT
+>nematode_4776
+TCACCGGGTGGAAACTAGCAGTTCGTATGACGTCT
+>nematode_4777
+TCACCGGGTGGAAACTAGCAGTTCGTATGCAGTCT
+>nematode_4778
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGACT
+>nematode_4779
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4780
+TCACCGGGTGGTAACTAGCAGTCGTATTACGCCTT
+>nematode_4781
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGCCT
+>nematode_4782
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4783
+TGACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_4784
+TCATCGGGTGTAAATCAGCTTGTCGTATGCCGTCT
+>nematode_4785
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_4786
+AGCTGATTTCGTCTTGGTAATATCGTATGCCGACT
+>nematode_4787
+AATCACCGGGTGTACATCAGCTAATCGTATGCCGT
+>nematode_4788
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4789
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4790
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_4791
+TCACCGGGTGGAAAATAGCAGTTCGTATGACGTCT
+>nematode_4792
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4793
+TCACCGGGTGGAAACTCGCAGTTCGTATTCCGTCT
+>nematode_4794
+TCACCGGGTGGAAACTAGCAGTCGTATGCCGTCTT
+>nematode_4795
+ACCGGGTGAACACTTGCAGTCGTATGCCGTCTTCT
+>nematode_4796
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4797
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4798
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4799
+TCACCGGGTGGAAACTAGCAGTTTCGTATGCCGTC
+>nematode_4800
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4801
+TCACCGGGTGGAAACTAGCAGTATCGTATGCCGTC
+>nematode_4802
+TCACCGGGTGGAAACTAGCAGTCGTATGCCGTCTT
+>nematode_4803
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCTGCT
+>nematode_4804
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4805
+TCACCGGGTGAACACTTCCAGTTCGTATGCCTTCT
+>nematode_4806
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_4807
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4808
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4809
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4810
+TCACCGGGTGTACATCAGATAATCGTATGTCGCTT
+>nematode_4811
+TCACCGGGTGAACACTTGCAGCTCGTATGCCACCT
+>nematode_4812
+TCACAGGGTGAACACTTGCAGTTCGTATGCAGTCT
+>nematode_4813
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4814
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_4815
+TCACCTGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4816
+CGGGAGAAAAACTGGAGTTCGTATGCCGTCTTCTT
+>nematode_4817
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4818
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4819
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4820
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_4821
+TCACCGGGTGAACACTTGCAGCTCGTATGCCGTCT
+>nematode_4822
+TCACCGGGTGAACACTTGCAGTTTCGTATGGTGTT
+>nematode_4823
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4824
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4825
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4826
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4827
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_4828
+CTCACCGGGTGTACATCAGCTATCGTATGTCGTCT
+>nematode_4829
+TCACCGGGTGAACACTTGCAGTTTCGTATTTCTTC
+>nematode_4830
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4831
+TCACCGGGTGAACACTTGCAGTTCGTATGCCTTCT
+>nematode_4832
+TCACCGGGTGGAAACTAGCAGTATCGTATGCCGTC
+>nematode_4833
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4834
+ACCGGGTGAACACTTGCAGTTCGTATGCCGTCTTC
+>nematode_4835
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4836
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4837
+TCACCGGGTGGAAACTAGCAGTCGTATGCCGTCTT
+>nematode_4838
+TCACCGGGTGAACACTTGCAGTTCGTATGCCTTCT
+>nematode_4839
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4840
+TCACCGGTTGTACATCAGCTAATCGTATTCCGTCT
+>nematode_4841
+TCACCGGGAGAAAAACTGGAGTCGTATGCCGTCTT
+>nematode_4842
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4843
+TCACCGGGTGTACATCAGCTAATCGTATGCTGTCT
+>nematode_4844
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4845
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4846
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4847
+TCACCGGGTGAAAATTCGCATCTCGTATGCCGTCT
+>nematode_4848
+ACCGGGTGGAAACTAGCAGTTTCGTATGCCGTCTT
+>nematode_4849
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_4850
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4851
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4852
+TCACCGGGTGTACATCAGTTAATCGTATGCCTTCT
+>nematode_4853
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4854
+TCACCGGGTGGAAACTAGCAGTCGTATGCCGTCTT
+>nematode_4855
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4856
+TCACCGGGTGAACACTTGCAGTTCGTATTCCTTTT
+>nematode_4857
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4858
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4859
+ACCGGGGGGAAACTAGCAGTTCGTATGCCGTCTTT
+>nematode_4860
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4861
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4862
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4863
+TCACCGGCTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4864
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4865
+TCACCGGGTGAACACTTGCAGTTCGTATGCTGTCT
+>nematode_4866
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4867
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4868
+AGCTGATTTCGTCTTGGTAATATCGTATGCCTTCT
+>nematode_4869
+TCACCGGGCGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4870
