# HG changeset patch
# User rnateam
# Date 1701607914 0
# Node ID 7dd2835ce566539fb86d9486ad17889c160670ea

planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/rna_tools/rbpbench commit 0e21bd630200c1f199db8ba5d83b81d4214fc59f

diff -r 000000000000 -r 7dd2835ce566 batch_table_wrapper.py
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/batch_table_wrapper.py	Sun Dec 03 12:51:54 2023 +0000
@@ -0,0 +1,242 @@
+#!/usr/bin/env python3
+
+import argparse
+import os
+import re
+import subprocess
+
+
+###############################################################################
+
+def setup_argument_parser():
+    """Setup argparse parser."""
+    help_description = """
+    Python wrapper for RBPBench Galaxy wrapper to work with collections of
+    input BED files (i.e. to process them with rbpbench batch).
+    """
+    # Define argument parser.
+    p = argparse.ArgumentParser(add_help=False,
+                                prog="batch_table_wrapper.py",
+                                description=help_description,
+                                formatter_class=argparse.MetavarTypeHelpFormatter)
+
+    # Required arguments.
+    p.add_argument("-h", "--help",
+                   action="help",
+                   help="Print help message")
+    p.add_argument("--table",
+                   dest="in_table",
+                   type=str,
+                   metavar='str',
+                   required=True,
+                   help="Input table file with data ID, method ID, RBP ID and file name (Galaxy element identifier in dataset collection) for each to be processed dataset by rbpbench batch")
+    p.add_argument("--paths",
+                   dest="in_paths",
+                   type=str,
+                   metavar='str',
+                   nargs='+',
+                   required=True,
+                   help="List of Galaxy BED file paths (--files path1 path2 .. )")
+    p.add_argument("--ids",
+                   dest="in_ids",
+                   type=str,
+                   metavar='str',
+                   nargs='+',
+                   required=True,
+                   help="List of Galaxy element identifiers, equal to the BED dataset names in the dataset collection (--ids id1 id2 .. )")
+    p.add_argument("--genome",
+                   dest="in_genome",
+                   type=str,
+                   metavar='str',
+                   required=True,
+                   help="Genomic sequences file (currently supported formats: FASTA)")
+    p.add_argument("--out",
+                   dest="out_folder",
+                   type=str,
+                   metavar='str',
+                   required=True,
+                   help="Batch results output folder")
+    # Optional batch arguments.
+    p.add_argument("--ext",
+                   dest="ext_up_down",
+                   type=str,
+                   metavar='str',
+                   default="0",
+                   help="Up- and downstream extension of --in sites in nucleotides (nt). Set e.g. --ext 30 for 30 nt on both sides, or --ext 20,10 for different up- and downstream extension (default: 0)")
+    p.add_argument("--motif-db",
+                   dest="motif_db",
+                   type=int,
+                   default=1,
+                   choices=[1, 2, 3],
+                   help="Motif database to use. 1: human RBP motifs full (259 RBPs, 605 motifs, human_v0.1), 2: human RBP motifs full (low frequencies not rounded, human_v0.1_no_round), 3: human RBP motifs eCLIP (107 RBPs, 316 motifs, human_eclip_v0.1) (default: 1)")
+    p.add_argument("--fimo-nt-freqs",
+                   dest="fimo_nt_freqs",
+                   type=str,
+                   metavar='str',
+                   default=False,
+                   help="Provide FIMO nucleotide frequencies (FIMO option: --bifile) file (default: use internal frequencies file optimized for human transcripts)")
+    p.add_argument("--fimo-pval",
+                   dest="fimo_pval",
+                   type=float,
+                   metavar='float',
+                   default=0.001,
+                   help="FIMO p-value threshold (FIMO option: --thresh) (default: 0.001)")
+    p.add_argument("--bed-score-col",
+                   dest="bed_score_col",
+                   type=int,
+                   metavar='int',
+                   default=5,
+                   help="--in BED score column used for p-value calculations. BED score can be e.g. log2 fold change or -log10 p-value of the region (default: 5)")
+    p.add_argument("--unstranded",
+                   dest="unstranded",
+                   default=False,
+                   action="store_true",
+                   help="Set if --in BED regions are NOT strand-specific, i.e., to look for motifs on both strands of the provided regions. Note that the two strands of a region will still be counted as one region (change with --unstranded-ct) (default: False)")
+    p.add_argument("--unstranded-ct",
+                   dest="unstranded_ct",
+                   default=False,
+                   action="store_true",
+                   help="Count each --in region twice for RBP hit statistics when --unstranded is enabled. By default, two strands of one region are counted as one region for RBP hit statistics")
+    return p
+
+
+###############################################################################
+
+if __name__ == '__main__':
+
+    parser = setup_argument_parser()
+    args = parser.parse_args()
+
+    assert os.path.exists(args.in_table), "--table file \"%s\" not found" % (args.in_file)
+    assert os.path.exists(args.in_genome), "--genome file \"%s\" not found" % (args.in_genome)
+
+    c_paths = len(args.in_paths)
+    c_ids = len(args.in_ids)
+    assert c_paths == c_ids, "given # paths (--paths) != # ids (--ids) (%i != %i). Please provide one ID for each path" % (c_paths, c_ids)
+
+    """
+    Check given paths and IDs.
+
+    """
+
+    # Paths.
+    paths_dic = {}
+    paths_list = []
+    for path in args.in_paths:
+        assert os.path.exists(path), "--paths %s file not found" % (path)
+        if path not in paths_dic:
+            paths_dic[path] = 1
+        else:
+            assert False, "--paths %s given > 1. Please provide unique paths" % (path)
+        paths_list.append(path)
+
+    # IDs
+    ids_dic = {}
+    ids_list = []
+    for id in args.in_ids:
+        if id not in ids_dic:
+            ids_dic[id] = 1
+        else:
+            assert False, "--ids \"%s\" given > 1. Please provide unique element identifiers (dataset names) inside the dataset collection, in order to unambiguously assign element ID to file path" % (id)
+        ids_list.append(id)
+
+    id2path_dic = {}
+    for idx, id in enumerate(ids_list):
+        path = paths_list[idx]
+        id2path_dic[id] = path
+
+    """
+    Read in table.
+
+    Column format:
+    rbp_id method_id data_id dataset_name
+
+    """
+
+    comb_ids_dic = {}
+    id_collect_dic = {}
+    id_collect_dic["rbp_id"] = []
+    id_collect_dic["method_id"] = []
+    id_collect_dic["data_id"] = []
+    id_collect_dic["set_name"] = []
+    id_collect_dic["path"] = []  # Galaxy file path.
+
+    print("Read in --table ... ")
+
+    with open(args.in_table) as f:
+        for line in f:
+
+            if re.search("^#", line):
+                continue
+
+            cols = line.strip().split("\t")
+
+            assert len(cols) == 4, "line in --table with # cols != 4 (%i) encountered:%s" % (len(cols), line)
+
+            rbp_id = cols[0]
+            method_id = cols[1]
+            data_id = cols[2]
+            set_name = cols[3]
+
+            if rbp_id == "rbp_id":
+                continue
+
+            comb_id = "%s,%s,%s,%s" % (rbp_id, method_id, data_id, set_name)
+
+            if comb_id not in comb_ids_dic:
+                comb_ids_dic[comb_id] = 1
+            else:
+                assert False, "data combination (\"%s\") appears > 1 in --table file. Please provide unique combinations for rbpbench batch calculation" % (comb_id)
+
+            assert set_name in ids_dic, "given dataset name \"%s\" from --table not part of given --ids. Please provide dataset names present in dataset collection" % (set_name)
+
+            id_collect_dic["rbp_id"].append(rbp_id)
+            id_collect_dic["method_id"].append(method_id)
+            id_collect_dic["data_id"].append(data_id)
+            id_collect_dic["set_name"].append(set_name)
+            id_collect_dic["path"].append(id2path_dic[set_name])
+
+    f.closed
+
+    assert id_collect_dic["rbp_id"], "nothing read in from --table. Please provide non-empty table in correct format (columns: rbp_id method_id data_id dataset_name)"
+
+    """
+    Construct RBPBench batch call.
+
+    """
+
+    batch_call = "rbpbench batch"
+    batch_call += " --out %s" % (args.out_folder)
+    batch_call += " --genome %s" % (args.in_genome)
+    batch_call += " --ext %s" % (args.ext_up_down)
+    batch_call += " --motif-db %i" % (args.motif_db)
+    if args.fimo_nt_freqs:
+        batch_call += " --fimo-nt-freqs %s" % (args.fimo_nt_freqs)
+    batch_call += " --fimo-pval %s" % (str(args.fimo_pval))
+    batch_call += " --bed-score-col %i" % (args.bed_score_col)
+    if args.unstranded:
+        batch_call += " --unstranded"
+    if args.unstranded_ct:
+        batch_call += " --unstranded-ct"
+
+    rbp_ids = (" ").join(id_collect_dic["rbp_id"])
+    method_ids = (" ").join(id_collect_dic["method_id"])
+    data_ids = (" ").join(id_collect_dic["data_id"])
+    paths = (" ").join(id_collect_dic["path"])
+
+    batch_call += " --rbp-list %s" % (rbp_ids)
+    batch_call += " --method-list %s" % (method_ids)
+    batch_call += " --data-list %s" % (data_ids)
+    batch_call += " --bed %s" % (paths)
+
+    """
+    Execute RBPBench batch call.
+    """
+
+    print("")
+    print("EXECUTING CALL:\n%s" % (batch_call))
+    output = subprocess.getoutput(batch_call)
+    print("")
+    print("RUN OUTPUT:\n%s" % (output))
+    print("")
+    print("DONE.")
diff -r 000000000000 -r 7dd2835ce566 macros.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/macros.xml	Sun Dec 03 12:51:54 2023 +0000
@@ -0,0 +1,40 @@
+<macros>
+    <token name="@TOOL_VERSION@">0.7</token>
+    <token name="@VERSION_SUFFIX@">0</token>
+    <token name="@profile@">22.05</token>
+    <xml name="requirements">
+        <requirements>
+            <requirement type="package" version="@TOOL_VERSION@">rbpbench</requirement>
+            <requirement type="package" version="5.5.4">meme</requirement>
+        </requirements>
+    </xml>
+    <xml name="bio_tools">
+        <xrefs>
+            <xref type="bio.tools">rbpbench</xref>
+        </xrefs>
+    </xml>
+    <!--xml name="citations">
+        <citations>
+            <citation type="doi"></citation>
+        </citations>
+    </xml-->
+    <token name="@PREPARE_REF@"><![CDATA[
+        ln -s -f
+        #if str($action_type.reference_genome.reference_genome_selector) == "history"
+            '$action_type.reference_genome.history_genome'
+        #else
+            '$action_type.reference_genome.builtin_genome.fields.path'
+        #end if
+        reference.fa &&
+    ]]></token>
+    <token name="@COMMON_PARAMS@"><![CDATA[
+        --ext $action_type.search_options.search_ext
+        --fimo-pval $action_type.search_options.search_fimo_pval
+        --bed-score-col $action_type.search_options.search_bed_score_col
+        $action_type.search_options.search_unstranded
+        $action_type.search_options.search_unstranded_ct
+        #if $action_type.search_options.fimo_nt_freqs_file:
+            --fimo-nt-freqs '$action_type.search_options.fimo_nt_freqs_file'
+        #end if
+    ]]></token>
+</macros>
diff -r 000000000000 -r 7dd2835ce566 rbpbench.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/rbpbench.xml	Sun Dec 03 12:51:54 2023 +0000
@@ -0,0 +1,1003 @@
+<tool id="rbpbench" name="RBPBench" version="@TOOL_VERSION@+galaxy@VERSION_SUFFIX@" profile="@profile@">
+
+    <description>- Evaluate CLIP-seq and other genomic region data using a comprehensive collection of RBP binding motifs</description>
+    <macros>
+        <import>macros.xml</import>
+    </macros>
+    <expand macro="bio_tools"/>
+    <expand macro="requirements"/>
+
+    <command detect_errors="exit_code"><![CDATA[
+        #if $action_type.action_type_selector == 'search_motifs':
+            @PREPARE_REF@
+            rbpbench search
+                --in '$action_type.search_bed_file'
+                --out ./
+                --genome reference.fa
+                --method-id '$action_type.search_method_id'
+                --data-id '$action_type.search_data_id'
+                --rbps
+                #if str($action_type.select_db.select_db_selector) == "default_db":
+                    #if str($action_type.select_db.select_rbps.select_rbps_selector) == "list_db_rbps":
+                        #if str($action_type.select_db.select_rbps.database) != "None":
+                            #for $rbp_id in str($action_type.select_db.select_rbps.database).split(','):
+                                $rbp_id
+                            #end for
+                        #end if
+                    #else:
+                        ALL
+                    #end if
+                #else:
+                    $action_type.select_db.custom_db_rbp_ids_list
+                #end if
+
+                #if str($action_type.user_rbp.user_rbp_selector) == "sequence":
+                    USER
+                    --user-rbp-id $action_type.user_rbp.seq_rbp_id
+                    --user-meme-xml '$action_type.user_rbp.meme_motifs_xml'
+                #elif str($action_type.user_rbp.user_rbp_selector) == "structure":
+                    USER
+                    --user-rbp-id $action_type.user_rbp.str_rbp_id
+                    --user-cm '$action_type.user_rbp.cm_model_file'
+                #end if
+
+                #if str($action_type.select_db.select_db_selector) == "custom_db":
+                    --custom-db-id $action_type.select_db.custom_db_id
+                    --custom-db-info $action_type.select_db.custom_db_info_file
+                    #if $action_type.select_db.custom_db_meme_xml_file:
+                        --custom-db-meme-xml '$action_type.select_db.custom_db_meme_xml_file'
+                    #end if
+                    #if $action_type.select_db.custom_db_cm_model_file:
+                        --custom-db-cm '$action_type.select_db.custom_db_cm_model_file'
+                    #end if
+                #end if
+                @COMMON_PARAMS@
+                #if $action_type.report_plotting_options.set_rbp_id:
+                    --set-rbp-id '$action_type.report_plotting_options.set_rbp_id'
+                #end if
+                --motif-distance-plot-range $action_type.report_plotting_options.motif_distance_plot_range
+                --motif-min-pair-count $action_type.report_plotting_options.motif_min_pair_count
+                --rbp-min-pair-count $action_type.report_plotting_options.rbp_min_pair_count
+                #if $action_type.report_plotting_options.gtf_file:
+                    --gtf '$action_type.report_plotting_options.gtf_file'
+                #end if
+                #if $action_type.report_plotting_options.tr_list_file:
+                    --tr-list '$action_type.report_plotting_options.tr_list_file'
+                #end if
+                #if $action_type.report_plotting_options.list_tr_biotypes:
+                    --tr-types '$action_type.report_plotting_options.list_tr_biotypes'
+                #end if
+                --upset-plot-min-degree $action_type.report_plotting_options.upset_plot_min_degree
+                #if $action_type.report_plotting_options.upset_plot_max_degree:
+                    --upset-plot-max-degree '$action_type.report_plotting_options.upset_plot_max_degree'
+                #end if
+                --upset-plot-min-subset-size $action_type.report_plotting_options.upset_plot_min_subset_size
+
+                $action_type.search_output_options.search_report
+                $action_type.search_output_options.search_plot_motifs
+
+                #if $action_type.report_plotting_options.store_sort_js_in_html:
+                    --sort-js-mode 3
+                #else:
+                    --sort-js-mode 2
+                #end if
+                #if $action_type.report_plotting_options.plotly_js_source == 1:
+                    #if $action_type.report_plotting_options.plotly_plot_code_in_html:
+                        --plotly-js-mode 6
+                    #else:
+                        --plotly-js-mode 3
+                    #end if
+                #elif $action_type.report_plotting_options.plotly_js_source == 2:
+                    #if $action_type.report_plotting_options.plotly_plot_code_in_html:
+                        --plotly-js-mode 5
+                    #else:
+                        --plotly-js-mode 1
+                    #end if
+                #else:
+                    #if $action_type.report_plotting_options.plotly_plot_code_in_html:
+                        --plotly-js-mode 7
+                    #else:
+                        --plotly-js-mode 4
+                    #end if
+                #end if
+
+            #if $action_type.search_output_options.search_report:
+                &&
+                sed -i 's/html_report_plots\///g' ./report.rbpbench_search.html
+                &&
+                cp ./report.rbpbench_search.html $search_report_html_file
+                &&
+                mkdir '$search_report_html_file.extra_files_path'
+                &&
+                cp -r ./html_report_plots/* '$search_report_html_file.extra_files_path'
+            #end if
+            
+            #if $action_type.search_output_options.search_plot_motifs:
+                &&
+                sed -i 's/html_motif_plots\///g' ./motif_plots.rbpbench_search.html
+                &&
+                cp ./motif_plots.rbpbench_search.html $motif_plots_html_file
+                &&
+                mkdir '$motif_plots_html_file.extra_files_path'
+                &&
+                cp -r ./html_motif_plots/* '$motif_plots_html_file.extra_files_path'
+            #end if
+
+
+        #elif $action_type.action_type_selector == 'batch_search_motifs':
+            @PREPARE_REF@
+            rbpbench batch
+                --out ./
+                --genome reference.fa
+                --bed 
+                #for $i in $action_type.dataset_inputs:
+                    $i.dataset_bed_file
+                #end for
+                --rbp-list 
+                #for $i in $action_type.dataset_inputs:
+                    $i.dataset_rbp_id 
+                #end for
+                --data-list 
+                #for $i in $action_type.dataset_inputs:
+                    $i.dataset_data_id 
+                #end for
+                --method-list 
+                #for $i in $action_type.dataset_inputs:
+                    $i.dataset_method_id 
+                #end for
+                @COMMON_PARAMS@
+
+        #elif $action_type.action_type_selector == 'batch_table_search_motifs':
+            @PREPARE_REF@
+            batch_table_wrapper_rbpbench.py
+                --out ./
+                --genome reference.fa
+                --table '$action_type.batch_table_file'
+                --paths 