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4871
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTTT
+>nematode_4872
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4873
+ACCGGGTGTACATCAGCTAATCGTATGCCGTCTTT
+>nematode_4874
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4875
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4876
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_4877
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4878
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4879
+TCACCGGGTGGAAAATAGCAGTTCGTATGCCGTCT
+>nematode_4880
+TCACCGCGTGGAAACTAGCAGTTCGTATGCCCGCT
+>nematode_4881
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4882
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4883
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4884
+TCACCGGGAGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4885
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_4886
+TCACCGGGTGAAAATTTGCATGTCGTATGCAGACT
+>nematode_4887
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_4888
+TCACCGGGTGGAAACTAGCAGTTCGTATGACGTTT
+>nematode_4889
+TCACCGGCTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4890
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4891
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4892
+TCACCGGGTGGAAACTAGCAGTCGTATGCCGTCTT
+>nematode_4893
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4894
+ACCGGGAGAACACTTGCAGTTCGTATGCCGTCTTC
+>nematode_4895
+TCACCGGGAGGAAACTAGCAGTTCGTATGCCGCTT
+>nematode_4896
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4897
+TCACCGGGTGGAAACTAGCAGTTTCGTATGCTGTT
+>nematode_4898
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4899
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4900
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4901
+TCACAGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4902
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_4903
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4904
+TCACCGGGTGAACACTTGCAGTTCGTATGCCTTCT
+>nematode_4905
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4906
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4907
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4908
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4909
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4910
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4911
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4912
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4913
+TCACCGGGTGGAAACTAGTAGTTCGTATGCCGTCT
+>nematode_4914
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4915
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4916
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4917
+TCACCGGGTGTAAATCAGCTTGTCGTATGCCGTCT
+>nematode_4918
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4919
+TCACCGGGTGGAAACTAGCAGTTCGTATTCCGTCT
+>nematode_4920
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4921
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCTTTT
+>nematode_4922
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4923
+TCACCGGGTGAACACTTGCAGATCGTATGACGTCT
+>nematode_4924
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_4925
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4926
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_4927
+TCACCGGGTGTAAATCAGCTTGTCGTATGCCGTCT
+>nematode_4928
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4929
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4930
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4931
+TCACCGGGCGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4932
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4933
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_4934
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_4935
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4936
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4937
+TCACCGGGTGGAAACTGGCAGTTCGTATGCCGTCT
+>nematode_4938
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4939
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4940
+TCACCGGGTGGAAACTAGCAGTATCGTATGCCGTC
+>nematode_4941
+TCACCGGGTGGACACTTGCAGTTCGTATGCCTTCT
+>nematode_4942
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4943
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4944
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4945
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4946
+TCCCCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_4947
+TCACCGGGTGTACATCAGCTTCGTATGCCGTCTTC
+>nematode_4948
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_4949
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4950
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4951
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_4952
+TCACCGGGTGTAAATCAGCTTTTCGTATGCCTTTT
+>nematode_4953
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_4954
+TCACCGGGAGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4955
+TCACCGGGTGGACATCAGCTAATCGTATGCCGTCT
+>nematode_4956
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4957
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4958
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4959
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4960
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4961
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_4962
+TCACCGGGTGAAAACTTGCAGTTCGTATGCCGTCT
+>nematode_4963
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4964
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4965
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_4966
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4967
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4968
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4969
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4970
+TCACCGGGTGTACATCAGATAATCGTATGCCGTCT
+>nematode_4971
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4972
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4973
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4974
+TCACCGGGTGTAAATCAGCTTGTCGTATGCCGTCT
+>nematode_4975
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4976
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4977
+TCACAGGGTGTAAATCAGCTTGTCGTATGCCGTCT
+>nematode_4978
+TCACCGGGTGGAAACTAGCAGTTTCGTATGCCGTC
+>nematode_4979
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4980
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4981
+TCACCGGGTGGAAACTAGCAGTCGTATGCCGTCTT
+>nematode_4982
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4983
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4984
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_4985
+TCACTGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4986
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4987
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4988
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCTTCT
+>nematode_4989
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4990
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4991
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4992
+TCACCGGGTGAACACTTGCAGTATCGTATGCCGTC
+>nematode_4993
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_4994
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_4995
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4996
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_4997
+TCACCGGGAGAAAAACTGGAGTTCGTATGCCGTCT
+>nematode_4998
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_4999
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCTTCT
+>nematode_5000
+TCACCGGGTGGAAACTAGCATCGTATGTCGTCTTC
+>nematode_5001
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_5002
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_5003
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_5004
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_5005
+TCACCGGGTGAACACTTGCAGTTCGTATGCTGTCT
+>nematode_5006
+TCACAGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_5007
+TCACCGGGTGGAAACTAGCAGTTTCGTATGCCGTC
+>nematode_5008
+TCACCGGGTGTACATCAGCTAATCGTATGCCTTCT
+>nematode_5009
+TCACCGGGTGGAAATTAGCAGTTCGTATGCCGTCT
+>nematode_5010
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_5011
+TCACCGGGTGAACACTTGCAGTCGTATGCCGTCTT
+>nematode_5012
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCTTCT
+>nematode_5013
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_5014
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_5015
+TCACCGGGTGGAAACTAGAAGTTCGTATCCCGTCT
+>nematode_5016
+TCACCGCGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_5017
+TCACCGGGTGAACACTTGCATTTCGTATGCAGTCT
+>nematode_5018
+TCACCGGGTGAACACTTGCAGTTCGTATGCCTTCT
+>nematode_5019
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_5020
+TCACCGGGTGGTAACTAGCAGTCGTATTACGCCTT
+>nematode_5021
+TCACCGGGTGAACACTTGCAGTTCGTATGCCTTCT
+>nematode_5022
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_5023
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_5024
+TCACCGGGTGAACACTTGCAGTCGTATGCCGTCTT
+>nematode_5025
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_5026
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_5027
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_5028
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_5029
+TCACCGGGTGGAAACTAGCAGTCGTATGCCGTCTT
+>nematode_5030
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTTT
+>nematode_5031
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_5032
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_5033
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_5034
+TCACCGGGTGGAAACTAGCAGTCGTATGCCGTCTT
+>nematode_5035
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_5036
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_5037
+TCACCGGCTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_5038
+TCACCGGATGGAAACTAGCAGTTCGTATTCTGTTT
+>nematode_5039
+TCACCGGGTGTAAATCAGCTTGTCGTATGCCGTCT
+>nematode_5040
+TCACCGGGTGAACACTTGCAGTTCGTATGCTTTCT
+>nematode_5041
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_5042
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_5043
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_5044
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_5045
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_5046
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_5047
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_5048
+TCACCGGGTGGAAACTAGCAGTTCGTATGCTGTCT
+>nematode_5049
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_5050
+TCACCGGGTGTAAATCAGCTTGTCGTATGCCGTCT
+>nematode_5051
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_5052
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_5053
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_5054
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_5055
+TCACCGGGTGTAAATCAGCTTGTCGTATGCCTTCT