+                #for $i in $action_type.batch_table_bed_collection:
+                    $i
+                #end for
+                --ids 
+                #for $i in $action_type.batch_table_bed_collection:
+                    $i.element_identifier
+                #end for
+                @COMMON_PARAMS@
+
+        #elif $action_type.action_type_selector == 'plot_nt_dist':
+            @PREPARE_REF@
+            rbpbench dist
+                --in '$action_type.dist_bed_file'
+                --out ./
+                --genome reference.fa
+                --cp-mode $action_type.dist_options.dist_cp_mode
+                --ext $action_type.dist_options.dist_ext
+                $action_type.dist_options.dist_plot_pdf
+
+
+        #elif $action_type.action_type_selector == 'compare_search_results':
+            rbpbench compare
+                --in 
+                #for $in_file in $action_type.input_tables:
+                    $in_file
+                #end for
+                --out ./
+                #if $action_type.compare_output_options.store_sort_js_in_html:
+                    --sort-js-mode 3
+                #else:
+                    --sort-js-mode 2
+                #end if
+
+            &&
+            sed -i 's/html_report_plots\///g' ./report.rbpbench_compare.html
+            &&
+            cp ./report.rbpbench_compare.html $compare_report_html_file
+            &&
+            mkdir '$compare_report_html_file.extra_files_path'
+            &&
+            cp -r ./html_report_plots/* '$compare_report_html_file.extra_files_path'
+
+        #end if
+
+    ]]></command>
+
+    <inputs>
+
+        <conditional name="action_type">
+        
+            <param name="action_type_selector" type="select" label="Select RBPBench program mode">
+                <option value="search_motifs" selected="true">Search RBP binding motifs in genomic regions</option>
+                <option value="batch_search_motifs">Search RBP binding motifs in genomic regions (multiple inputs)</option>
+                <option value="batch_table_search_motifs">Search RBP binding motifs in genomic regions (data collection input)</option>
+                <option value="plot_nt_dist">Plot nucleotide distribution at genomic positions</option>
+                <option value="compare_search_results">Compare different search results</option>
+            </param>
+
+            <!-- rbpbench search -->
+            <when value="search_motifs">
+                <param name="search_bed_file" type="data" format="bed" label="Genomic regions BED file"
+                       help="Genomic regions (e.g. RBP binding sites) in BED format (>= 6-columns) for RBP binding motif search"/>
+                <conditional name="reference_genome">
+                    <param label="Select reference genome sequence (according to provided BED file)" name="reference_genome_selector" type="select">
+                        <option selected="True" value="builtin">Select built-in genome sequence</option>
+                        <option value="history">Select genome sequence from history</option>
+                    </param>
+                    <when value="builtin">
+                        <param label="Select built-in genome sequence" name="builtin_genome" type="select">
+                            <options from_data_table="fasta_indexes">
+                            <filter column="2" type="sort_by" />
+                            <validator message="No genomes are available for the selected input dataset" type="no_options" />
+                            </options>
+                        </param>
+                    </when>
+                    <when value="history">
+                        <param format="fasta" type="data" name="history_genome" label="Select genome sequence in FASTA format from history"/>
+                    </when>
+                </conditional>
+                <conditional name="select_db">
+                    <param name="select_db_selector" type="select" label="Select RBP binding motif database">
+                        <option selected="True" value="default_db" >Human motif database with 259 RBPs and 605 RBP binding motifs (catrapid.omics.v2.1.human.6plus)</option>
+                        <option value="custom_db" >Provide a custom motif database</option>
+                    </param>
+                    <when value="default_db">
+                
+                        <conditional name="select_rbps">
+                            <param name="select_rbps_selector" type="select" label="Select RBPs for motif search">
+                                <option selected="True" value="list_db_rbps" >Select individual RBPs </option>
+                                <option value="all_db_rbps" >Select all 259 RBPs</option>
+                            </param>
+                            <when value="list_db_rbps">
+                                <param name="database" label="Select RBPs" type="select" multiple="true"> 
+                                    <options from_data_table='rbp_ids_table' />
+                                </param>
+                            </when>
+                            <when value="all_db_rbps">
+                                <!-- do nothing -->
+                            </when>
+                        </conditional>
+                    </when>
+                    <when value="custom_db">
+                        <param type="text" name="custom_db_id" value="custom_db_id"
+                            label="Custom motif database ID"
+                            help="Set ID / name for provided custom motif database (default: custom_db_id)"/>
+                
+                        <param type="data" format="txt,tabular" name="custom_db_info_file"
+                            label="Custom motif database info table file"
+                            help="Provide custom motif database info table file containing RBP ID -> motif ID -> motif type assignments. The motif IDs must correspond to the provided custom MEME / DREME XML and/or covariance models file(s)."/>
+                
+                        <param type="data" format="memexml" name="custom_db_meme_xml_file" optional="True"
+                            label="Custom motif database MEME / DREME XML file"
+                            help="Provide custom motif database MEME / DREME XML file containing sequence motifs"/>
+                
+                        <param type="data" format="cm" name="custom_db_cm_model_file" optional="True"
+                            label="Custom motif database covariance models file"
+                            help="Provide custom motif database covariance models file containing structure motif(s) (i.e., covariance model(s))"/>
+                
+                        <param name="custom_db_rbp_ids_list" type="text" value="RBP1 RBP2 RBP3"
+                            label="Specify RBP IDs from custom motif database"
+                            help="Provide list of RBP IDs found in custom motif database to use for motif search. This can be a single ID, as well as several (separated by spaces, as in the example). To search using all RBPs in the custom database, simply type ALL."/>
+                    </when>
+                </conditional>
+
+                <conditional name="user_rbp">
+                    <param label="Add user-supplied motifs" name="user_rbp_selector" type="select">
+                        <option selected="True" value="no">No</option>
+                        <option value="sequence">Yes (MEME/DREME XML based sequence motif(s))</option>
+                        <option value="structure">Yes (Covariance model based structure motif(s))</option>
+                    </param>
+                    <when value="sequence">
+                        <param format="memexml" type="data" name="meme_motifs_xml" 
+                            label="DREME or MEME motifs XML file"
+                            help="DREME or MEME output XML file containing sequence motif(s)"/>
+                        <param type="text" name="seq_rbp_id" value="User_RBP"
+                            label="RBP ID"
+                            help="RBP ID (RBP name) for provided sequence motif(s). Make sure to provide user RBP IDs and motif IDs that are different from selected database RBP and motif IDs."/>
+                    </when>
+                    <when value="structure">
+                        <param format="cm" type="data" name="cm_model_file" 
+                            label="Covariance models file"
+                            help="Covariance models file containing structure motif(s)"/>
+                        <param type="text" name="str_rbp_id" value="User_RBP"
+                            label="RBP ID"
+                            help="RBP ID (RBP name) for provided structure motif(s). Make sure to provide user RBP IDs and motif IDs that are different from selected database RBP and motif IDs."/>
+                    </when>
+                    <when value="no">
+                        <!-- do nothing -->
+                    </when>
+                </conditional>
+
+                <param type="text" name="search_method_id" value="method_id"
+                    label="Method ID"
+                    help="Method ID which can be used to describe the peak calling method (e.g. clipper_idr). This ID (together with data ID and set RBP ID(s)) defines which search results get compared in RBPBench's comparison mode (see Help below for more details)."/>
+                <param type="text" name="search_data_id" value="data_id"
+                    label="Data ID"
+                    help="Data ID which can be used to describe from which cell type and/or CLIP-seq protocol the data originates (e.g. k562_eclip or pum2_k562_eclip). This ID (together with method ID and set RBP ID(s)) defines which search results get compared in RBPBench's comparison mode (see Help below for more details)."/>
+
+                <section name="search_options" title="Motif search settings">
+                    <param name="search_ext" type="text" value="0"
+                        label="Up- and downstream extension of genomic regions"
+                        help='Up- and downstream extension of genomic regions in nucleotides (nt). E.g. set to "30" to extend 30 nt on both sides, or "20,10" for different up- and downstream extension (default: 0)'/>
+                    <param name="search_fimo_pval" type="float" value="0.001"
+                        label="FIMO p-value threshold"
+                        help='FIMO p-value threshold (FIMO option: --thresh) for reporting motif hits (default: 0.001)'/>
+                    <param name="search_bed_score_col" type="integer" value="5"
+                        label="BED score column used for p-value calculations"
+                        help="Score column of genomic regions BED file used for p-value calculations. BED score can be e.g. log2 fold change or -log10 p-value of the region (default: 5)"/>
+                    <param name="search_unstranded" label="Treat genomic regions in BED file as NOT strand-specific" type="boolean"
+                        truevalue="--unstranded" falsevalue="" checked="False"
+                        help="Set if genomic regions in BED file are NOT strand-specific, i.e., to look for motifs on both strands of the provided regions. Note that the two strands of a region will still be counted as one region (change with option below) (default: False)"/>
+                    <param name="search_unstranded_ct" label="Count each genomic region twice for RBP hit statistics" type="boolean"
+                        truevalue="--unstranded-ct" falsevalue="" checked="False"
+                        help="Count each genomic region twice for RBP hit statistics when non-strand-specific option above is enabled (default: False)"/>
+                    <param format="txt" type="data" name="fimo_nt_freqs_file" optional="True"
+                        label="Provide FIMO nucleotide frequencies file"
+                        help="Provide FIMO nucleotide frequencies (FIMO option: --bifile) file. By default, an internal frequencies file optimized for human transcripts is used"/>
+                </section>
+
+                <section name="report_plotting_options" title="HTML report options">
+
+                    <param format="gtf" type="data" name="gtf_file" optional="True"
+                        label="GTF file to add genomic annotations to input regions"
+                        help="Provide GTF file with genomic annotations to add to HTML report plots (e.g. from GENCODE or Ensembl). By default, the most prominent transcripts will be extracted and used for functional annotation. Alternatively, provide a list of expressed transcripts via --tr-list option (together with --gtf containing the transcripts). Note that currently only features on standard chromosomes (1,2,..,X,Y,MT) are used for annotation"/>
+                    <param format="txt" type="data" name="tr_list_file" optional="True"
+                        label="Transcript IDs file"
+                        help="Supply file with transcript IDs (one ID per row) to define which transcripts to use from GTF file for adding functional annotations to HTML report plots"/>
+                    <param name="list_tr_biotypes" type="text" optional="True"
+                        label="List of transcript biotypes"
+                        help="List of transcript biotypes to consider from GTF file. By default an internal selection of transcript biotypes is used (in addition to intron, CDS, UTR, intergenic). Provide a list of IDs separated by spaces. Note that provided biotype IDs need to be in GTF file!"/>
+
+                    <param name="upset_plot_min_degree" type="integer" value="2"
+                        label="Upset plot minimum degree parameter"
+                        help="Upset plot minimum degree parameter for HTML report upset plot. This defines the minimum number of RBPs for a combination to be included (default: 2)"/>
+                    <param name="upset_plot_max_degree" type="integer" value="" optional="True"
+                        label="Upset plot maximum degree parameter"
+                        help="Upset plot maximum degree parameter for HTML report upset plot. By default no maximum degree is set. Useful together with minimum degree to look at specific degrees (e.g. only 2, or between 2 and 3) (default: None)"/>
+                    <param name="upset_plot_min_subset_size" type="integer" value="5"
+                        label="Upset plot minimum subset size parameter"
+                        help="Upset plot minimum subset size parameter for HTML report upset plot. This defines the minimum number of hits for a specific RBP combination to be included (default: 5)"/>
+
+                    <param type="text" name="set_rbp_id" optional="True"
+                        label="Set reference RBP ID for plotting motif distances"
+                        help="Set reference RBP ID to plot motif distances relative to motifs from this RBP (--set-rbp-id). Motif plot will be centered on best scoring motif of the RBP for each region. Note that set RBP ID needs to be one of the above selected RBP IDs!"/>
+                    <param name="motif_distance_plot_range" type="integer" value="60"
+                        label="BED score column used for p-value calculations"
+                        help="Set range of motif distance plot. I.e., centered on the set RBP (--set-rbp-id) motifs, motifs within minus and plus --motif-distance-plot-range will be plotted (default: 60)"/>
+                    <param name="motif_min_pair_count" type="integer" value="10"
+                        label="Motif co-occurrence minimum pair count"
+                        help="Minimum count of co-occurrences of a motif with set RBP ID (--set-rbp-id) motif to be reported and plotted (default: 10)"/>
+                    <param name="rbp_min_pair_count" type="integer" value="10"
+                        label="RBP co-occurrence minimum pair count"
+                        help="Minimum amount of co-occurrences of motifs for an RBP ID compared to set RBP ID (--set-rbp-id) motifs to be reported and plotted (default: 10)"/>
+
+                    <param name="store_sort_js_in_html" label="Store JS code for table sorting inside HTML?" 
+                        type="boolean" checked="False"
+                        help="Store JavaScript code for table sorting inside output HTML files. By default code is stored locally in extra file located in HTML output folder."/>
+                    <param name="plotly_js_source" type="integer" value="1" min="1" max="3"
+                        label="Specify plotly JS code source"
+                        help="1: Store plotly JavaScript code locally inside HTML output folder. 2: Add hyperlink to report HTML file (internet connection required). 3: Store code inside report HTML file (default: 1)"/>
+                    <param name="plotly_plot_code_in_html" label="Store plotly plotting code inside HTML?" 
+                        type="boolean" checked="False"
+                        help="Store plotly plotting code inside HTML. By default code is stored in separate HTML files in HTML report output folder."/>
+
+                </section>
+
+                <section name="search_output_options" title="Output options">
+                    <param name="search_report" label="Output HTML report?" type="boolean"
+                        truevalue="--report" falsevalue="" checked="True"
+                        help="Generate an HTML report containing RBP co-occurrence + combination + distance statistics and plots (default: True)"/>
+                    <param name="search_plot_motifs" label="Plot RBP motifs?" type="boolean"
+                        truevalue="--plot-motifs" falsevalue="" checked="False"
+                        help="Visualize selected RBP motifs, by outputting sequence logos and motif hit statistics into a separate HTML file (default: False)"/>
+                    <param name="sites_bed_fasta_out" label="Output filtered genomic regions BED + FASTA files" type="boolean"
+                        checked="False"
+                        help="Output filtered genomic regions BED/FASTA file used for motif search. Filtered means that the actual regions used for motif search can differ from the input genomic regions, e.g. through default filtering by chromsome ID (only regions with valid IDs), removal of duplicated regions, or through optional extension of the regions"/>
+                    <param name="motif_hits_bed_out" label="Output motif hits BED file" type="boolean"
+                        checked="False"
+                        help="Output motif hits BED file containing motif hits in provided genomic regions for selected RBPs"/>
+                    <param name="contingency_table_out" label="Output contingency table containing co-occurrence p-values" type="boolean"
+                        checked="False"
+                        help="Output contingency table containing co-occurrence p-values (Fisher's exact test) between each RBP pair (see manual for more information)"/>
+                    <param name="region_annotations_out" label="Output genomic region annotations table file?" 