+>nematode_5056
+TCACCGGGTGAACACTTGCGGTTCGTATGCTGTTT
+>nematode_5057
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_5058
+TCACCGGGTGGAAACTAGCAGTTCGTATCTATTAT
+>nematode_5059
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_5060
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_5061
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCTTCT
+>nematode_5062
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_5063
+TCACCGGGTGGAAACTAGCAGTATCGTATGCCGTC
+>nematode_5064
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_5065
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_5066
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTTT
+>nematode_5067
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_5068
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_5069
+TCACCGGGAGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_5070
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_5071
+TCACCGGGTGAACACTTGCAGTATCGTATGCCGTC
+>nematode_5072
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_5073
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_5074
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_5075
+TCACCGGGTGAAAATTCGCATTCGTATGCCGTCTT
+>nematode_5076
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_5077
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_5078
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTTT
+>nematode_5079
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_5080
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_5081
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_5082
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_5083
+TCACCGGGTGAACACTTGCAGTGCTCGTATGCCGT
+>nematode_5084
+TCACCGGGTGTAAATCAGCTTGTCGTATGCCGTCT
+>nematode_5085
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_5086
+TCACCGGGTGAACACTTGCCGTTCGTATGACGATT
+>nematode_5087
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_5088
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_5089
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_5090
+TCACCGGGTGGAAACCAGCAGTTCGTATGCCGTCT
+>nematode_5091
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_5092
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_5093
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_5094
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_5095
+TCACCGGGAGGAAAACTGGAGTTCGTATGCCGTCT
+>nematode_5096
+TCACCGGGTGAACACTTGCAGTTCGTATGCCTTCT
+>nematode_5097
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_5098
+TCACCGGGTGAACACTTGCAGTTCGTATGCTGTCT
+>nematode_5099
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_5100
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_5101
+TCACCGGGCGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_5102
+TCACCGGGTGGAAACTAGCAGTTCGTATGCAGTCT
+>nematode_5103
+TCACCGGGTGAACACTTGCAGTTCGTATGTCGTCT
+>nematode_5104
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_5105
+TCACCGGGGGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_5106
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_5107
+TCACCGGGTGGAAACTAGCAGTCGTATGCCGTCTT
+>nematode_5108
+TCACCGGGTGGAAACTAGCAGTTCGTATGAAGTAT
+>nematode_5109
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_5110
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_5111
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_5112
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_5113
+TCACCGGGTGGAAACTAGCAGTTCGTATGTCGTCT
+>nematode_5114
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_5115
+TCACCGGGTGAACACTTGCAGTTCGTATTCCTTCT
+>nematode_5116
+TCACCGGGTGTACATCAGCTAATCGTATGCCTTCT
+>nematode_5117
+TCACCGGGTGGCAACTAGCAGTTCGTATTCCTTCT
+>nematode_5118
+TCACCGGGGGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_5119
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_5120
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_5121
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_5122
+TCACCGGGTAGAAACTAGCAGTTCGTATGCCGCTT
+>nematode_5123
+TCACCGGGTGGAAACTAGCAGTTCGTATTCATTCT
+>nematode_5124
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_5125
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_5126
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_5127
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_5128
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_5129
+TCACCGGGTGTACATCAGCTAATCGTATGCTGTTT
+>nematode_5130
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_5131
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_5132
+TNACCGGGTGGAAACTAGCAGTCGTATGCCGTCTT
+>nematode_5133
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_5134
+TCACCGGGTGGAAACTAGCAGTCGTATGCCGTCTT
+>nematode_5135
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_5136
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_5137
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_5138
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_5139
+TCACCGGGAGAAAAACTGGAGTCGTATGCCGTCTT
+>nematode_5140
+TCACCGGGTGAAAATTCGCATTCGTATGTCGTGTT
+>nematode_5141
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_5142
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCTTCT
+>nematode_5143
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_5144
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_5145
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_5146
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_5147
+TCACCGGGGGAAAATTCGCATGTCGTATGCCTTCT