+                        type="boolean" checked="False"
+                        help="Output genomic region annotations table file containing assigned annotations for each BED input region. Note that a GTF file has to be provided (default: False)"/>
+                </section>
+            </when>
+
+            <!-- rbpbench batch -->
+            <when value="batch_search_motifs">
+                <repeat name="dataset_inputs" min="1" title="Dataset">
+                    <param name="dataset_bed_file" type="data" format="bed"
+                        label="Genomic regions BED file"
+                        help="Genomic regions (e.g. RBP binding sites) in BED format (>= 6-columns) for RBP binding motif search"/>
+                    <param name="dataset_rbp_id" label="Select RBP for motif search" type="select">
+                        <options from_data_table='rbp_ids_table' />
+                    </param>
+                    <param type="text" name="dataset_method_id" value="method_id"
+                        label="Method ID"
+                        help="Method ID which can be used to describe the peak calling method (e.g. clipper_idr). This ID (together with data ID and set RBP ID) defines which search results get compared in RBPBench's comparison mode (see Help below for more details)."/>
+                    <param type="text" name="dataset_data_id" value="data_id"
+                        label="Data ID"
+                        help="Data ID which can be used to describe from which cell type and/or CLIP-seq protocol the data originates (e.g. k562_eclip or pum2_k562_eclip). This ID (together with method ID set RBP ID) defines which search results get compared in RBPBench's comparison mode (see Help below for more details)."/>
+                </repeat>
+
+                <conditional name="reference_genome">
+                    <param label="Select reference genome sequence (according to the provided BED files)" name="reference_genome_selector" type="select">
+                        <option selected="True" value="builtin">Select built-in genome sequence</option>
+                        <option value="history">Select genome sequence from history</option>
+                    </param>
+                    <when value="builtin">
+                        <param label="Select built-in genome sequence" name="builtin_genome" type="select">
+                            <options from_data_table="fasta_indexes">
+                            <filter column="2" type="sort_by" />
+                            <validator message="No genomes are available for the selected input dataset" type="no_options" />
+                            </options>
+                        </param>
+                    </when>
+                    <when value="history">
+                        <param format="fasta" type="data" name="history_genome" label="Select genome sequence in FASTA format from history"/>
+                    </when>
+                </conditional>
+
+                <section name="search_options" title="Motif search settings">
+                    <param name="search_ext" type="text" value="0"
+                        label="Up- and downstream extension of genomic regions"
+                        help='Up- and downstream extension of genomic regions in nucleotides (nt). E.g. set to "30" to extend 30 nt on both sides, or "20,10" for different up- and downstream extension (default: 0)'/>
+                    <param name="search_fimo_pval" type="float" value="0.001"
+                        label="FIMO p-value threshold"
+                        help='FIMO p-value threshold (FIMO option: --thresh) for reporting motif hits (default: 0.001)'/>
+                    <param name="search_bed_score_col" type="integer" value="5"
+                        label="BED score column used for p-value calculations"
+                        help="Score column of genomic regions BED files used for p-value calculations. BED score can be e.g. log2 fold change or -log10 p-value of the region (default: 5)"/>
+                    <param name="search_unstranded" label="Treat genomic regions in BED file as NOT strand-specific" type="boolean"
+                        truevalue="--unstranded" falsevalue="" checked="False"
+                        help="Set if genomic regions in BED files are NOT strand-specific, i.e., to look for motifs on both strands of the provided regions. Note that the two strands of a region will still be counted as one region (change with option below) (default: False)"/>
+                    <param name="search_unstranded_ct" label="Count each genomic region twice for RBP hit statistics" type="boolean"
+                        truevalue="--unstranded-ct" falsevalue="" checked="False"
+                        help="Count each genomic region twice for RBP hit statistics when non-strand-specific option above is enabled (default: False)"/>
+                    <param format="txt" type="data" name="fimo_nt_freqs_file" optional="True"
+                        label="Provide FIMO nucleotide frequencies file"
+                        help="Provide FIMO nucleotide frequencies (FIMO option: --bifile) file. By default, an internal frequencies file optimized for human transcripts is used"/>
+                    </section>
+
+                <section name="search_output_options" title="Output options">
+                    <param name="batch_motif_hits_bed_out" label="Output motif hits BED file" type="boolean"
+                               checked="False"
+                               help="Output motif hits BED file containing motif hits for all input datasets"/>
+                </section>
+
+            </when>
+
+            <!-- rbpbench batch data collection + table -->
+            <when value="batch_table_search_motifs">
+
+                <param name="batch_table_bed_collection" type="data_collection" collection_type="list" format="bed"
+                       label="Data collection containing genomic regions BED files"
+                       help="Data collection containing genomic regions BED files to be processed. Note that dataset names inside collection must correspond to names given in the batch processing table file below"/>
+
+                <param name="batch_table_file" type="data" format="txt,tabular"
+                    label="Provide batch processing table file"
+                    help="Provide batch processing table file with one row for each batch job. Each row contains the tab-delimited information: RBP ID (RBP name), method ID, data ID, dataset name. The dataset name must be present in the supplied data collection of BED files"/>
+
+                <conditional name="reference_genome">
+                    <param label="Select reference genome sequence (according to the provided BED files)" name="reference_genome_selector" type="select">
+                        <option selected="True" value="builtin">Select built-in genome sequence</option>
+                        <option value="history">Select genome sequence from history</option>
+                    </param>
+                    <when value="builtin">
+                        <param label="Select built-in genome sequence" name="builtin_genome" type="select">
+                            <options from_data_table="fasta_indexes">
+                            <filter column="2" type="sort_by" />
+                            <validator message="No genomes are available for the selected input dataset" type="no_options" />
+                            </options>
+                        </param>
+                    </when>
+                    <when value="history">
+                        <param format="fasta" type="data" name="history_genome" label="Select genome sequence in FASTA format from history"/>
+                    </when>
+                </conditional>
+
+                <section name="search_options" title="Motif search settings">
+                    <param name="search_ext" type="text" value="0"
+                        label="Up- and downstream extension of genomic regions"
+                        help='Up- and downstream extension of genomic regions in nucleotides (nt). E.g. set to "30" to extend 30 nt on both sides, or "20,10" for different up- and downstream extension (default: 0)'/>
+                    <param name="search_fimo_pval" type="float" value="0.001"
+                        label="FIMO p-value threshold"
+                        help='FIMO p-value threshold (FIMO option: --thresh) for reporting motif hits (default: 0.001)'/>
+                    <param name="search_bed_score_col" type="integer" value="5"
+                        label="BED score column used for p-value calculations"
+                        help="Score column of genomic regions BED files used for p-value calculations. BED score can be e.g. log2 fold change or -log10 p-value of the region (default: 5)"/>
+                    <param name="search_unstranded" label="Treat genomic regions in BED file as NOT strand-specific" type="boolean"
+                        truevalue="--unstranded" falsevalue="" checked="False"
+                        help="Set if genomic regions in BED files are NOT strand-specific, i.e., to look for motifs on both strands of the provided regions. Note that the two strands of a region will still be counted as one region (change with option below) (default: False)"/>
+                    <param name="search_unstranded_ct" label="Count each genomic region twice for RBP hit statistics" type="boolean"
+                        truevalue="--unstranded-ct" falsevalue="" checked="False"
+                        help="Count each genomic region twice for RBP hit statistics when non-strand-specific option above is enabled (default: False)"/>
+                    <param format="txt" type="data" name="fimo_nt_freqs_file" optional="True"
+                        label="Provide FIMO nucleotide frequencies file"
+                        help="Provide FIMO nucleotide frequencies (FIMO option: --bifile) file. By default, an internal frequencies file optimized for human transcripts is used"/>
+                    </section>
+
+                <section name="search_output_options" title="Output options">
+                    <param name="batch_table_motif_hits_bed_out" label="Output motif hits BED file" type="boolean"
+                               checked="False"
+                               help="Output motif hits BED file containing motif hits for all input datasets"/>
+                </section>
+
+            </when>
+
+            <!-- rbpbench dist -->
+            <when value="plot_nt_dist">
+
+                <param name="dist_bed_file" type="data" format="bed"
+                       label="Genomic regions BED file"
+                       help="Genomic regions (e.g. RBP binding sites) in BED format. Zero position for plotting can be defined in options"/>
+
+                <conditional name="reference_genome">
+                    <param label="Select reference genome sequence (according to BED file)" name="reference_genome_selector" type="select">
+                    <option selected="True" value="history">Select genome sequence from history</option>
+                    <option value="builtin">Select built-in genome sequence</option>
+                    </param>
+                    <when value="history">
+                        <param format="fasta" type="data" name="history_genome" label="Select genome sequence in FASTA format from history"/>
+                    </when>
+                    <when value="builtin">
+                        <param label="Select built-in genome sequence" name="builtin_genome" type="select">
+                            <options from_data_table="fasta_indexes">
+                            <filter column="2" type="sort_by" />
+                            <validator message="No genomes are available for the selected input dataset" type="no_options" />
+                            </options>
+                        </param>
+                    </when>
+                </conditional>
+
+                <section name="dist_options" title="Nucleotide distribution plot settings">
+                    <param name="dist_cp_mode" type="integer" value="1" min="1" max="3"
+                            label="Define zero position for plotting"
+                            help="Define which position of genomic sites to use as zero position for plotting. 1: upstream end position, 2: center position, 3: downstream end position (default: 1)"/>
+                    <param name="dist_ext" type="integer" value="10"
+                           label="Up- and downstream extension of defined genomic positions"
+                           help="Up- and downstream extension of defined genomic positions in nucleotides (nt) to include in plotting (default: 10)"/>
+                    <param name="dist_plot_pdf" label="Plot as PDF?" type="boolean"
+                        truevalue="--plot-pdf" falsevalue="" checked="False"
+                        help="Plot nucleotide distribution as PDF (default: PNG)"/>
+                    <param name="sites_bed_fasta_out" label="Output genomic regions BED + FASTA files" type="boolean"
+                               checked="False"
+                               help="Output genomic regions BED/FASTA file used for plotting"/>
+                </section>
+
+            </when>
+
+            <!-- rbpbench compare -->
+            <when value="compare_search_results">
+
+                <param name="input_tables" type="data" format="tabular" multiple="true"
+                    label="Motif search results"
+                    help="Supply motif search results table files for comparison. These are the hit statistics table files output by single or batch motif search jobs. Both RBP and motif hit statistics table files are needed, and can be from any single or batch search job."/>
+
+                <section name="compare_output_options" title="Output options">
+                    <param name="compared_motif_hits_table" label="Output compared motif hits table file" type="boolean"
+                        checked="False"
+                        help="Output compared motif hits table file showing motif hits and which data or method IDs contain them"/>
+                    <param name="compared_motif_hits_bed" label="Output compared motif hits BED file" type="boolean"
+                        checked="False"
+                        help="Output compared motif hits table file showing motif hits and which data or method IDs contain them in BED format"/>
+                    <param name="comparisons_stats_out" label="Output comparison statistics table file" type="boolean"
+                        checked="False"
+                        help="Output comparison statistics table file containing the statistics found in the comparison HTML report"/>
+                    <param name="store_sort_js_in_html" label="Store JS code for table sorting inside HTML?" 
+                        type="boolean" checked="False"
+                        help="Store JavaScript code for table sorting inside output HTML files. By default code is stored locally in extra file located in HTML output folder."/>
+                </section>
+            </when>
+
+        </conditional>
+
+    </inputs>
+
+    <outputs>
+
+        <!-- rbpbench search outputs -->
+        <data name="rbp_hit_stats_file" format="tabular" from_work_dir="rbp_hit_stats.tsv" label="${tool.name} on ${on_string}: RBP hit statistics table file">
+            <filter>action_type["action_type_selector"] == "search_motifs"</filter>
+        </data>
+        <data name="motif_hit_stats_file" format="tabular" from_work_dir="motif_hit_stats.tsv" label="${tool.name} on ${on_string}: Motif hit statistics table file">
+            <filter>action_type["action_type_selector"] == "search_motifs"</filter>
+        </data>
+        <data name="search_report_html_file" format="html" from_work_dir="report.rbpbench_search.html" label="${tool.name} on ${on_string}: Search report HTML file">
+            <filter>action_type["action_type_selector"] == "search_motifs" and action_type["search_output_options"]["search_report"]</filter>
+        </data>
+        <data name="motif_plots_html_file" format="html" from_work_dir="motif_plots.rbpbench_search.html" label="${tool.name} on ${on_string}: Motif plots HTML file">
+            <filter>action_type["action_type_selector"] == "search_motifs" and action_type["search_output_options"]["search_plot_motifs"]</filter>
+        </data>
+        <data name="in_sites_bed_file" format="bed" from_work_dir="in_sites.filtered.bed" label="${tool.name} on ${on_string}: Genomic regions used for motif search BED file">
+            <filter>action_type["action_type_selector"] == "search_motifs" and action_type["search_output_options"]["sites_bed_fasta_out"]</filter>
+        </data>
+        <data name="in_sites_fa_file" format="fasta" from_work_dir="in_sites.filtered.fa" label="${tool.name} on ${on_string}: Genomic regions used for motif search FASTA file">
+            <filter>action_type["action_type_selector"] == "search_motifs" and action_type["search_output_options"]["sites_bed_fasta_out"]</filter>
+        </data>
+        <data name="motif_hits_bed_file" format="bed" from_work_dir="motif_hits.rbpbench_search.bed" label="${tool.name} on ${on_string}: Motif hits on genomic regions BED file">
+            <filter>action_type["action_type_selector"] == "search_motifs" and action_type["search_output_options"]["motif_hits_bed_out"]</filter>
+        </data>
+        <data name="contingency_table_file" format="tabular" from_work_dir="contingency_table_results.tsv" label="${tool.name} on ${on_string}: RBP co-occurrence contingency table file">
+            <filter>action_type["action_type_selector"] == "search_motifs" and action_type["search_output_options"]["contingency_table_out"]</filter>
+        </data>
+        <data name="region_annotations_file" format="tabular" from_work_dir="region_annotations.tsv" label="${tool.name} on ${on_string}: genomic region annotations table file">
+            <filter>action_type["action_type_selector"] == "search_motifs" and action_type["search_output_options"]["region_annotations_out"] and action_type["report_plotting_options"]["gtf_file"]</filter>
+        </data>
+
+        <!-- rbpbench batch outputs -->
+        <data name="batch_rbp_hit_stats_file" format="tabular" from_work_dir="rbp_hit_stats.tsv" label="${tool.name} on ${on_string}: Batch RBP hit statistics table file">
+            <filter>action_type["action_type_selector"] == "batch_search_motifs"</filter>
+        </data>
+        <data name="batch_motif_hit_stats_file" format="tabular" from_work_dir="motif_hit_stats.tsv" label="${tool.name} on ${on_string}: Batch motif hit statistics table file">
+            <filter>action_type["action_type_selector"] == "batch_search_motifs"</filter>
+        </data>
+        <data name="batch_motif_hits_bed_file" format="bed" from_work_dir="motif_hits.rbpbench_batch.bed" label="${tool.name} on ${on_string}: Batch motif hits on genomic regions BED files">
+            <filter>action_type["action_type_selector"] == "batch_search_motifs" and action_type["search_output_options"]["batch_motif_hits_bed_out"]</filter>
+        </data>
+
+        <!-- rbpbench batch table outputs -->
+        <data name="batch_table_rbp_hit_stats_file" format="tabular" from_work_dir="rbp_hit_stats.tsv" label="${tool.name} on ${on_string}: Batch data collection RBP hit statistics table file">
+            <filter>action_type["action_type_selector"] == "batch_table_search_motifs"</filter>
+        </data>
+        <data name="batch_table_motif_hit_stats_file" format="tabular" from_work_dir="motif_hit_stats.tsv" label="${tool.name} on ${on_string}: Batch data collection motif hit statistics table file">
+            <filter>action_type["action_type_selector"] == "batch_table_search_motifs"</filter>
+        </data>
+        <data name="batch_table_motif_hits_bed_file" format="bed" from_work_dir="motif_hits.rbpbench_batch.bed" label="${tool.name} on ${on_string}: Motif hits on genomic regions BED files from data collection">
+            <filter>action_type["action_type_selector"] == "batch_table_search_motifs" and action_type["search_output_options"]["batch_table_motif_hits_bed_out"]</filter>
+        </data>
+
+        <!-- rbpbench dist outputs -->
+        <data name="nt_dist_plot_png_file" format="png" from_work_dir="nt_dist_zero_pos.png" label="${tool.name} on ${on_string}: Nucleotide distribution plot PNG file">
+            <filter>action_type["action_type_selector"] == "plot_nt_dist" and not action_type["dist_options"]["dist_plot_pdf"]</filter>
+        </data>
+        <data name="nt_dist_plot_pdf_file" format="pdf" from_work_dir="nt_dist_zero_pos.pdf" label="${tool.name} on ${on_string}: Nucleotide distribution plot PDF file">
+            <filter>action_type["action_type_selector"] == "plot_nt_dist" and action_type["dist_options"]["dist_plot_pdf"]</filter>
+        </data>
+        <data name="plot_sites_bed_file" format="bed" from_work_dir="in_sites.filtered.bed" label="${tool.name} on ${on_string}: Genomic regions used for plotting BED file">
+            <filter>action_type["action_type_selector"] == "plot_nt_dist" and action_type["dist_options"]["sites_bed_fasta_out"]</filter>
+        </data>
+        <data name="plot_sites_fa_file" format="fasta" from_work_dir="in_sites.filtered.fa" label="${tool.name} on ${on_string}: Genomic regions used for plotting FASTA file">
+            <filter>action_type["action_type_selector"] == "plot_nt_dist" and action_type["dist_options"]["sites_bed_fasta_out"]</filter>
+        </data>
+
+        <!-- rbpbench compare outputs -->
+        <data name="compare_report_html_file" format="html" from_work_dir="report.rbpbench_compare.html" label="${tool.name} on ${on_string}: Comparison report HTML file">
+            <filter>action_type["action_type_selector"] == "compare_search_results"</filter>
+        </data>
+        <data name="compared_motif_hits_bed_file" format="bed" from_work_dir="motif_hits.rbpbench_compare.bed" label="${tool.name} on ${on_string}: Compared motif hits BED file">
+            <filter>action_type["action_type_selector"] == "compare_search_results" and action_type["compare_search_results"]["compared_motif_hits_bed"]</filter>
+        </data>
+        <data name="compared_motif_hits_table_file" format="tabular" from_work_dir="motif_hits.rbpbench_compare.tsv" label="${tool.name} on ${on_string}: Compared motif hits table file">
+            <filter>action_type["action_type_selector"] == "compare_search_results" and action_type["compare_search_results"]["compared_motif_hits_table"]</filter>
+        </data>
+        <data name="compared_stats_table_file" format="tabular" from_work_dir="comparison_stats.rbpbench_compare.tsv" label="${tool.name} on ${on_string}: Comparison statistics table file">
+            <filter>action_type["action_type_selector"] == "compare_search_results" and action_type["compare_search_results"]["comparisons_stats_out"]</filter>
+        </data>
+
+    </outputs>
+
+    <tests>
+
+        <!-- rbpbench search tests -->
+        <test expect_num_outputs="7">
+            <param name="action_type_selector" value="search_motifs"/>
+            <param name="reference_genome_selector" value="history" />
+            <param name="history_genome" value="test.fa" />
+            <param name="search_bed_file" value="test.bed" ftype="bed"/>
+            <param name="select_rbps_selector" value="list_db_rbps"/>
+            <param name="database" value="PUM1,PUM2" />
+            <param name="search_report" value="True"/>
+            <param name="search_plot_motifs" value="False"/>
+            <param name="sites_bed_fasta_out" value="True"/>
+            <param name="motif_hits_bed_out" value="True"/>
+            <param name="contingency_table_out" value="True"/>
+            <output name="rbp_hit_stats_file" file="rbp_hit_stats.rbpbench_search.tsv" compare="sim_size"/>
+            <output name="motif_hit_stats_file" file="motif_hit_stats.rbpbench_search.tsv" compare="sim_size"/>
+            <output name="search_report_html_file" file="report.rbpbench_search.html" compare="sim_size"/>
+            <output name="in_sites_bed_file" file="in_sites.filtered.rbpbench_search.bed"/>
+            <output name="in_sites_fa_file" file="in_sites.filtered.rbpbench_search.fa"/>
+            <output name="motif_hits_bed_file" file="motif_hits.rbpbench_search.bed"/>
+            <output name="contingency_table_file" file="contingency_table_results.rbpbench_search.tsv"/>
+        </test>
+        <!-- test builtin fasta -->
+        <test expect_num_outputs="7">
+            <param name="action_type_selector" value="search_motifs"/>
+            <param name="reference_genome_selector" value="builtin" />
+            <param name="builtin_genome" value="testid" />
+            <param name="search_bed_file" value="test.bed" ftype="bed"/>
+            <param name="select_rbps_selector" value="list_db_rbps"/>
+            <param name="database" value="PUM1,PUM2" />
+            <param name="search_report" value="True"/>
+            <param name="search_plot_motifs" value="False"/>
+            <param name="sites_bed_fasta_out" value="True"/>
+            <param name="motif_hits_bed_out" value="True"/>
+            <param name="contingency_table_out" value="True"/>
+            <output name="rbp_hit_stats_file" file="rbp_hit_stats.rbpbench_search.tsv" compare="sim_size"/>
+            <output name="motif_hit_stats_file" file="motif_hit_stats.rbpbench_search.tsv" compare="sim_size"/>
+            <output name="search_report_html_file" file="report.rbpbench_search.html" compare="sim_size"/>
+            <output name="in_sites_bed_file" file="in_sites.filtered.rbpbench_search.bed"/>
+            <output name="in_sites_fa_file" file="in_sites.filtered.rbpbench_search.fa"/>
+            <output name="motif_hits_bed_file" file="motif_hits.rbpbench_search.bed"/>
+            <output name="contingency_table_file" file="contingency_table_results.rbpbench_search.tsv"/>
+        </test>
+
+        <test expect_num_outputs="2">
+            <param name="action_type_selector" value="search_motifs"/>
+            <param name="reference_genome_selector" value="history" />
+            <param name="history_genome" value="test.slbp_user.fa" />
+            <param name="search_bed_file" value="test.slbp_user.bed" ftype="bed"/>
+            <param name="user_rbp_selector" value="structure"/>
+            <param name="cm_model_file" value="SLBP_USER.cm" />
+            <param name="str_rbp_id" value="SLBP_USER" />
+            <param name="search_report" value="False"/>
+            <output name="rbp_hit_stats_file" file="rbp_hit_stats.rbpbench_search.slbp_user.tsv" compare="sim_size"/>
+            <output name="motif_hit_stats_file" file="motif_hit_stats.rbpbench_search.slbp_user.tsv" compare="sim_size"/>
+        </test>
+        <test expect_num_outputs="3">
+            <param name="action_type_selector" value="search_motifs"/>
+            <param name="reference_genome_selector" value="history" />
+            <param name="history_genome" value="test.fa" />
+            <param name="search_bed_file" value="test.bed" ftype="bed"/>
+            <param name="select_db_selector" value="default_db"/>
+            <param name="select_rbps_selector" value="all_db_rbps"/>
+            <param name="search_report" value="False"/>
+            <param name="search_plot_motifs" value="False"/>
+            <param name="sites_bed_fasta_out" value="False"/>
+            <param name="motif_hits_bed_out" value="True"/>
+            <param name="contingency_table_out" value="False"/>
+            <output name="motif_hits_bed_file" file="motif_hits.rbpbench_search.test_all.bed"/>
+        </test>
+        <test expect_num_outputs="4">
+            <param name="action_type_selector" value="search_motifs"/>
+            <param name="reference_genome_selector" value="history" />
+            <param name="history_genome" value="test.fa" />
+            <param name="search_bed_file" value="test.bed" ftype="bed"/>
+            <param name="gtf_file" value="test_search.gtf" ftype="gtf"/>
+            <param name="select_db_selector" value="default_db"/>
+            <param name="select_rbps_selector" value="all_db_rbps"/>
+            <param name="search_report" value="True"/>
+            <param name="search_plot_motifs" value="False"/>
+            <param name="sites_bed_fasta_out" value="False"/>
+            <param name="motif_hits_bed_out" value="False"/>
+            <param name="contingency_table_out" value="False"/>
+            <param name="region_annotations_out" value="True"/>
+            <output name="region_annotations_file" file="test_search_gtf.region_annotations.tsv"/>
+        </test>
+        <test expect_num_outputs="3">
+            <param name="action_type_selector" value="search_motifs"/>
+            <param name="reference_genome_selector" value="history" />
+            <param name="history_genome" value="test.fa" />
+            <param name="search_bed_file" value="test.bed" ftype="bed"/>
+            <param name="select_db_selector" value="custom_db"/>
+            <param name="custom_db_id" value="custom_yo" />
+            <param name="custom_db_info_file" value="test_custom.info.txt" />
+            <param name="custom_db_meme_xml_file" value="test_custom.seq_motifs.meme" />
+            <param name="custom_db_cm_model_file" value="test_custom.str_motifs.cm" />
+            <param name="custom_db_rbp_ids_list" value="PUM1 PUM2 SLBP" />
+            <param name="search_report" value="False"/>
+            <param name="search_plot_motifs" value="False"/>
+            <param name="sites_bed_fasta_out" value="False"/>
+            <param name="motif_hits_bed_out" value="True"/>
+            <param name="contingency_table_out" value="False"/>
+            <param name="region_annotations_out" value="False"/>
+            <output name="motif_hits_bed_file" file="test_custom.motif_hits.rbpbench_search.bed"/>
+        </test>
+
+        <!-- rbpbench batch tests -->
+        <test expect_num_outputs="3">
+            <param name="action_type_selector" value="batch_search_motifs"/>
+            <param name="reference_genome_selector" value="history" />
+            <param name="history_genome" value="test.fa" />
+            <repeat name="dataset_inputs">
+                <param name="dataset_bed_file" value="test.bed"/>
+                <param name="dataset_method_id" value="method-id1" />
+                <param name="dataset_data_id" value="data-id1" />
+                <param name="dataset_rbp_id" value="PUM1" />
+            </repeat>
+            <repeat name="dataset_inputs">
+                <param name="dataset_bed_file" value="test.bed"/>
+                <param name="dataset_method_id" value="method-id2" />
+                <param name="dataset_data_id" value="data-id2" />
+                <param name="dataset_rbp_id" value="PUM2" />
+            </repeat>
+            <param name="batch_motif_hits_bed_out" value="True"/>
+            <output name="batch_rbp_hit_stats_file" file="rbp_hit_stats.test_batch.tsv" compare="sim_size"/>
+            <output name="batch_motif_hit_stats_file" file="motif_hit_stats.test_batch.tsv" compare="sim_size"/>
+            <output name="batch_motif_hits_bed_file" file="motif_hits.rbpbench_batch.test_batch.bed"/>
+        </test>
+
+        <!-- rbpbench batch table tests -->
+        <test expect_num_outputs="3">
+            <param name="action_type_selector" value="batch_table_search_motifs"/>
+            <param name="reference_genome_selector" value="history" />
+            <param name="history_genome" value="test.fa" />
+            <param name="batch_table_bed_collection">
+                <collection type="list">
+                    <element name="test1.bed" value="test1.bed"/>
+                    <element name="test2.bed" value="test2.bed"/>
+                </collection>
+            </param>
+            <param name="batch_table_file" value="test_table.txt"/>
+            <param name="batch_table_motif_hits_bed_out" value="True"/>
+            <output name="batch_table_rbp_hit_stats_file" file="rbp_hit_stats.table_test.tsv" compare="sim_size"/>
+            <output name="batch_table_motif_hit_stats_file" file="motif_hit_stats.table_test.tsv" compare="sim_size"/>
+            <output name="batch_table_motif_hits_bed_file" file="motif_hits.rbpbench_batch.table_test.bed"/>
+        </test>
+
+        <!-- rbpbench compare tests -->
+        <test expect_num_outputs="4">
+            <param name="action_type_selector" value="compare_search_results"/>
+            <param name="input_tables" value="rbp_hit_stats.compare_test.dewseq.tsv,rbp_hit_stats.compare_test.clipper_idr.tsv,motif_hit_stats.compare_test.dewseq.tsv,motif_hit_stats.compare_test.clipper_idr.tsv" ftype="tabular" />
+            <param name="compared_motif_hits_table" value="True"/>
+            <param name="compared_motif_hits_bed" value="True"/>
+            <param name="comparisons_stats_out" value="True"/>
+            <output name="compare_report_html_file" file="report.rbpbench_compare.test.html" compare="sim_size"/>
+            <output name="compared_motif_hits_bed_file" file="motif_hits.rbpbench_compare.test.bed"/>
+            <output name="compared_motif_hits_table_file" file="motif_hits.rbpbench_compare.test.tsv"/>
+            <output name="compared_stats_table_file" file="comparison_stats.rbpbench_compare.test.tsv"/>
+        </test>
+
+    </tests>
+    <help><![CDATA[
+
+
+**What is RBPBench?**
+
+
+RBPBench_ is multi-function tool to evaluate CLIP-seq and other genomic region 
+data using a comprehensive collection of known RNA-binding protein (RBP) binding motifs. 
+RBPBench can be used for a variety of purposes, from RBP motif search (database or 
+user-supplied RBPs) in genomic regions, over motif co-occurrence analysis, to benchmarking 
+CLIP-seq peak caller methods as well as comparisons across cell types and 
+CLIP-seq protocols.
+
+-----
+
+**RBPBench program modes**
+
+RBPBench on Galaxy provides the following main functions (Choose on top via "Select RBPBench program mode"): 
+
+1) Search RBP binding motifs in genomic regions
+2) Search RBP binding motifs in genomic regions (multiple inputs)
+3) Search RBP binding motifs in genomic regions (data collection input)
+4) Plot nucleotide distribution at genomic positions
+5) Compare different search results
+
+
+**1. Search RBP binding motifs in genomic regions**
+
+In this mode we can select any number of RBPs of interest and search for RBP binding motifs in a given 
+set of genomic regions (*Genomic regions BED file*). A built-in high-quality database of human RBP binding motifs 
+(currently containing 259 RBPs and 605 motifs) is used by default. Moreover, users can add own motifs 
+(*Add user-supplied motifs*), as well as defining their own database (*Provide a custom RBP motif database*).
+Both sequence (MEME/DREME XML format) and structure motifs (covariance models) are supported.
+Comprehensive hit statistics (both on RBP and single motif level) are output as table files, 
+together with an informative HTML report containing various plots and tables 
+(see Output options to control what files are output). 
+Hit statistics output table formats are described in the RBPBench documentation_.
+The HTML report includes statistics for each RBP on enrichment of motifs in higher scoring regions, 
+as well as a heatmap of RBP co-occurrences in genomic regions, and an upset plot 
+on present RBP combinations (*HTML report options* for finetuning).
+If a GTF file is provided (*HTML report options -> GTF file*), genomic region annotations are also added to the regions and plots.
+Furthermore, motif distances (RBP and motif level) can be plotted relative to a set reference RBP 
+(*HTML report options -> Set reference RBP ID*).
+Motif search settings can be adapted, e.g. to apply up- and/or downstream extension to the genomic regions
+before search. Motifs for selected RBPs can also be plotted in a separate HTML file (*Output options -> Plot RBP motifs*).
+To compare motif search results (mode: *Compare different search results*), 
+data ID and method ID can be set accordingly (more details in sections 2, 3, and 5).
+
+
+**2. Search RBP binding motifs in genomic regions (multiple inputs)**
+
+This mode allows the input of more than one set of genomic regions (via *+ Insert Dataset*). 
+For each input, an RBP for motif search needs to be selected. Optionally (for comparing 
+different search results), descriptive data + method IDs can be added (also see *Compare different search results*).
+For example, if two different peak calling methods (method1, method2) have been used to 
+extract RBP binding regions from CLIP-seq data of RBP RBPX, and we want to compare these two methods later on, we would:
+*+ Insert Dataset*: input the set (i.e., BED file) produced by method1, choose the CLIP-ped RBP (RBPX) + add method ID "method1". 
+*+ Insert Dataset*: input the set produced by method2, again choose RBPX, and add method ID "method2". 
+The data ID we keep constant, ideally choosing an ID that describes the data (e.g. cell type, CLIP-seq protocol, CLIP-ped RBP).
+For example, if the cell type is K562, and the CLIP-seq protocol is eCLIP, we could specify 
+the data ID "K562_eCLIP" or "RBPX_K562_eCLIP". We can repeat this for other proteins by 
+adding the respective inputs. Finally, for comparing the two methods,
+all we need to do is to use the two produced hit statistics output tables (RBP + motif hit statistics) 
+as inputs in *Compare different search results* mode.
+The same also works the other way around, by keeping the method ID constant and changing the data ID.
+For example, if we want to compare motif search results across different cell types, we can use 
+different data IDs while keeping the method ID.
+
+
+**3. Search RBP binding motifs in genomic regions (data collection input)**
+
+This mode is identical to the previous one (multiple inputs), except that instead of 
+manually defining each input (dataset, RBP, method ID, data ID), we simply
+input a table containing all the information, as well as a dataset collection containing the datasets. 
+It is thus the preferable mode if we want to compare a large number of datasets 
+(concept of comparing sets via method ID and data ID described in the previous section).
+The input table (batch processing table file) has the following format 
+(tab-separated columns: RBP ID, method ID, data ID, BED genomic regions file name):
+
+========== ============ =============== =============================
+PUM1       method1      K562_eCLIP      PUM1.K562_eclip.method1.bed
+PUM1       method2      K562_eCLIP      PUM1.K562_eclip.method2.bed
+PUM1       method3      K562_eCLIP      PUM1.K562_eclip.method3.bed
+PUM2       method1      K562_eCLIP      PUM2.K562_eclip.method1.bed
+PUM2       method2      K562_eCLIP      PUM2.K562_eclip.method2.bed
+PUM2       method3      K562_eCLIP      PUM2.K562_eclip.method3.bed
+SLBP       method1      K562_eCLIP      SLBP.K562_eclip.method1.bed
+SLBP       method2      K562_eCLIP      SLBP.K562_eclip.method2.bed
+SLBP       method3      K562_eCLIP      SLBP.K562_eclip.method3.bed
+========== ============ =============== =============================
+
+NOTE that the table file name needs to correspond to the name of the dataset inside the 
+dataset collection. Conveniently, if you upload files to Galaxy and make a dataset collection out of them, 
+the dataset names will correspond to the uploaded file names.
+In the above table, we would produce search results for three different 
+methods, on three different RBPs. 
+Likewise, if we would want to compare motif search results across cell types, 
+the table could look like this:
+
+========== ============ =============== =============================
+PUM1       method1      K562_eCLIP      PUM1.K562_eclip.method1.bed
+PUM1       method1      HepG2_eCLIP     PUM1.HepG2_eclip.method1.bed
+PUM2       method1      K562_eCLIP      PUM2.K562_eclip.method1.bed
+PUM2       method1      HepG2_eCLIP     PUM2.HepG2_eclip.method1.bed
+SLBP       method1      K562_eCLIP      SLBP.K562_eclip.method1.bed
+SLBP       method1      HepG2_eCLIP     SLBP.HepG2_eclip.method1.bed
+========== ============ =============== =============================
+
+Here we would create motif search results across cell types K562 and HepG2, while keeping the peak calling 
+method ID constant ("method1").
+As with the two already discussed search modes, 
+the resulting hit statistics output table files (RBP + motif hit statistics) 
+can subsequently serve as inputs to RBPBench's comparison mode (*Compare different search results*, section 5).
+
+
+**4. Plot nucleotide distribution at genomic positions**
+
+In this mode, a set of genomic regions is input and the nucleotide distribution is plotted 
+around a defined center positions (*Nucleotide distribution plot settings -> Define zero position for plotting*). By default, 
+the upstream end position of each region is used (other choices are center and downstream end).
+This for example enables us to look at CLIP-seq crosslink positions and potential nucleotide biases at these sites.
+
+
+**5. Compare different search results**
+
+This mode is used to compare different motif search results (produced by any of the three motif search modes 
+described above). Inputs are the RBP and motif hit statistics table files output by the motif search modes.
+As exemplified in the previous sections, the set method IDs and 
+data IDs (together with the selected RBP IDs) define what gets compared in comparison mode.
+Based on the IDs in the input tables, RBPBench looks for combinations of RBP ID+method ID+data ID, and produces 
+method-ID-centered (with fixed RBP ID + data ID) and / or data-ID-centered (with fixed RBP ID + method ID) comparisons.
+At least two different IDs are needed for a comparison (e.g. two different method IDs or two different data IDs, with same RBP ID).
+The comparison results are presented in an HTML report file, containing a hit statistics table and a 
+Venn diagram plot for each found combination. Moreover, the report results are output as table files,
+and the combined motifs are output in BED format, for a data ID / method ID centered comparison e.g. inside a Genome Viewer.
+Comparing numbers of unique and shared motif hits between methods also serves as a way of benchmarking different methods.
+Since no ground truth (i.e., set of true / experimentally verified transcriptome-wide binding sites of an RBP) exists, one obvious way to 
+benchmark peak calling methods is to look at the enrichment of known RBP binding motifs in regions reported by the peak callers.
+RBPBench makes such evaluations easy, especially by combining modes 2,3, and 5.
+
+
+-----
+
+**Tool documentation & repository**
+
+For more information (including a webserver tutorial) please visit the RBPBench website:
+
+https://backofenlab.github.io/RBPBench
+
+
+The RBPBench repository can be found at:
+
+https://github.com/michauhl/RBPBench
+
+The GitHub repository hosts the command line version of RBPBench and also includes a 
+comprehensive manual with installation instructions and various usage examples. 