+>nematode_5148
+TCACCGGGTGGAAACTAGCAGTCGTATGTCGTTTT
+>nematode_5149
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_5150
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_5151
+TCACCGGGTGTACATCAGCTAATCGTATGCCTTCT
+>nematode_5152
+TCACCGGGGGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_5153
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTTT
+>nematode_5154
+TCACTGGGTGAAAATTCGCATGTCGTATGTCGTCT
+>nematode_5155
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_5156
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_5157
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_5158
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_5159
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_5160
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_5161
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_5162
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_5163
+TCACCGGGTGAAAATTCGCAGGTCGTATGCCGTCT
+>nematode_5164
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_5165
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_5166
+TCACCGGGGGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_5167
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_5168
+TCACCGGGGGGAAACTAGCAGTTCGTATGCCTTCT
+>nematode_5169
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGCCT
+>nematode_5170
+TCACCGGGTGTACATCAGCTAATTCGTATGCCGTC
+>nematode_5171
+ACCGGGTGGAAACTAGCAGTTCGTATGCCGGCTTC
+>nematode_5172
+TCACCTGGTGGAAACTAGCAGTTCGTATGCTGTCT
+>nematode_5173
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_5174
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_5175
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_5176
+TCACCGGGCGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_5177
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_5178
+TCACCGGGTGGAAACTAGCAGTCGTATGTCGTCTT
+>nematode_5179
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_5180
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_5181
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_5182
+TCACCGGGTGAAAACTAGCAGTCGTATGCCGTCTT
+>nematode_5183
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_5184
+TCACCGGGTGGAAACTAGCAGTATCGTATGTCGTC
+>nematode_5185
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_5186
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_5187
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_5188
+TCACCGGGTGGAAACTAGCAGTTCGTATGCAGTAT
+>nematode_5189
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_5190
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_5191
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_5192
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_5193
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCTTCT
+>nematode_5194
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_5195
+TCACCGGGTGAACACTTGCAGTTCGTATGCCTTCT
+>nematode_5196
+TCACCGGGTGGAAACTAGCAGTATCGTATGCCGTC
+>nematode_5197
+TCACCGGGCGTAAATCAGCTTGTCGTATGCCGTCT
+>nematode_5198
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_5199
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_5200
+TCACCGGGTGAACACTTGCAGTCGTATGACGTCTT
+>nematode_5201
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_5202
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_5203
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_5204
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_5205
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_5206
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_5207
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_5208
+TCACCGGGAGGAAACTAGCAGTTCGTATTCCTTCT
+>nematode_5209
+TCACCGGGTGGAAACTAGCAGTCGTATGCCGTCTT
+>nematode_5210
+TCACCGGGTGGAAACTAGCAGTCGTATGCCGTCTT
+>nematode_5211
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCTTCT
+>nematode_5212
+TCACCGGGTGGAAACTAGCAGTTCGTATGTCGTCT
+>nematode_5213
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_5214
+TCACCGGGTGGAAACTAGCAGTTTCGTATGCCGTC
+>nematode_5215
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_5216
+TCACCGGGTGGAAACTAGCAGTATCGTATGCCCTC
+>nematode_5217
+TCACCGGGTGGAAACTAGCAGTCGTATGCCGTCTT
+>nematode_5218
+TCACCGGGTGGAAACTAGCAGTTCGTATGTCGTCT
+>nematode_5219
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_5220
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_5221
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_5222
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_5223
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_5224
+TCACCGGGTGGAAACTAGCAGTTTCGTATGCCGTC
+>nematode_5225
+TCACCGGGTGTACATCAGCTAATCGTATGCCGCTT
+>nematode_5226
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_5227
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_5228
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_5229
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_5230
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_5231
+TCACCGGGTGAACACTTGCATCGTATGCCGTCTTC
+>nematode_5232
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_5233
+TCACCGGGTGGAAACTAGCAGTTCGTATGACGACT
+>nematode_5234
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_5235
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_5236
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_5237
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_5238
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_5239
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_5240