+
+
+.. _RBPBench: https://github.com/michauhl/RBPBench
+.. _documentation: https://github.com/michauhl/RBPBench#hit-statistics-table-files
+
+    ]]></help>
+</tool>
diff -r 000000000000 -r 7dd2835ce566 test-data/SLBP_USER.cm
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/SLBP_USER.cm	Sun Dec 03 12:51:54 2023 +0000
@@ -0,0 +1,385 @@
+INFERNAL1/a [1.1.3 | Nov 2019]
+NAME     Histone3
+ACC      RF00032
+DESC     Histone 3' UTR stem-loop
+STATES   142
+NODES    42
+CLEN     46
+W        57
+ALPH     RNA
+RF       no
+CONS     yes
+MAP      yes
+DATE     Fri Apr  4 13:03:46 2014
+COM      [1] /nfs/production/xfam/rfam/software/bin/cmbuild -F CM SEED
+COM      [2] /nfs/production/xfam/rfam/software/bin/cmcalibrate --mpi CM
+PBEGIN   0.05
+PEND     0.05
+WBETA    1e-07
+QDBBETA1 1e-07
+QDBBETA2 1e-15
+N2OMEGA  1.52588e-05
+N3OMEGA  1.52588e-05
+ELSELF   -0.08926734
+NSEQ     46
+EFFN     46.000000
+CKSUM    471917655
+NULL     0.000  0.000  0.000  0.000 
+GA       25.00
+TC       25.00
+NC       24.90
+EFP7GF   -8.9961 0.74543
+ECMLC    0.73248    -4.63583     3.49505     1600000      463131  0.002591
+ECMGC    0.50982    -9.05666     1.92502     1600000      108029  0.003703
+ECMLI    0.86412    -1.32523     4.80439     1600000      239617  0.005008
+ECMGI    0.55516    -6.80684     2.91667     1600000       88393  0.004525
+CM
+                                             [ ROOT    0 ]      -      - - - - -
+     S     0    -1 0     1     4     1     1    57    76 -10.705 -10.912  -0.004  -9.326                 
+    IL     1     1 2     1     4     1    19    64    83  -1.686  -2.369  -1.117  -4.855                  0.000  0.000  0.000  0.000 
+    IR     2     2 3     2     3     1    19    63    81  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL    1 ]      1      - c - - -
+    ML     3     2 3     5     3     1    19    57    76 -11.622  -0.002 -10.276                          0.274  0.676 -1.683 -0.183 
+     D     4     2 3     5     3     0    15    58    76  -6.174  -1.687  -0.566                         
+    IL     5     5 3     5     3     1    18    62    80  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL    2 ]      2      - c - - -
+    ML     6     5 3     8     3     1    18    56    75 -11.622  -0.002 -10.276                          0.562  0.685 -1.974 -0.595 
+     D     7     5 3     8     3     0    15    57    75  -6.174  -1.687  -0.566                         
+    IL     8     8 3     8     3     1    17    61    79  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL    3 ]      3      - A - - -
+    ML     9     8 3    11     3     1    17    55    74 -11.622  -0.002 -10.276                          1.588 -1.105 -4.684 -1.031 
+     D    10     8 3    11     3     0    14    56    74  -6.174  -1.687  -0.566                         
+    IL    11    11 3    11     3     1    17    60    78  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL    4 ]      4      - A - - -
+    ML    12    11 3    14     3     1    16    54    73 -11.622  -0.002 -10.276                          1.035 -0.025 -1.895 -0.517 
+     D    13    11 3    14     3     0    14    55    73  -6.174  -1.687  -0.566                         
+    IL    14    14 3    14     3     1    16    59    77  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL    5 ]      5      - a - - -
+    ML    15    14 3    17     3     1    15    53    72 -11.923  -0.687  -1.402                          0.970  0.662 -4.530 -1.266 
+     D    16    14 3    17     3     0    14    52    71  -5.620  -0.734  -1.403                         
+    IL    17    17 3    17     3     1    15    55    73  -1.925  -0.554  -4.164                          0.000  0.000  0.000  0.000 
+                                             [ MATR    6 ]      -     47 - U - -
+    MR    18    17 3    20     3     1    14    52    71 -11.239  -0.003  -9.556                         -1.280 -3.255 -0.399  1.446 
+     D    19    17 3    20     3     0    13    51    70 -11.650  -0.025  -5.880                         
+    IR    20    20 3    20     3     1    12    54    72  -1.925  -0.554  -4.164                          0.000  0.000  0.000  0.000 
+                                             [ MATR    7 ]      -     46 - g - -
+    MR    21    20 3    23     3     1    14    51    70 -11.923  -0.002 -10.241                          0.333 -0.456  0.341 -0.425 
+     D    22    20 3    23     3     0     8    50    68  -6.390  -1.568  -0.620                         
+    IR    23    23 3    23     3     1    12    53    71  -1.925  -0.554  -4.164                          0.000  0.000  0.000  0.000 
+                                             [ MATR    8 ]      -     45 - U - -
+    MR    24    23 3    26     3     1    13    50    69 -11.923  -0.002 -10.241                          0.022 -0.397 -2.351  1.021 
+     D    25    23 3    26     3     0     7    49    67  -6.390  -1.568  -0.620                         
+    IR    26    26 3    26     3     1    11    52    70  -1.925  -0.554  -4.164                          0.000  0.000  0.000  0.000 
+                                             [ MATR    9 ]      -     44 - u - -
+    MR    27    26 3    29     3     1    12    49    68 -11.923  -0.002 -10.241                          0.188 -0.473 -0.169  0.323 
+     D    28    26 3    29     3     0     6    48    66  -6.390  -1.568  -0.620                         
+    IR    29    29 3    29     3     1    10    51    69  -1.925  -0.554  -4.164                          0.000  0.000  0.000  0.000 
+                                             [ MATR   10 ]      -     43 - u - -
+    MR    30    29 3    32     3     1    11    48    67 -11.923  -0.002 -10.241                          0.043 -1.204  0.229  0.448 
+     D    31    29 3    32     3     0     5    47    65  -6.390  -1.568  -0.620                         
+    IR    32    32 3    32     3     1    10    50    68  -1.925  -0.554  -4.164                          0.000  0.000  0.000  0.000 
+                                             [ MATR   11 ]      -     42 - u - -
+    MR    33    32 3    35     3     1    10    47    66 -11.923  -0.037  -5.328                          0.283 -0.639 -0.668  0.596 
+     D    34    32 3    35     3     0     5    46    64  -6.390  -1.568  -0.620                         
+    IR    35    35 3    35     3     1     9    49    67  -1.925  -0.554  -4.164                          0.000  0.000  0.000  0.000 
+                                             [ MATR   12 ]      -     41 - a - -
+    MR    36    35 3    38     3     1     9    46    65 -11.888  -0.002 -10.205                          0.690 -2.247  0.302 -0.084 
+     D    37    35 3    38     3     0     4    45    64  -8.147  -0.315  -2.376                         
+    IR    38    38 3    38     3     1     7    48    66  -1.925  -0.554  -4.164                          0.000  0.000  0.000  0.000 
+                                             [ MATR   13 ]      -     40 - a - -
+    MR    39    38 3    41     3     1     8    45    64 -11.923  -0.002 -10.241                          0.896 -0.277 -0.185 -1.204 
+     D    40    38 3    41     3     0     2    44    62  -6.390  -1.568  -0.620                         
+    IR    41    41 3    41     3     1     6    47    65  -1.925  -0.554  -4.164                          0.000  0.000  0.000  0.000 
+                                             [ MATR   14 ]      -     39 - A - -
+    MR    42    41 3    44     3     1     7    44    63 -11.923  -0.002 -10.241                          1.147 -1.015 -0.320 -1.029 
+     D    43    41 3    44     3     0     1    43    61  -6.390  -1.568  -0.620                         
+    IR    44    44 3    44     3     1     5    46    64  -1.925  -0.554  -4.164                          0.000  0.000  0.000  0.000 
+                                             [ MATR   15 ]      -     38 - a - -
+    MR    45    44 3    47     3     1     7    43    62 -11.923  -0.027  -5.794                          0.871 -0.426 -0.479 -0.497 
+     D    46    44 3    47     3     0     1    42    60  -6.390  -1.568  -0.620                         
+    IR    47    47 3    47     3     1     5    45    63  -1.925  -0.554  -4.164                          0.000  0.000  0.000  0.000 
+                                             [ MATR   16 ]      -     37 - a - -
+    MR    48    47 3    50     3     1     6    42    61 -11.898  -0.002 -10.216                          0.726 -0.863 -0.477  0.109 
+     D    49    47 3    50     3     0     0    41    60  -7.823  -0.406  -2.053                         
+    IR    50    50 3    50     3     1     3    44    62  -1.925  -0.554  -4.164                          0.000  0.000  0.000  0.000 
+                                             [ MATR   17 ]      -     36 - a - -
+    MR    51    50 3    53     3     1     5    41    60 -11.923  -0.002 -10.241                          0.725 -1.911 -0.230  0.297 
+     D    52    50 3    53     3     0     0    40    58  -6.390  -1.568  -0.620                         
+    IR    53    53 3    53     3     1     3    43    61  -1.925  -0.554  -4.164                          0.000  0.000  0.000  0.000 
+                                             [ MATR   18 ]      -     35 - a - -
+    MR    54    53 3    56     3     1     4    40    59 -11.923  -0.002 -10.241                          0.828 -0.827 -1.719  0.441 
+     D    55    53 3    56     3     0     0    39    57  -6.390  -1.568  -0.620                         
+    IR    56    56 3    56     3     1     2    42    60  -1.925  -0.554  -4.164                          0.000  0.000  0.000  0.000 
+                                             [ MATR   19 ]      -     34 - c - -
+    MR    57    56 3    59     3     1     3    39    58 -11.923  -0.002 -10.241                          0.119  0.695 -0.517 -0.745 
+     D    58    56 3    59     3     0     0    38    56  -6.390  -1.568  -0.620                         
+    IR    59    59 3    59     3     1     2    41    59  -1.925  -0.554  -4.164                          0.000  0.000  0.000  0.000 
+                                             [ MATR   20 ]      -     33 - a - -
+    MR    60    59 3    62     3     1     2    38    57 -11.923  -0.002 -10.241                          0.569 -0.255 -1.396  0.378 
+     D    61    59 3    62     3     0     0    37    55  -6.390  -1.568  -0.620                         
+    IR    62    62 3    62     3     1     1    40    58  -1.925  -0.554  -4.164                          0.000  0.000  0.000  0.000 
+                                             [ MATR   21 ]      -     32 - u - -
+    MR    63    62 3    65     3     1     1    37    56 -11.923  -0.056  -4.714                          0.347 -0.205 -0.853  0.387 
+     D    64    62 3    65     3     0     0    36    54  -6.390  -1.568  -0.620                         
+    IR    65    65 3    65     3     1     1    39    57  -1.925  -0.554  -4.164                          0.000  0.000  0.000  0.000 
+                                             [ MATR   22 ]      -     31 - u - -
+    MR    66    65 3    68     3     1     3    36    55 -11.868  -0.002 -10.186                          0.706 -1.486 -1.611  0.752 
+     D    67    65 3    68     3     0     0    35    54  -8.618  -0.220  -2.847                         
+    IR    68    68 3    68     3     1     1    38    56  -1.925  -0.554  -4.164                          0.000  0.000  0.000  0.000 
+                                             [ MATR   23 ]      -     30 - u - -
+    MR    69    68 3    71     3     1     2    35    54 -11.923  -0.002 -10.241                         -0.972 -0.369  0.214  0.638 
+     D    70    68 3    71     3     0     0    34    52  -6.390  -1.568  -0.620                         
+    IR    71    71 3    71     3     1     1    37    55  -1.925  -0.554  -4.164                          0.000  0.000  0.000  0.000 
+                                             [ MATR   24 ]      -     29 - A - -
+    MR    72    71 3    74     3     1     1    34    53 -11.923  -0.047  -4.982                          1.166 -1.748 -1.275  0.063 
+     D    73    71 3    74     3     0     0    33    52  -6.390  -1.568  -0.620                         
+    IR    74    74 3    74     3     1     1    36    54  -1.925  -0.554  -4.164                          0.000  0.000  0.000  0.000 
+                                             [ MATR   25 ]      -     28 - c - -
+    MR    75    74 3    77     3     1     1    33    52 -11.878  -0.002 -10.195                         -0.910  0.584 -0.997  0.554 
+     D    76    74 3    77     3     0     0    32    51  -8.406  -0.258  -2.636                         
+    IR    77    77 3    77     3     1     1    35    53  -1.925  -0.554  -4.164                          0.000  0.000  0.000  0.000 
+                                             [ MATR   26 ]      -     27 - A - -
+    MR    78    77 3    80     3     1     1    32    51 -11.923  -0.071  -4.384                          1.458 -1.557 -2.019 -0.586 
+     D    79    77 3    80     3     0     0    31    50  -6.390  -1.568  -0.620                         
+    IR    80    80 3    80     3     1     1    34    52  -1.925  -0.554  -4.164                          0.000  0.000  0.000  0.000 
+                                             [ MATR   27 ]      -     26 - a - -
+    MR    81    80 3    83     3     1     1    31    50  -1.344  -0.725 -10.171                          0.698  0.567 -2.058 -0.607 
+     D    82    80 3    83     3     0     0    31    49  -0.277  -4.066  -3.118                         
+    IR    83    83 3    83     3     1     1    31    49  -6.042  -0.027  -8.281                          0.000  0.000  0.000  0.000 
+                                             [ MATR   28 ]      -     24 - c - -
+    MR    84    83 3    86     3     1     1    30    48 -11.923  -0.002 -10.241                          0.331  0.903 -2.658 -0.486 
+     D    85    83 3    86     3     0     0    29    47  -6.390  -1.568  -0.620                         
+    IR    86    86 3    86     3     1     1    31    49  -1.925  -0.554  -4.164                          0.000  0.000  0.000  0.000 
+                                             [ MATR   29 ]      -     23 - C - -
+    MR    87    86 3    89     3     1     1    29    47 -11.923  -0.002 -10.241                         -2.740  1.578 -5.132 -0.259 
+     D    88    86 3    89     3     0     0    28    46  -6.390  -1.568  -0.620                         
+    IR    89    89 3    89     3     1     1    30    48  -1.925  -0.554  -4.164                          0.000  0.000  0.000  0.000 
+                                             [ MATR   30 ]      -     22 - A - -
+    MR    90    89 3    92     5     1     1    28    46 -10.571  -0.003 -10.387 -10.599 -11.491          1.957 -3.517 -6.202 -6.036 
+     D    91    89 3    92     5     0     0    27    45  -5.352  -0.707  -2.978  -4.409  -2.404         
+    IR    92    92 3    92     5     1     1    28    47  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP   31 ]      6     21 G C - -
+    MP    93    92 3    97     6     2     2    27    45 -11.637 -11.577  -0.004 -10.353 -10.633 -11.028 -9.446 -6.202 -11.294 -3.624 -11.134 -7.406 -5.494 -10.940 -7.562  3.944 -7.769 -1.149 -5.842 -7.856 -7.917 -10.190 
+    ML    94    92 3    97     6     1     1    26    44  -6.250  -6.596  -1.310  -1.005  -6.446  -3.975  0.368 -0.385 -0.191  0.094 
+    MR    95    92 3    97     6     1     1    25    44  -6.988  -5.717  -1.625  -5.695  -0.829  -3.908  0.368 -0.385 -0.191  0.094 
+     D    96    92 3    97     6     0     0    23    42  -9.049  -7.747  -3.544  -4.226  -4.244  -0.319 
+    IL    97    97 5    97     6     1     1    27    45  -2.579  -2.842  -0.760  -4.497  -5.274  -4.934  0.000  0.000  0.000  0.000 
+    IR    98    98 6    98     5     1     1    26    45  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP   32 ]      7     20 G C - -
+    MP    99    98 6   103     6     2     2    25    43 -11.637 -11.577  -0.004 -10.353 -10.633 -11.028 -9.520 -6.204 -11.599 -3.658 -11.128 -7.383 -5.483 -11.144 -7.569  3.980 -7.767 -4.127 -5.848 -7.844 -7.915 -10.583 
+    ML   100    98 6   103     6     1     1    24    42  -6.250  -6.596  -1.310  -1.005  -6.446  -3.975  0.368 -0.385 -0.191  0.094 
+    MR   101    98 6   103     6     1     1    24    42  -6.988  -5.717  -1.625  -5.695  -0.829  -3.908  0.368 -0.385 -0.191  0.094 
+     D   102    98 6   103     6     0     0    21    40  -9.049  -7.747  -3.544  -4.226  -4.244  -0.319 
+    IL   103   103 5   103     6     1     1    25    43  -2.579  -2.842  -0.760  -4.497  -5.274  -4.934  0.000  0.000  0.000  0.000 
+    IR   104   104 6   104     5     1     1    24    43  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP   33 ]      8     19 C G - -
+    MP   105   104 6   109     6     2     2    23    41 -11.637 -11.577  -0.004 -10.353 -10.633 -11.028 -8.195 -8.273 -7.664  0.485 -6.102 -7.918  3.494 -6.975 -7.717 -4.266 -7.912 -6.303  1.648 -8.123 -3.772 -6.505 
+    ML   106   104 6   109     6     1     1    22    41  -6.250  -6.596  -1.310  -1.005  -6.446  -3.975  0.368 -0.385 -0.191  0.094 
+    MR   107   104 6   109     6     1     1    22    41  -6.988  -5.717  -1.625  -5.695  -0.829  -3.908  0.368 -0.385 -0.191  0.094 
+     D   108   104 6   109     6     0     0    20    39  -9.049  -7.747  -3.544  -4.226  -4.244  -0.319 
+    IL   109   109 5   109     6     1     1    23    41  -2.579  -2.842  -0.760  -4.497  -5.274  -4.934  0.000  0.000  0.000  0.000 
+    IR   110   110 6   110     5     1     1    22    41  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP   34 ]      9     18 U A - -
+    MP   111   110 6   115     6     2     2    21    39 -11.637 -11.577  -0.004 -10.353 -10.633 -11.028 -7.836 -7.795 -7.436 -3.794 -5.957 -7.798  2.220 -6.790 -7.445  1.323 -7.710 -5.649  3.103 -7.832 -3.590 -6.217 
+    ML   112   110 6   115     6     1     1    21    40  -6.250  -6.596  -1.310  -1.005  -6.446  -3.975  0.368 -0.385 -0.191  0.094 
+    MR   113   110 6   115     6     1     1    21    40  -6.988  -5.717  -1.625  -5.695  -0.829  -3.908  0.368 -0.385 -0.191  0.094 
+     D   114   110 6   115     6     0     0    19    38  -9.049  -7.747  -3.544  -4.226  -4.244  -0.319 
+    IL   115   115 5   115     6     1     1    21    40  -2.579  -2.842  -0.760  -4.497  -5.274  -4.934  0.000  0.000  0.000  0.000 
+    IR   116   116 6   116     5     1     1    21    39  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP   35 ]     10     17 C G - -
+    MP   117   116 6   121     6     2     2    19    37 -11.637 -11.577  -0.004 -10.353 -10.633 -11.028 -8.021 -8.050 -7.554 -4.088 -6.028 -7.856  3.184 -6.884 -7.587  0.019 -7.815 -5.994  2.506 -7.979 -3.679 -6.365 
+    ML   118   116 6   121     6     1     1    21    39  -6.250  -6.596  -1.310  -1.005  -6.446  -3.975  0.368 -0.385 -0.191  0.094 
+    MR   119   116 6   121     6     1     1    20    39  -6.988  -5.717  -1.625  -5.695  -0.829  -3.908  0.368 -0.385 -0.191  0.094 
+     D   120   116 6   121     6     0     0    19    38  -9.049  -7.747  -3.544  -4.226  -4.244  -0.319 
+    IL   121   121 5   121     6     1     1    20    39  -2.579  -2.842  -0.760  -4.497  -5.274  -4.934  0.000  0.000  0.000  0.000 
+    IR   122   122 6   122     5     1     1    20    38  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP   36 ]     11     16 U A - -
+    MP   123   122 6   127     4     2     2    17    35 -10.705 -10.912  -0.004  -9.326                 -8.498 -8.756 -7.833 -4.969 -6.193 -7.989  1.976 -7.104 -7.931 -4.927 -8.060 -7.105  3.379 -8.342  0.623 -6.731 
+    ML   124   122 6   127     4     1     1    20    39  -3.758  -3.940  -0.507  -2.670                  0.368 -0.385 -0.191  0.094 
+    MR   125   122 6   127     4     1     1    20    38  -4.809  -3.838  -1.706  -0.766                  0.368 -0.385 -0.191  0.094 
+     D   126   122 6   127     4     0     0    19    37  -4.568  -4.250  -2.265  -0.520                 
+    IL   127   127 5   127     4     1     1    22    40  -1.686  -2.369  -1.117  -4.855                  0.000  0.000  0.000  0.000 
+    IR   128   128 6   128     3     1     1    21    39  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   37 ]     12      - U - - -
+    ML   129   128 6   131     3     1     1    14    32 -11.622  -0.002 -10.276                          0.104 -1.394 -4.333  1.319 
+     D   130   128 6   131     3     0     0    16    34  -6.174  -1.687  -0.566                         
+    IL   131   131 3   131     3     1     1    20    38  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   38 ]     13      - U - - -
+    ML   132   131 3   134     3     1     1    12    31 -11.622  -0.002 -10.276                         -2.505  0.463 -5.033  1.272 
+     D   133   131 3   134     3     0     0    15    33  -6.174  -1.687  -0.566                         
+    IL   134   134 3   134     3     1     1    19    37  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   39 ]     14      - U - - -
+    ML   135   134 3   137     3     1     1    11    29 -11.622  -0.002 -10.276                         -7.616 -6.858 -8.607  1.994 
+     D   136   134 3   137     3     0     0    13    32  -6.174  -1.687  -0.566                         
+    IL   137   137 3   137     3     1     1    18    36  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   40 ]     15      - a - - -
+    ML   138   137 3   140     2     1     1     1     1       *   0.000                                  0.741  0.478 -2.313 -0.445 
+     D   139   137 3   140     2     0     0     0     0       *   0.000                                 
+    IL   140   140 3   140     2     1     1    13    28  -1.823  -0.479                                  0.000  0.000  0.000  0.000 
+                                             [ END    41 ]      -      - - - - -
+     E   141   140 3    -1     0     0     0     0     0                                                 
+//
+HMMER3/f [3.3 | Nov 2019]
+NAME  Histone3
+ACC   RF00032
+DESC  Histone 3' UTR stem-loop
+LENG  46
+MAXL  102
+ALPH  RNA
+RF    no
+MM    no
+CONS  yes
+CS    yes
+MAP   yes
+DATE  Fri Apr  4 13:03:46 2014
+COM   [1] /nfs/production/xfam/rfam/software/bin/cmbuild -F CM SEED
+NSEQ  46
+EFFN  42.133911
+CKSUM 471917655
+STATS LOCAL MSV       -8.1088  0.74543
+STATS LOCAL VITERBI   -8.5088  0.74543
+STATS LOCAL FORWARD   -3.2029  0.74543
+HMM          A        C        G        U   
+            m->m     m->i     m->d     i->m     i->i     d->m     d->d
+  COMPO   1.16847  1.39084  1.71368  1.34673
+          1.38629  1.38629  1.38629  1.38629
+          0.00416  6.17794  6.17794  1.46634  0.26236  0.00000        *
+      1   1.19718  0.92283  2.53752  1.50734      1 c - - :
+          1.38629  1.38629  1.38629  1.38629
+          0.00416  6.17794  6.17794  1.46634  0.26236  1.09861  0.40547
+      2   0.99976  0.91709  2.73454  1.78721      2 c - - :
+          1.38629  1.38629  1.38629  1.38629
+          0.00416  6.17794  6.17794  1.46634  0.26236  1.09861  0.40547
+      3   0.28707  2.15200  4.53977  2.09870      3 A - - :
+          1.38629  1.38629  1.38629  1.38629
+          0.00416  6.17794  6.17794  1.46634  0.26236  1.09861  0.40547
+      4   0.67303  1.40667  2.67938  1.73570      4 A - - :
+          1.38629  1.38629  1.38629  1.38629
+          0.00416  6.17794  6.17794  1.46634  0.26236  1.09861  0.40547
+      5   0.71631  0.93175  4.42267  2.24827      5 a - - :
+          1.38629  1.38629  1.38629  1.38629
+          0.00416  6.17794  6.17794  1.46634  0.26236  1.09861  0.40547
+      6   4.96323  6.10024  0.01150  6.11805      6 G - - <
+          1.38629  1.38629  1.38629  1.38629
+          0.00416  6.17794  6.17794  1.46634  0.26236  1.09861  0.40547
+      7   4.97477  6.07793  0.01151  6.10217      7 G - - <
+          1.38629  1.38629  1.38629  1.38629
+          0.00416  6.17794  6.17794  1.46634  0.26236  1.09861  0.40547
+      8   2.42219  0.35197  5.16373  1.59825      8 C - - <
+          1.38629  1.38629  1.38629  1.38629
+          0.00416  6.17794  6.17794  1.46634  0.26236  1.09861  0.40547
+      9   4.96709  1.22589  1.84282  0.61402      9 U - - <
+          1.38629  1.38629  1.38629  1.38629
+          0.00416  6.17794  6.17794  1.46634  0.26236  1.09861  0.40547
+     10   5.14332  0.56593  2.72176  1.02007     10 C - - <
+          1.38629  1.38629  1.38629  1.38629
+          0.00416  6.17794  6.17794  1.46634  0.26236  1.09861  0.40547
+     11   5.65512  1.39382  5.58556  0.29488     11 U - - <
+          1.38629  1.38629  1.38629  1.38629
+          0.00416  6.17794  6.17794  1.46634  0.26236  1.09861  0.40547
+     12   1.31706  2.34288  4.27893  0.47454     12 U - - _
+          1.38629  1.38629  1.38629  1.38629
+          0.00416  6.17794  6.17794  1.46634  0.26236  1.09861  0.40547
+     13   3.10136  1.06700  4.79001  0.50640     13 U - - _
+          1.38629  1.38629  1.38629  1.38629
+          0.00416  6.17794  6.17794  1.46634  0.26236  1.09861  0.40547
+     14   6.52235  6.01860  7.19543  0.00466     14 U - - _
+          1.38629  1.38629  1.38629  1.38629
+          0.00416  6.17794  6.17794  1.46634  0.26236  1.09861  0.40547
+     15   0.87615  1.05939  2.96086  1.68645     15 a - - _
+          1.38629  1.38629  1.38629  1.38629
+          0.00416  6.17794  6.17794  1.46634  0.26236  1.09861  0.40547
+     16   0.43199  5.71946  1.06961  5.43487     16 A - - >
+          1.38629  1.38629  1.38629  1.38629
+          0.00416  6.17794  6.17794  1.46634  0.26236  1.09861  0.40547
+     17   1.03329  2.73783  0.55849  4.90865     17 G - - >
+          1.38629  1.38629  1.38629  1.38629
+          0.00416  6.17794  6.17794  1.46634  0.26236  1.09861  0.40547
+     18   0.62348  1.85123  1.21052  4.72873     18 A - - >
+          1.38629  1.38629  1.38629  1.38629
+          0.00416  6.17794  6.17794  1.46634  0.26236  1.09861  0.40547
+     19   1.62037  5.32794  0.34630  2.40773     19 G - - >
+          1.38629  1.38629  1.38629  1.38629
+          0.00416  6.17794  6.17794  1.46634  0.26236  1.09861  0.40547
+     20   6.16935  0.01425  6.02393  4.64210     20 C - - >
+          1.38629  1.38629  1.38629  1.38629
+          0.00416  6.17794  6.17794  1.46634  0.26236  1.09861  0.40547
+     21   6.22221  0.03904  6.06094  3.38213     21 C - - >
+          1.38629  1.38629  1.38629  1.38629
+          0.00416  6.17794  6.17794  1.46634  0.26236  1.09861  0.40547
+     22   0.03027  3.82336  5.58493  5.47058     22 A - - :
+          1.38629  1.38629  1.38629  1.38629
+          0.00416  6.17794  6.17794  1.46634  0.26236  1.09861  0.40547
+     23   3.26053  0.29487  4.86483  1.56402     23 C - - :
+          1.38629  1.38629  1.38629  1.38629
+          0.00416  6.17794  6.17794  1.46634  0.26236  1.09861  0.40547
+     24   1.15929  0.76514  3.19669  1.71411     24 c - - :
+          1.38629  1.38629  1.38629  1.38629
+          0.47612  0.97621  6.17794  0.01098  4.51736  1.09861  0.40547
+     25   0.90589  0.99871  2.78941  1.79574     26 a - - :
+          1.38629  1.38629  1.38629  1.38629
+          0.00416  6.17794  6.17794  1.46634  0.26236  1.09861  0.40547
+     26   0.37936  2.45545  2.76975  1.78857     27 A - - :
+          1.38629  1.38629  1.38629  1.38629
+          0.03553  6.17794  3.41622  1.46634  0.26236  1.09861  0.40547
+     27   2.00288  0.98595  2.07379  1.00440     28 c - - :
+          1.38629  1.38629  1.38629  1.38629
+          0.00429  6.14670  6.14670  1.46634  0.26236  0.11900  2.18757
+     28   0.58277  2.57844  2.26067  1.34141     29 A - - :
+          1.38629  1.38629  1.38629  1.38629
+          0.00416  6.17794  6.17794  1.46634  0.26236  1.09861  0.40547
+     29   2.04103  1.64155  1.24300  0.94698     30 u - - :
+          1.38629  1.38629  1.38629  1.38629
+          0.04224  6.17794  3.23682  1.46634  0.26236  1.09861  0.40547
+     30   0.90025  2.40010  2.48509  0.86868     31 u - - :
+          1.38629  1.38629  1.38629  1.38629
+          0.00432  6.14002  6.14002  1.46634  0.26236  0.10040  2.34838
+     31   1.14658  1.52988  1.97258  1.11897     32 u - - :
+          1.38629  1.38629  1.38629  1.38629
+          0.00416  6.17794  6.17794  1.46634  0.26236  1.09861  0.40547
+     32   0.99477  1.56394  2.34075  1.12508     33 a - - :
+          1.38629  1.38629  1.38629  1.38629
+          0.00416  6.17794  6.17794  1.46634  0.26236  1.09861  0.40547
+     33   1.30260  0.91111  1.74486  1.88763     34 c - - :
+          1.38629  1.38629  1.38629  1.38629
+          0.00416  6.17794  6.17794  1.46634  0.26236  1.09861  0.40547
+     34   0.81644  1.95418  2.55798  1.08218     35 a - - :
+          1.38629  1.38629  1.38629  1.38629
+          0.00416  6.17794  6.17794  1.46634  0.26236  1.09861  0.40547
+     35   0.88707  2.68494  1.54697  1.18084     36 a - - :
+          1.38629  1.38629  1.38629  1.38629
+          0.02155  6.17794  3.95035  1.46634  0.26236  1.09861  0.40547
+     36   0.88692  1.97884  1.71659  1.30871     37 a - - :
+          1.38629  1.38629  1.38629  1.38629
+          0.00423  6.16062  6.16062  1.46634  0.26236  0.19522  1.72966
+     37   0.78649  1.68131  1.71782  1.72051     38 a - - :
+          1.38629  1.38629  1.38629  1.38629
+          0.00416  6.17794  6.17794  1.46634  0.26236  1.09861  0.40547
+     38   0.59588  2.08432  1.60986  2.08251     39 A - - :
+          1.38629  1.38629  1.38629  1.38629
+          0.00416  6.17794  6.17794  1.46634  0.26236  1.09861  0.40547
+     39   0.76886  1.58017  1.51684  2.19720     40 a - - :
+          1.38629  1.38629  1.38629  1.38629
+          0.02859  6.17794  3.64554  1.46634  0.26236  1.09861  0.40547
+     40   0.91147  2.90974  1.18115  1.44117     41 a - - :
+          1.38629  1.38629  1.38629  1.38629
+          0.00426  6.15362  6.15362  1.46634  0.26236  0.14750  1.98676
+     41   1.19023  1.82584  1.84655  0.97555     42 u - - :
+          1.38629  1.38629  1.38629  1.38629
+          0.00416  6.17794  6.17794  1.46634  0.26236  1.09861  0.40547
+     42   1.35396  2.21010  1.23260  1.07716     43 u - - :
+          1.38629  1.38629  1.38629  1.38629
+          0.00416  6.17794  6.17794  1.46634  0.26236  1.09861  0.40547
+     43   1.25472  1.71330  1.50591  1.16232     44 u - - :
+          1.38629  1.38629  1.38629  1.38629
+          0.00416  6.17794  6.17794  1.46634  0.26236  1.09861  0.40547
+     44   1.37043  1.66018  2.98397  0.68259     45 U - - :
+          1.38629  1.38629  1.38629  1.38629
+          0.00416  6.17794  6.17794  1.46634  0.26236  1.09861  0.40547
+     45   1.15612  1.70216  1.15511  1.67140     46 g - - :
+          1.38629  1.38629  1.38629  1.38629
+          0.47997  6.17794  0.96989  1.46634  0.26236  1.09861  0.40547
+     46   2.25321  3.55314  1.66807  0.38906     47 U - - :
+          1.38629  1.38629  1.38629  1.38629
+          0.00335  5.70132        *  1.46634  0.26236  0.00000        *
+//
diff -r 000000000000 -r 7dd2835ce566 test-data/comparison_stats.rbpbench_compare.test.tsv
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/comparison_stats.rbpbench_compare.test.tsv	Sun Dec 03 12:51:54 2023 +0000
@@ -0,0 +1,5 @@
+combined_id	method_id	data_id	motif_db	rbp_id	c_regions	c_uniq_motif_hits	perc_reg_with_hits	perc_uniq_motif_nts_eff_reg	uniq_motif_hits_cal_1000nt
+k562_eclip,human_v0.1,PUM1	dewseq_w100_s5	k562_eclip	human_v0.1	PUM1	23	24	43.47826086956522	3.2	4.859283255719781
+k562_eclip,human_v0.1,PUM1	clipper_idr	k562_eclip	human_v0.1	PUM1	32	8	18.75	2.691013935607881	3.8443056222969725
+k562_eclip,human_v0.1,PUM2	dewseq_w100_s5	k562_eclip	human_v0.1	PUM2	70	448	92.85714285714286	14.084164436876673	31.46288362946836
+k562_eclip,human_v0.1,PUM2	clipper_idr	k562_eclip	human_v0.1	PUM2	77	219	76.62337662337663	17.64076214943267	46.88503532434168
diff -r 000000000000 -r 7dd2835ce566 test-data/contingency_table_results.rbpbench_search.tsv
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/contingency_table_results.rbpbench_search.tsv	Sun Dec 03 12:51:54 2023 +0000
@@ -0,0 +1,3 @@
+#rbp_id	PUM1	PUM2
+PUM1	1.0	1.0
+PUM2	1.0	1.0
diff -r 000000000000 -r 7dd2835ce566 test-data/fasta_indexes.loc
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/fasta_indexes.loc	Sun Dec 03 12:51:54 2023 +0000
@@ -0,0 +1,30 @@
+#This is a sample file distributed with Galaxy that enables tools
+#to use a directory of Samtools indexed sequences data files.  You will need
+#to create these data files and then create a fasta_indexes.loc file
+#similar to this one (store it in this directory) that points to
+#the directories in which those files are stored. The fasta_indexes.loc
+#file has this format (white space characters are TAB characters):
+#
+# <unique_build_id>     <dbkey> <display_name>  <file_base_path>
+#
+#So, for example, if you had hg19 Canonical indexed stored in
+#
+# /depot/data2/galaxy/hg19/sam/,
+#
+#then the fasta_indexes.loc entry would look like this:
+#
+#hg19canon      hg19    Human (Homo sapiens): hg19 Canonical    /depot/data2/galaxy/hg19/sam/hg19canon.fa
+#
+#and your /depot/data2/galaxy/hg19/sam/ directory
+#would contain hg19canon.fa and hg19canon.fa.fai files.
+#
+#Your fasta_indexes.loc file should include an entry per line for
+#each index set you have stored.  The file in the path does actually
+#exist, but it should never be directly used. Instead, the name serves
+#as a prefix for the index file.  For example:
+#
+#hg18canon      hg18    Human (Homo sapiens): hg18 Canonical    /depot/data2/galaxy/hg18/sam/hg18canon.fa
+#hg18full       hg18    Human (Homo sapiens): hg18 Full /depot/data2/galaxy/hg18/sam/hg18full.fa
+#hg19canon      hg19    Human (Homo sapiens): hg19 Canonical    /depot/data2/galaxy/hg19/sam/hg19canon.fa
+#hg19full       hg19    Human (Homo sapiens): hg19 Full /depot/data2/galaxy/hg19/sam/hg19full.fa
+testid	testdbkey	testdisplay	${__HERE__}/test.fa
\ No newline at end of file
diff -r 000000000000 -r 7dd2835ce566 test-data/in_sites.filtered.rbpbench_search.bed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/in_sites.filtered.rbpbench_search.bed	Sun Dec 03 12:51:54 2023 +0000
@@ -0,0 +1,1 @@
+chr1	10	80	chr1:10-80(+)	0.0	+
diff -r 000000000000 -r 7dd2835ce566 test-data/in_sites.filtered.rbpbench_search.fa
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/in_sites.filtered.rbpbench_search.fa	Sun Dec 03 12:51:54 2023 +0000
@@ -0,0 +1,2 @@
+>chr1:10-80(+)
+ACTGGTTGTGATTTGTAGATACTGGCTCTTCTCAGATGAAGTTCCAGGATTATTCATTGAAAAAGGCTGG
diff -r 000000000000 -r 7dd2835ce566 test-data/motif_hit_stats.compare_test.clipper_idr.tsv
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/motif_hit_stats.compare_test.clipper_idr.tsv	Sun Dec 03 12:51:54 2023 +0000
@@ -0,0 +1,228 @@
+data_id	method_id	run_id	motif_db	region_id	rbp_id	motif_id	chr_id	gen_s	gen_e	strand	region_s	region_e	region_len	uniq_count	fimo_score	fimo_pval	cms_score	cms_eval	internal_id
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:43687539-43687632(+)	PUM1	PUM1_1	chr21	43687623	43687629	+	84	90	93	1	9.0101	0.000415	-	-	pZFAGsHH
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:8397346-8397397(+)	PUM1	PUM1_1	chr21	8397362	8397368	+	16	22	51	1	12.1616	5.85e-05	-	-	pZFAGsHH
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:8215025-8215091(+)	PUM1	PUM1_1	chr21	8215042	8215048	+	17	23	66	1	6.9798	0.000768	-	-	pZFAGsHH
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:8215025-8215091(+)	PUM1	PUM1_1	chr21	8215045	8215051	+	20	26	66	1	11.1515	0.000238	-	-	pZFAGsHH
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:8215025-8215091(+)	PUM1	PUM1_1	chr21	8215075	8215081	+	50	56	66	1	11.1515	0.000238	-	-	pZFAGsHH
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:8214310-8214363(+)	PUM1	PUM1_1	chr21	8214324	8214330	+	14	20	53	1	12.1616	5.85e-05	-	-	pZFAGsHH
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:36375568-36375657(+)	PUM1	PUM1_2	chr21	36375632	36375640	+	64	72	89	1	-2.35354	0.000906	-	-	pZFAGsHH
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:32764345-32764372(-)	PUM1	PUM1_2	chr21	32764358	32764366	-	7	15	27	1	6.31313	0.000191	-	-	pZFAGsHH