+TCACCGGGTGGAAACTAGCAGTTCGTATGCTGTTT
+>nematode_5241
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_5242
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_5243
+TCACCGGGTGTAAATCAGCTTGTCGTATGCCGTCT
+>nematode_5244
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_5245
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_5246
+TCACCGGGTGAACACTTGCAGTCGTATGCCGTCTT
+>nematode_5247
+TCACCGAGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_5248
+TCACCGGGTGGAAACTAGCAGTCGTATGCCGTCTT
+>nematode_5249
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_5250
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_5251
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGCCT
+>nematode_5252
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_5253
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_5254
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_5255
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGCCT
+>nematode_5256
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_5257
+TCACCGGGTGAACACTTGCAGTATCGTATGACGTC
+>nematode_5258
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_5259
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_5260
+TCACCGGGTGAATACTTGCAGTTCGTATGCTGTCT
+>nematode_5261
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_5262
+TCACCGGGGGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_5263
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_5264
+TCACCGGGTGAACACTTGCAGTTCGTATGCGGTGT
+>nematode_5265
+TCACCGGGTGTACATCAGCTAATCGTATGACGTCT
+>nematode_5266
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_5267
+TCACCGGGTGGAAACTAGCAGTCGTATGCCGTCTT
+>nematode_5268
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_5269
+TCACCGGGTGTACATCAGCTAATCGTATGACGTCT
+>nematode_5270
+TCACCGGGCGGAAACTAGCAGTTCGTATGTCGGTT
+>nematode_5271
+TCACCGGGTGGAAACTAGCAGTCGTATGCCGTCTT
+>nematode_5272
+TCACCGGGTGAACACTTGCAGTATCGTATGCCGTC
+>nematode_5273
+TCACCGGGTGTACATCAGCTATCGTATGGCGGCTT
+>nematode_5274
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_5275
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_5276
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_5277
+TCACCGGGTGAACACTTGCAGTTCGTATGTCGTCT
+>nematode_5278
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_5279
+TCACCGGGTGGAAACTAGCAGTTCGTATTCCGCCT
+>nematode_5280
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTAT
+>nematode_5281
+TCACCGCGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_5282
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_5283
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_5284
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_5285
+AGCTGATTTCGTCTTGGTAATATCGTATGCCGTCT
+>nematode_5286
+ACCGGGTGGAAACTAGCAGTTCGTATGCCGTCTTC
+>nematode_5287
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_5288
+AGCTGATTTCGTCTTGGTAATCGTATGCCGTCTTC
+>nematode_5289
+TCACCGGGTGGAAACTATCAGTTCGTATGCCGTCT
+>nematode_5290
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_5291
+ACACCGGGTGGAAACTAGCAGTTCGTATCCCGTCT
+>nematode_5292
+TCACCGGGTGAACACTTGCAGTCGTATGCCGTCTT
+>nematode_5293
+TCACCGGGTGGAAACTAGCAGTTCGTATGCAGTCT
+>nematode_5294
+TCACCGGGTGGAAACTAGCAGCTCGTATGCCGTCT
+>nematode_5295
+TCACCGGGTGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_5296
+TCACCGGGTGGAAACTAGCAGTTCGTATGACGTAT
+>nematode_5297
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTTT
+>nematode_5298
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_5299
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_5300
+CCACCGGGTGAACACTTGCAGTCGTATGCCGTCTT
+>nematode_5301
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTTT
+>nematode_5302
+TCACCGGGTGGAAACTAGCAGGTCGTATGCCGCCT
+>nematode_5303
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_5304
+TCACCGGGTGGAAACTAGCCGTTCGTATGACGTCT
+>nematode_5305
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_5306
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_5307
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_5308
+TCACAGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_5309
+TCACCGGGTGAACACTTGCAGTTCGTATGCTGTCT
+>nematode_5310
+TCACCGGGAGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_5311
+CGCCAATTTTCGCTTCAGTGCTATCGTATGCCGTT
+>nematode_5312
+TCACCGGGCGGAAACTAGCAGTTCGTATGACGACG
+>nematode_5313
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_5314
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_5315
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_5316
+ACCGGGTGTACATCAGCTAATCGTATGCCGTCTTC
+>nematode_5317
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_5318
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_5319
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_5320
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_5321
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_5322
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_5323
+TCACCGGGTGGAAACTAGCAGTATCGTATGCCGCC
+>nematode_5324
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_5325
+TCACCGGGGGTACATCAGCTAATCGTATGCCCTCT
+>nematode_5326
+TCACCGGGTGAACACTTGCAGTTCGTATGCCGTCT
+>nematode_5327
+TCACCGGGTGGAAACTAGCAGGTCGTATGCCGTCT
+>nematode_5328
+TCACCGGGCGAAAATTCGCATGTCGTATGCCGTCT
+>nematode_5329
+TCACCGGGTGTACATCAGCTAATCGTATGCCGTCT
+>nematode_5330
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT
+>nematode_5331
+TCACCGGGTGGAAACTAGCATCGTATGCCGTCTTC
+>nematode_5332
+TCACCGGGTGGAAACTAGCAGTTCGTATGCCGTCT