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:14371121-14371193(-)	PUM2	PUM2_1	chr21	14371170	14371177	-	17	24	72	1	4.78788	0.000283	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:14371121-14371193(-)	PUM2	PUM2_1	chr21	14371168	14371175	-	19	26	72	1	4.69697	0.000481	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:14371121-14371193(-)	PUM2	PUM2_1	chr21	14371143	14371150	-	44	51	72	1	14.2121	3.34e-05	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:32734876-32734935(-)	PUM2	PUM2_1	chr21	32734896	32734903	-	33	40	59	1	11.8788	8.1e-05	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:32734876-32734935(-)	PUM2	PUM2_1	chr21	32734887	32734894	-	42	49	59	1	14.3636	1.62e-05	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:32733994-32734078(-)	PUM2	PUM2_1	chr21	32734055	32734062	-	17	24	84	1	4.78788	0.000283	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:32733994-32734078(-)	PUM2	PUM2_1	chr21	32734041	32734048	-	31	38	84	1	14.2121	3.34e-05	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:14961306-14961341(-)	PUM2	PUM2_1	chr21	14961325	14961332	-	10	17	35	1	12.9798	4.95e-05	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:28945887-28945953(-)	PUM2	PUM2_1	chr21	28945911	28945918	-	36	43	66	1	14.2121	3.34e-05	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:33576734-33576815(+)	PUM2	PUM2_1	chr21	33576754	33576761	+	20	27	81	1	4.78788	0.000283	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:33576651-33576714(+)	PUM2	PUM2_1	chr21	33576671	33576678	+	20	27	63	1	4.54545	0.000789	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:33576651-33576714(+)	PUM2	PUM2_1	chr21	33576685	33576692	+	34	41	63	1	4.54545	0.000789	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:33576604-33576651(+)	PUM2	PUM2_1	chr21	33576643	33576650	+	39	46	47	1	14.2121	3.34e-05	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:36376271-36376367(+)	PUM2	PUM2_1	chr21	36376310	36376317	+	39	46	96	1	14.3636	1.62e-05	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:36376271-36376367(+)	PUM2	PUM2_1	chr21	36376312	36376319	+	41	48	96	1	4.71717	0.000332	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:37223448-37223498(-)	PUM2	PUM2_1	chr21	37223459	37223466	-	33	40	50	1	12.0303	6.48e-05	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:37202978-37203044(+)	PUM2	PUM2_1	chr21	37203027	37203034	+	49	56	66	1	12.9798	4.95e-05	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:46569364-46569436(+)	PUM2	PUM2_1	chr21	46569382	46569389	+	18	25	72	1	4.63636	0.000578	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:36375540-36375560(+)	PUM2	PUM2_1	chr21	36375544	36375551	+	4	11	20	1	4.63636	0.000578	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:33560587-33560651(+)	PUM2	PUM2_1	chr21	33560605	33560612	+	18	25	64	1	4.78788	0.000283	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:14485722-14485766(-)	PUM2	PUM2_1	chr21	14485730	14485737	-	30	37	44	1	4.63636	0.000578	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:14485656-14485707(-)	PUM2	PUM2_1	chr21	14485692	14485699	-	9	16	51	1	4.63636	0.000578	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:17788991-17789050(-)	PUM2	PUM2_1	chr21	17789024	17789031	-	20	27	59	1	14.3636	1.62e-05	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:45602682-45602742(+)	PUM2	PUM2_1	chr21	45602699	45602706	+	17	24	60	1	12.0303	6.48e-05	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:45602682-45602742(+)	PUM2	PUM2_1	chr21	45602733	45602740	+	51	58	60	1	4.87879	0.000191	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:37515039-37515108(+)	PUM2	PUM2_1	chr21	37515084	37515091	+	45	52	69	1	4.78788	0.000283	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:37515039-37515108(+)	PUM2	PUM2_1	chr21	37515086	37515093	+	47	54	69	1	12.0303	6.48e-05	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:32628790-32628839(-)	PUM2	PUM2_1	chr21	32628809	32628816	-	24	31	49	1	12.9798	4.95e-05	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:43760985-43761109(+)	PUM2	PUM2_1	chr21	43761044	43761051	+	59	66	124	1	12.0303	6.48e-05	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:46324135-46324199(+)	PUM2	PUM2_1	chr21	46324158	46324165	+	23	30	64	1	14.2121	3.34e-05	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:29345202-29345237(+)	PUM2	PUM2_1	chr21	29345209	29345216	+	7	14	35	1	12.0303	6.48e-05	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:34099697-34099783(+)	PUM2	PUM2_1	chr21	34099722	34099729	+	25	32	86	1	4.78788	0.000283	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:34099697-34099783(+)	PUM2	PUM2_1	chr21	34099724	34099731	+	27	34	86	1	14.3636	1.62e-05	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:34099697-34099783(+)	PUM2	PUM2_1	chr21	34099762	34099769	+	65	72	86	1	14.2121	3.34e-05	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:39175479-39175597(-)	PUM2	PUM2_1	chr21	39175562	39175569	-	29	36	118	1	12.0303	6.48e-05	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:39175479-39175597(-)	PUM2	PUM2_1	chr21	39175515	39175522	-	76	83	118	1	8.07071	0.000128	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:34791774-34791828(-)	PUM2	PUM2_1	chr21	34791779	34791786	-	43	50	54	1	4.63636	0.000578	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:33524027-33524134(-)	PUM2	PUM2_1	chr21	33524100	33524107	-	28	35	107	1	4.78788	0.000283	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:38156408-38156501(+)	PUM2	PUM2_1	chr21	38156461	38156468	+	53	60	93	1	10.6465	9.62e-05	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:38823652-38823706(+)	PUM2	PUM2_1	chr21	38823684	38823691	+	32	39	54	1	10.6465	9.62e-05	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:33437436-33437487(+)	PUM2	PUM2_1	chr21	33437440	33437447	+	4	11	51	1	14.2121	3.34e-05	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:33437328-33437436(+)	PUM2	PUM2_1	chr21	33437400	33437407	+	72	79	108	1	3.64646	0.000819	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:33437328-33437436(+)	PUM2	PUM2_1	chr21	33437428	33437435	+	100	107	108	1	4.63636	0.000578	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:14961795-14961851(-)	PUM2	PUM2_1	chr21	14961842	14961849	-	3	10	56	1	14.2121	3.34e-05	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:14961795-14961851(-)	PUM2	PUM2_1	chr21	14961807	14961814	-	38	45	56	1	4.78788	0.000283	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:14961795-14961851(-)	PUM2	PUM2_1	chr21	14961803	14961810	-	42	49	56	1	4.69697	0.000481	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:14961851-14961895(-)	PUM2	PUM2_1	chr21	14961861	14961868	-	28	35	44	1	12.0303	6.48e-05	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:36376401-36376460(+)	PUM2	PUM2_1	chr21	36376422	36376429	+	21	28	59	1	4.78788	0.000283	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:29326164-29326210(+)	PUM2	PUM2_1	chr21	29326166	29326173	+	2	9	46	1	12.9798	4.95e-05	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:44861160-44861215(-)	PUM2	PUM2_1	chr21	44861192	44861199	-	17	24	55	1	11.8788	8.1e-05	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:14485244-14485280(-)	PUM2	PUM2_1	chr21	14485254	14485261	-	20	27	36	1	4.63636	0.000578	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:14485280-14485326(-)	PUM2	PUM2_1	chr21	14485285	14485292	-	35	42	46	1	14.2121	3.34e-05	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:34105575-34105653(+)	PUM2	PUM2_1	chr21	34105602	34105609	+	27	34	78	1	12.0303	6.48e-05	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:34105575-34105653(+)	PUM2	PUM2_1	chr21	34105611	34105618	+	36	43	78	1	3.64646	0.000819	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:34098703-34098750(+)	PUM2	PUM2_1	chr21	34098705	34098712	+	2	9	47	1	4.63636	0.000578	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:32734633-32734683(-)	PUM2	PUM2_1	chr21	32734647	32734654	-	30	37	50	1	11.8788	8.1e-05	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:32734633-32734683(-)	PUM2	PUM2_1	chr21	32734638	32734645	-	39	46	50	1	4.63636	0.000578	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:44805626-44805677(-)	PUM2	PUM2_1	chr21	44805668	44805675	-	3	10	51	1	10.6465	9.62e-05	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:44805626-44805677(-)	PUM2	PUM2_1	chr21	44805641	44805648	-	30	37	51	1	4.54545	0.000789	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:44805626-44805677(-)	PUM2	PUM2_1	chr21	44805634	44805641	-	37	44	51	1	4.54545	0.000789	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:37513867-37513939(+)	PUM2	PUM2_1	chr21	37513892	37513899	+	25	32	72	1	4.63636	0.000578	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:14961937-14961964(-)	PUM2	PUM2_1	chr21	14961945	14961952	-	13	20	27	1	14.2121	3.34e-05	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:34887678-34887756(-)	PUM2	PUM2_1	chr21	34887732	34887739	-	18	25	78	1	14.2121	3.34e-05	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:34887678-34887756(-)	PUM2	PUM2_1	chr21	34887705	34887712	-	45	52	78	1	14.3636	1.62e-05	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:34887678-34887756(-)	PUM2	PUM2_1	chr21	34887697	34887704	-	53	60	78	1	4.71717	0.000332	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:34887678-34887756(-)	PUM2	PUM2_1	chr21	34887695	34887702	-	55	62	78	1	4.71717	0.000332	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:33578030-33578124(-)	PUM2	PUM2_1	chr21	33578071	33578078	-	47	54	94	1	12.0303	6.48e-05	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:43983033-43983127(+)	PUM2	PUM2_1	chr21	43983059	43983066	+	26	33	94	1	14.2121	3.34e-05	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:14961306-14961341(-)	PUM2	PUM2_2	chr21	14961325	14961332	-	10	17	35	1	6.30303	0.000377	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:33504132-33504209(-)	PUM2	PUM2_2	chr21	33504165	33504172	-	38	45	77	1	6.31313	0.000284	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:33576604-33576651(+)	PUM2	PUM2_2	chr21	33576612	33576619	+	8	15	47	1	-3.24242	0.000754	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:37202978-37203044(+)	PUM2	PUM2_2	chr21	37203027	37203034	+	49	56	66	1	6.30303	0.000377	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:45602682-45602742(+)	PUM2	PUM2_2	chr21	45602708	45602715	+	26	33	60	1	6.31313	0.000284	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:32628790-32628839(-)	PUM2	PUM2_2	chr21	32628809	32628816	-	24	31	49	1	6.30303	0.000377	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:34099697-34099783(+)	PUM2	PUM2_2	chr21	34099702	34099709	+	5	12	86	1	6.31313	0.000284	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:38156408-38156501(+)	PUM2	PUM2_2	chr21	38156461	38156468	+	53	60	93	1	6.30303	0.000377	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:38823652-38823706(+)	PUM2	PUM2_2	chr21	38823684	38823691	+	32	39	54	1	6.30303	0.000377	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:33437328-33437436(+)	PUM2	PUM2_2	chr21	33437400	33437407	+	72	79	108	1	15.9798	1.5e-05	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:29326164-29326210(+)	PUM2	PUM2_2	chr21	29326166	29326173	+	2	9	46	1	6.30303	0.000377	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:34105575-34105653(+)	PUM2	PUM2_2	chr21	34105611	34105618	+	36	43	78	1	6.30303	0.000377	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:44805626-44805677(-)	PUM2	PUM2_2	chr21	44805668	44805675	-	3	10	51	1	6.30303	0.000377	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:14961257-14961282(-)	PUM2	PUM2_2	chr21	14961274	14961281	-	2	9	25	1	-3.24242	0.000754	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:36375329-36375363(+)	PUM2	PUM2_2	chr21	36375341	36375348	+	12	19	34	1	6.31313	0.000284	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:43983033-43983127(+)	PUM2	PUM2_2	chr21	43983067	43983074	+	34	41	94	1	6.31313	0.000284	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:14371121-14371193(-)	PUM2	PUM2_3	chr21	14371143	14371150	-	44	51	72	1	15.7778	1.72e-05	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:32734876-32734935(-)	PUM2	PUM2_3	chr21	32734896	32734903	-	33	40	59	1	6.20202	0.000212	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:32734876-32734935(-)	PUM2	PUM2_3	chr21	32734887	32734894	-	42	49	59	1	6.20202	0.000212	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:32733994-32734078(-)	PUM2	PUM2_3	chr21	32734041	32734048	-	31	38	84	1	15.7778	1.72e-05	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:14961306-14961341(-)	PUM2	PUM2_3	chr21	14961325	14961332	-	10	17	35	1	6.20202	0.000212	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:28945887-28945953(-)	PUM2	PUM2_3	chr21	28945911	28945918	-	36	43	66	1	15.7778	1.72e-05	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:33576651-33576714(+)	PUM2	PUM2_3	chr21	33576671	33576678	+	20	27	63	1	6.11111	0.000423	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:33576651-33576714(+)	PUM2	PUM2_3	chr21	33576685	33576692	+	34	41	63	1	6.11111	0.000423	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:33576604-33576651(+)	PUM2	PUM2_3	chr21	33576643	33576650	+	39	46	47	1	15.7778	1.72e-05	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:36376271-36376367(+)	PUM2	PUM2_3	chr21	36376310	36376317	+	39	46	96	1	6.20202	0.000212	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:37202978-37203044(+)	PUM2	PUM2_3	chr21	37203027	37203034	+	49	56	66	1	6.20202	0.000212	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:46569364-46569436(+)	PUM2	PUM2_3	chr21	46569382	46569389	+	18	25	72	1	6.20202	0.000212	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:36375540-36375560(+)	PUM2	PUM2_3	chr21	36375544	36375551	+	4	11	20	1	6.20202	0.000212	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:14485722-14485766(-)	PUM2	PUM2_3	chr21	14485730	14485737	-	30	37	44	1	6.20202	0.000212	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:14485656-14485707(-)	PUM2	PUM2_3	chr21	14485692	14485699	-	9	16	51	1	6.20202	0.000212	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:17788991-17789050(-)	PUM2	PUM2_3	chr21	17789024	17789031	-	20	27	59	1	6.20202	0.000212	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:45602682-45602742(+)	PUM2	PUM2_3	chr21	45602733	45602740	+	51	58	60	1	6.20202	0.000212	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:32628790-32628839(-)	PUM2	PUM2_3	chr21	32628809	32628816	-	24	31	49	1	6.20202	0.000212	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:46324135-46324199(+)	PUM2	PUM2_3	chr21	46324158	46324165	+	23	30	64	1	15.7778	1.72e-05	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:34099697-34099783(+)	PUM2	PUM2_3	chr21	34099724	34099731	+	27	34	86	1	6.20202	0.000212	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:34099697-34099783(+)	PUM2	PUM2_3	chr21	34099762	34099769	+	65	72	86	1	15.7778	1.72e-05	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:34791774-34791828(-)	PUM2	PUM2_3	chr21	34791779	34791786	-	43	50	54	1	6.20202	0.000212	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:33437436-33437487(+)	PUM2	PUM2_3	chr21	33437440	33437447	+	4	11	51	1	15.7778	1.72e-05	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:33437328-33437436(+)	PUM2	PUM2_3	chr21	33437428	33437435	+	100	107	108	1	6.20202	0.000212	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:14961795-14961851(-)	PUM2	PUM2_3	chr21	14961842	14961849	-	3	10	56	1	15.7778	1.72e-05	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:29326164-29326210(+)	PUM2	PUM2_3	chr21	29326166	29326173	+	2	9	46	1	6.20202	0.000212	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:44861160-44861215(-)	PUM2	PUM2_3	chr21	44861192	44861199	-	17	24	55	1	6.20202	0.000212	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:14485244-14485280(-)	PUM2	PUM2_3	chr21	14485254	14485261	-	20	27	36	1	6.20202	0.000212	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:14485280-14485326(-)	PUM2	PUM2_3	chr21	14485285	14485292	-	35	42	46	1	15.7778	1.72e-05	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:34098703-34098750(+)	PUM2	PUM2_3	chr21	34098705	34098712	+	2	9	47	1	6.20202	0.000212	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:32734633-32734683(-)	PUM2	PUM2_3	chr21	32734647	32734654	-	30	37	50	1	6.20202	0.000212	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:32734633-32734683(-)	PUM2	PUM2_3	chr21	32734638	32734645	-	39	46	50	1	6.20202	0.000212	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:44805626-44805677(-)	PUM2	PUM2_3	chr21	44805641	44805648	-	30	37	51	1	6.11111	0.000423	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:44805626-44805677(-)	PUM2	PUM2_3	chr21	44805634	44805641	-	37	44	51	1	6.11111	0.000423	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:37513867-37513939(+)	PUM2	PUM2_3	chr21	37513892	37513899	+	25	32	72	1	6.20202	0.000212	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:14961937-14961964(-)	PUM2	PUM2_3	chr21	14961945	14961952	-	13	20	27	1	15.7778	1.72e-05	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:34887678-34887756(-)	PUM2	PUM2_3	chr21	34887732	34887739	-	18	25	78	1	15.7778	1.72e-05	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:34887678-34887756(-)	PUM2	PUM2_3	chr21	34887705	34887712	-	45	52	78	1	6.20202	0.000212	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:43983033-43983127(+)	PUM2	PUM2_3	chr21	43983059	43983066	+	26	33	94	1	15.7778	1.72e-05	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:14371121-14371193(-)	PUM2	PUM2_4	chr21	14371143	14371150	-	44	51	72	1	6.20202	0.000255	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:32734876-32734935(-)	PUM2	PUM2_4	chr21	32734887	32734894	-	42	49	59	1	6.20202	0.000255	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:32733994-32734078(-)	PUM2	PUM2_4	chr21	32734041	32734048	-	31	38	84	1	6.20202	0.000255	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:14961306-14961341(-)	PUM2	PUM2_4	chr21	14961325	14961332	-	10	17	35	1	6.20202	0.000255	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:28945887-28945953(-)	PUM2	PUM2_4	chr21	28945911	28945918	-	36	43	66	1	6.20202	0.000255	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:33576604-33576651(+)	PUM2	PUM2_4	chr21	33576643	33576650	+	39	46	47	1	6.20202	0.000255	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:36376271-36376367(+)	PUM2	PUM2_4	chr21	36376310	36376317	+	39	46	96	1	6.20202	0.000255	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:37202978-37203044(+)	PUM2	PUM2_4	chr21	37203027	37203034	+	49	56	66	1	6.20202	0.000255	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:17788991-17789050(-)	PUM2	PUM2_4	chr21	17789024	17789031	-	20	27	59	1	6.20202	0.000255	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:32628790-32628839(-)	PUM2	PUM2_4	chr21	32628809	32628816	-	24	31	49	1	6.20202	0.000255	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:46324135-46324199(+)	PUM2	PUM2_4	chr21	46324158	46324165	+	23	30	64	1	6.20202	0.000255	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:34099697-34099783(+)	PUM2	PUM2_4	chr21	34099724	34099731	+	27	34	86	1	6.20202	0.000255	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:34099697-34099783(+)	PUM2	PUM2_4	chr21	34099762	34099769	+	65	72	86	1	6.20202	0.000255	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:39175479-39175597(-)	PUM2	PUM2_4	chr21	39175515	39175522	-	76	83	118	1	6.27273	0.000156	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:33524027-33524134(-)	PUM2	PUM2_4	chr21	33524055	33524062	-	73	80	107	1	-3.30303	0.0008	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:33437436-33437487(+)	PUM2	PUM2_4	chr21	33437440	33437447	+	4	11	51	1	6.20202	0.000255	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:14961795-14961851(-)	PUM2	PUM2_4	chr21	14961842	14961849	-	3	10	56	1	6.20202	0.000255	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:29326164-29326210(+)	PUM2	PUM2_4	chr21	29326166	29326173	+	2	9	46	1	6.20202	0.000255	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:29326125-29326164(+)	PUM2	PUM2_4	chr21	29326130	29326137	+	5	12	39	1	-3.30303	0.0008	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:14485280-14485326(-)	PUM2	PUM2_4	chr21	14485285	14485292	-	35	42	46	1	6.20202	0.000255	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:14961937-14961964(-)	PUM2	PUM2_4	chr21	14961945	14961952	-	13	20	27	1	6.20202	0.000255	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:34887678-34887756(-)	PUM2	PUM2_4	chr21	34887732	34887739	-	18	25	78	1	6.20202	0.000255	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:34887678-34887756(-)	PUM2	PUM2_4	chr21	34887705	34887712	-	45	52	78	1	6.20202	0.000255	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:43983033-43983127(+)	PUM2	PUM2_4	chr21	43983059	43983066	+	26	33	94	1	6.20202	0.000255	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:14371121-14371193(-)	PUM2	PUM2_5	chr21	14371170	14371179	-	15	24	72	1	8.27273	0.000508	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:14371121-14371193(-)	PUM2	PUM2_5	chr21	14371143	14371152	-	42	51	72	1	11.9293	4.81e-05	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:32734876-32734935(-)	PUM2	PUM2_5	chr21	32734896	32734905	-	31	40	59	1	11.4545	6.81e-05	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:32734876-32734935(-)	PUM2	PUM2_5	chr21	32734887	32734896	-	40	49	59	1	14.7071	9.81e-07	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:32734876-32734935(-)	PUM2	PUM2_5	chr21	32734885	32734894	-	42	51	59	1	7.45455	0.000727	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:32734876-32734935(-)	PUM2	PUM2_5	chr21	32734879	32734888	-	48	57	59	1	10.2323	0.000167	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:32733994-32734078(-)	PUM2	PUM2_5	chr21	32734041	32734050	-	29	38	84	1	12.7172	2.11e-05	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:14961306-14961341(-)	PUM2	PUM2_5	chr21	14961325	14961334	-	8	17	35	1	11.6566	6.11e-05	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:28945887-28945953(-)	PUM2	PUM2_5	chr21	28945911	28945920	-	34	43	66	1	10.0303	0.000196	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:33576734-33576815(+)	PUM2	PUM2_5	chr21	33576754	33576763	+	20	29	81	1	7.64646	0.000672	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:33504132-33504209(-)	PUM2	PUM2_5	chr21	33504165	33504174	-	36	45	77	1	6.72727	0.000983	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:33576651-33576714(+)	PUM2	PUM2_5	chr21	33576669	33576678	+	18	27	63	1	9.56566	0.000256	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:33576651-33576714(+)	PUM2	PUM2_5	chr21	33576683	33576692	+	32	41	63	1	9.54545	0.00026	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:33576604-33576651(+)	PUM2	PUM2_5	chr21	33576641	33576650	+	37	46	47	1	11.6263	6.33e-05	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:36376271-36376367(+)	PUM2	PUM2_5	chr21	36376308	36376317	+	37	46	96	1	13.9192	3.92e-06	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:36376271-36376367(+)	PUM2	PUM2_5	chr21	36376310	36376319	+	39	48	96	1	9.43434	0.00027	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:36376271-36376367(+)	PUM2	PUM2_5	chr21	36376343	36376352	+	72	81	96	1	6.92929	0.000923	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:37223448-37223498(-)	PUM2	PUM2_5	chr21	37223459	37223468	-	31	40	50	1	11.0606	9.24e-05	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:37202978-37203044(+)	PUM2	PUM2_5	chr21	37203025	37203034	+	47	56	66	1	14.3232	1.95e-06	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:46569364-46569436(+)	PUM2	PUM2_5	chr21	46569388	46569397	+	24	33	72	1	11.5051	6.62e-05	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:36375540-36375560(+)	PUM2	PUM2_5	chr21	36375542	36375551	+	2	11	20	1	10.101	0.000188	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:36375651-36375701(+)	PUM2	PUM2_5	chr21	36375655	36375664	+	4	13	50	1	7.67677	0.000661	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:17788991-17789050(-)	PUM2	PUM2_5	chr21	17789024	17789033	-	18	27	59	1	12.0404	4.11e-05	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:17788991-17789050(-)	PUM2	PUM2_5	chr21	17789022	17789031	-	20	29	59	1	7.45455	0.000727	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:45602682-45602742(+)	PUM2	PUM2_5	chr21	45602697	45602706	+	15	24	60	1	12.1515	3.69e-05	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:45602682-45602742(+)	PUM2	PUM2_5	chr21	45602706	45602715	+	24	33	60	1	7.77778	0.00064	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:45602682-45602742(+)	PUM2	PUM2_5	chr21	45602731	45602740	+	49	58	60	1	10.1717	0.000174	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:37515108-37515163(+)	PUM2	PUM2_5	chr21	37515122	37515131	+	14	23	55	1	7.71717	0.000655	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:37515039-37515108(+)	PUM2	PUM2_5	chr21	37515084	37515093	+	45	54	69	1	12.3939	2.8e-05	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:32628790-32628839(-)	PUM2	PUM2_5	chr21	32628809	32628818	-	22	31	49	1	12.7071	2.2e-05	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:43760985-43761109(+)	PUM2	PUM2_5	chr21	43761042	43761051	+	57	66	124	1	12.1515	3.69e-05	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:46324135-46324199(+)	PUM2	PUM2_5	chr21	46324156	46324165	+	21	30	64	1	11.1212	8.74e-05	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:29345202-29345237(+)	PUM2	PUM2_5	chr21	29345207	29345216	+	5	14	35	1	12.3737	2.89e-05	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:34099697-34099783(+)	PUM2	PUM2_5	chr21	34099720	34099729	+	23	32	86	1	8.27273	0.000508	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:34099697-34099783(+)	PUM2	PUM2_5	chr21	34099722	34099731	+	25	34	86	1	13.1111	1.1e-05	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:34099697-34099783(+)	PUM2	PUM2_5	chr21	34099760	34099769	+	63	72	86	1	12.1515	3.69e-05	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:39175479-39175597(-)	PUM2	PUM2_5	chr21	39175562	39175571	-	27	36	118	1	11.3434	7.4e-05	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:39175479-39175597(-)	PUM2	PUM2_5	chr21	39175515	39175524	-	74	83	118	1	10.1616	0.000175	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:33524027-33524134(-)	PUM2	PUM2_5	chr21	33524083	33524092	-	43	52	107	1	8.48485	0.000453	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:33524027-33524134(-)	PUM2	PUM2_5	chr21	33524047	33524056	-	79	88	107	1	10.9293	0.000107	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:33524027-33524134(-)	PUM2	PUM2_5	chr21	33524030	33524039	-	96	105	107	1	8.61616	0.000424	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:38156408-38156501(+)	PUM2	PUM2_5	chr21	38156459	38156468	+	51	60	93	1	11.7677	5.5e-05	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:43693414-43693454(+)	PUM2	PUM2_5	chr21	43693415	43693424	+	1	10	40	1	12.2929	3.08e-05	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:43693369-43693414(+)	PUM2	PUM2_5	chr21	43693399	43693408	+	30	39	45	1	7.35354	0.00076	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:38823652-38823706(+)	PUM2	PUM2_5	chr21	38823682	38823691	+	30	39	54	1	13.6061	6.92e-06	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:33437436-33437487(+)	PUM2	PUM2_5	chr21	33437438	33437447	+	2	11	51	1	11.9394	4.69e-05	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:33437328-33437436(+)	PUM2	PUM2_5	chr21	33437398	33437407	+	70	79	108	1	8.80808	0.000397	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:33437328-33437436(+)	PUM2	PUM2_5	chr21	33437426	33437435	+	98	107	108	1	8.26263	0.000513	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:14961795-14961851(-)	PUM2	PUM2_5	chr21	14961842	14961851	-	1	10	56	1	11.1212	8.74e-05	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:14961851-14961895(-)	PUM2	PUM2_5	chr21	14961861	14961870	-	26	35	44	1	10.5455	0.000137	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:45512384-45512556(+)	PUM2	PUM2_5	chr21	45512511	45512520	+	127	136	172	1	8.51515	0.000442	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:33558801-33558874(+)	PUM2	PUM2_5	chr21	33558832	33558841	+	31	40	73	1	7.71717	0.000655	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:44861160-44861215(-)	PUM2	PUM2_5	chr21	44861192	44861201	-	15	24	55	1	13.0505	1.29e-05	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:14485280-14485326(-)	PUM2	PUM2_5	chr21	14485285	14485294	-	33	42	46	1	11.1212	8.74e-05	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:34105575-34105653(+)	PUM2	PUM2_5	chr21	34105600	34105609	+	25	34	78	1	10.2525	0.000164	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:34105575-34105653(+)	PUM2	PUM2_5	chr21	34105609	34105618	+	34	43	78	1	10.7475	0.000121	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:32734633-32734683(-)	PUM2	PUM2_5	chr21	32734647	32734656	-	28	37	50	1	10.404	0.000149	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:32734633-32734683(-)	PUM2	PUM2_5	chr21	32734638	32734647	-	37	46	50	1	8.50505	0.000445	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:44805626-44805677(-)	PUM2	PUM2_5	chr21	44805668	44805677	-	1	10	51	1	13.6061	6.92e-06	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:37513867-37513939(+)	PUM2	PUM2_5	chr21	37513905	37513914	+	38	47	72	1	7.0404	0.000882	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:14961937-14961964(-)	PUM2	PUM2_5	chr21	14961945	14961954	-	11	20	27	1	10.8384	0.000118	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:32734837-32734876(-)	PUM2	PUM2_5	chr21	32734862	32734871	-	6	15	39	1	7.77778	0.00064	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:34887678-34887756(-)	PUM2	PUM2_5	chr21	34887737	34887746	-	11	20	78	1	7.24242	0.000807	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:34887678-34887756(-)	PUM2	PUM2_5	chr21	34887732	34887741	-	16	25	78	1	12.7172	2.11e-05	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:34887678-34887756(-)	PUM2	PUM2_5	chr21	34887705	34887714	-	43	52	78	1	13.9192	3.92e-06	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:34887678-34887756(-)	PUM2	PUM2_5	chr21	34887703	34887712	-	45	54	78	1	8.71717	0.000411	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:34887678-34887756(-)	PUM2	PUM2_5	chr21	34887697	34887706	-	51	60	78	1	9.17172	0.00032	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:34887678-34887756(-)	PUM2	PUM2_5	chr21	34887695	34887704	-	53	62	78	1	11.0303	9.55e-05	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:36375329-36375363(+)	PUM2	PUM2_5	chr21	36375339	36375348	+	10	19	34	1	7.25253	0.000803	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:33578030-33578124(-)	PUM2	PUM2_5	chr21	33578071	33578080	-	45	54	94	1	12.9394	1.5e-05	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:31671330-31671381(-)	PUM2	PUM2_5	chr21	31671335	31671344	-	38	47	51	1	8.55556	0.000433	-	-	AJ40lTA6
+k562_eclip	clipper_idr	run_id	human_v0.1	chr21:43983033-43983127(+)	PUM2	PUM2_5	chr21	43983057	43983066	+	24	33	94	1	12.1717	3.39e-05	-	-	AJ40lTA6
diff -r 000000000000 -r 7dd2835ce566 test-data/motif_hit_stats.compare_test.dewseq.tsv
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/motif_hit_stats.compare_test.dewseq.tsv	Sun Dec 03 12:51:54 2023 +0000
@@ -0,0 +1,584 @@
+data_id	method_id	run_id	motif_db	region_id	rbp_id	motif_id	chr_id	gen_s	gen_e	strand	region_s	region_e	region_len	uniq_count	fimo_score	fimo_pval	cms_score	cms_eval	internal_id
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:8214212-8214407(+)	PUM1	PUM1_1	chr21	8214298	8214304	+	86	92	195	1	8.83838	0.000473	-	-	MVuT5ext
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:8214212-8214407(+)	PUM1	PUM1_1	chr21	8214324	8214330	+	112	118	195	1	12.1616	5.85e-05	-	-	MVuT5ext
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:8218652-8218957(+)	PUM1	PUM1_1	chr21	8218698	8218704	+	46	52	305	1	11.3232	0.00018	-	-	MVuT5ext
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:8213907-8214127(+)	PUM1	PUM1_1	chr21	8214075	8214081	+	168	174	220	1	6.9798	0.000768	-	-	MVuT5ext
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:8217782-8218632(+)	PUM1	PUM1_1	chr21	8217841	8217847	+	59	65	850	1	6.9798	0.000768	-	-	MVuT5ext
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:8217782-8218632(+)	PUM1	PUM1_1	chr21	8217884	8217890	+	102	108	850	1	11.1515	0.000238	-	-	MVuT5ext
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:8217782-8218632(+)	PUM1	PUM1_1	chr21	8217961	8217967	+	179	185	850	1	11.3232	0.00018	-	-	MVuT5ext
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:8217782-8218632(+)	PUM1	PUM1_1	chr21	8217962	8217968	+	180	186	850	1	6.9798	0.000768	-	-	MVuT5ext
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:8401688-8401913(+)	PUM1	PUM1_1	chr21	8401737	8401743	+	49	55	225	1	11.3232	0.00018	-	-	MVuT5ext
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:8397503-8397723(+)	PUM1	PUM1_1	chr21	8397514	8397520	+	11	17	220	1	11.1515	0.000238	-	-	MVuT5ext
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:8397503-8397723(+)	PUM1	PUM1_1	chr21	8397534	8397540	+	31	37	220	1	9.0101	0.000415	-	-	MVuT5ext
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:8397503-8397723(+)	PUM1	PUM1_1	chr21	8397536	8397542	+	33	39	220	1	12.1616	5.85e-05	-	-	MVuT5ext
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:8397503-8397723(+)	PUM1	PUM1_1	chr21	8397540	8397546	+	37	43	220	1	11.1515	0.000238	-	-	MVuT5ext
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:8397503-8397723(+)	PUM1	PUM1_1	chr21	8397544	8397550	+	41	47	220	1	11.1515	0.000238	-	-	MVuT5ext
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:8397503-8397723(+)	PUM1	PUM1_1	chr21	8397554	8397560	+	51	57	220	1	9.0101	0.000415	-	-	MVuT5ext
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:8397503-8397723(+)	PUM1	PUM1_1	chr21	8397556	8397562	+	53	59	220	1	12.1616	5.85e-05	-	-	MVuT5ext
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:8397503-8397723(+)	PUM1	PUM1_1	chr21	8397680	8397686	+	177	183	220	1	6.9798	0.000768	-	-	MVuT5ext
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:8397243-8397453(+)	PUM1	PUM1_1	chr21	8397336	8397342	+	93	99	210	1	8.83838	0.000473	-	-	MVuT5ext
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:8397243-8397453(+)	PUM1	PUM1_1	chr21	8397362	8397368	+	119	125	210	1	12.1616	5.85e-05	-	-	MVuT5ext
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:43687515-43687745(+)	PUM1	PUM1_1	chr21	43687623	43687629	+	108	114	230	1	9.0101	0.000415	-	-	MVuT5ext
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:32764357-32764462(-)	PUM1	PUM1_2	chr21	32764358	32764366	-	97	105	105	1	6.31313	0.000191	-	-	MVuT5ext
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:36375527-36375647(+)	PUM1	PUM1_2	chr21	36375632	36375640	+	105	113	120	1	-2.35354	0.000906	-	-	MVuT5ext
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:36375527-36375647(+)	PUM1	PUM1_3	chr21	36375534	36375541	+	7	14	120	1	12.5354	6.6e-05	-	-	MVuT5ext
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:36375527-36375647(+)	PUM1	PUM1_3	chr21	36375556	36375563	+	29	36	120	1	4.61616	0.000739	-	-	MVuT5ext
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:5240799-5240909(-)	PUM2	PUM2_1	chr21	5240861	5240868	-	42	49	110	1	14.2121	3.34e-05	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14371114-14371439(-)	PUM2	PUM2_1	chr21	14371383	14371390	-	50	57	325	1	10.6465	9.62e-05	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14371114-14371439(-)	PUM2	PUM2_1	chr21	14371233	14371240	-	200	207	325	1	4.78788	0.000283	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14371114-14371439(-)	PUM2	PUM2_1	chr21	14371201	14371208	-	232	239	325	1	3.40404	0.00091	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14371114-14371439(-)	PUM2	PUM2_1	chr21	14371170	14371177	-	263	270	325	1	4.78788	0.000283	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14371114-14371439(-)	PUM2	PUM2_1	chr21	14371168	14371175	-	265	272	325	1	4.69697	0.000481	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14371114-14371439(-)	PUM2	PUM2_1	chr21	14371143	14371150	-	290	297	325	1	14.2121	3.34e-05	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14485592-14485887(-)	PUM2	PUM2_1	chr21	14485810	14485817	-	71	78	295	1	14.2121	3.34e-05	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14485592-14485887(-)	PUM2	PUM2_1	chr21	14485768	14485775	-	113	120	295	1	12.9798	4.95e-05	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14485592-14485887(-)	PUM2	PUM2_1	chr21	14485730	14485737	-	151	158	295	1	4.63636	0.000578	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14485592-14485887(-)	PUM2	PUM2_1	chr21	14485692	14485699	-	189	196	295	1	4.63636	0.000578	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14485227-14485462(-)	PUM2	PUM2_1	chr21	14485285	14485292	-	171	178	235	1	14.2121	3.34e-05	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14485227-14485462(-)	PUM2	PUM2_1	chr21	14485254	14485261	-	202	209	235	1	4.63636	0.000578	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14962128-14962318(-)	PUM2	PUM2_1	chr21	14962220	14962227	-	92	99	190	2	10.404	0.000113	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14961188-14961428(-)	PUM2	PUM2_1	chr21	14961325	14961332	-	97	104	240	2	12.9798	4.95e-05	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14961653-14962058(-)	PUM2	PUM2_1	chr21	14962047	14962054	-	5	12	405	2	4.69697	0.000481	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14961653-14962058(-)	PUM2	PUM2_1	chr21	14962038	14962045	-	14	21	405	2	4.71717	0.000332	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14961653-14962058(-)	PUM2	PUM2_1	chr21	14962036	14962043	-	16	23	405	2	4.71717	0.000332	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14961653-14962058(-)	PUM2	PUM2_1	chr21	14962034	14962041	-	18	25	405	2	4.71717	0.000332	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14961653-14962058(-)	PUM2	PUM2_1	chr21	14962032	14962039	-	20	27	405	2	4.71717	0.000332	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14961653-14962058(-)	PUM2	PUM2_1	chr21	14962030	14962037	-	22	29	405	2	4.71717	0.000332	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14961653-14962058(-)	PUM2	PUM2_1	chr21	14962028	14962035	-	24	31	405	2	4.71717	0.000332	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14961653-14962058(-)	PUM2	PUM2_1	chr21	14962026	14962033	-	26	33	405	2	4.71717	0.000332	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14961653-14962058(-)	PUM2	PUM2_1	chr21	14962024	14962031	-	28	35	405	2	4.71717	0.000332	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14961653-14962058(-)	PUM2	PUM2_1	chr21	14962022	14962029	-	30	37	405	2	4.71717	0.000332	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14961653-14962058(-)	PUM2	PUM2_1	chr21	14962020	14962027	-	32	39	405	2	4.71717	0.000332	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14961653-14962058(-)	PUM2	PUM2_1	chr21	14962018	14962025	-	34	41	405	2	4.71717	0.000332	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14961653-14962058(-)	PUM2	PUM2_1	chr21	14962016	14962023	-	36	43	405	2	4.71717	0.000332	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14961653-14962058(-)	PUM2	PUM2_1	chr21	14962005	14962012	-	47	54	405	2	14.3636	1.62e-05	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14961653-14962058(-)	PUM2	PUM2_1	chr21	14962003	14962010	-	49	56	405	2	4.71717	0.000332	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14961653-14962058(-)	PUM2	PUM2_1	chr21	14962001	14962008	-	51	58	405	2	4.71717	0.000332	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14961653-14962058(-)	PUM2	PUM2_1	chr21	14961999	14962006	-	53	60	405	2	4.71717	0.000332	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14961653-14962058(-)	PUM2	PUM2_1	chr21	14961997	14962004	-	55	62	405	2	4.71717	0.000332	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14961653-14962058(-)	PUM2	PUM2_1	chr21	14961945	14961952	-	107	114	405	2	14.2121	3.34e-05	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14961653-14962058(-)	PUM2	PUM2_1	chr21	14961861	14961868	-	191	198	405	2	12.0303	6.48e-05	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14961653-14962058(-)	PUM2	PUM2_1	chr21	14961842	14961849	-	210	217	405	2	14.2121	3.34e-05	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14961653-14962058(-)	PUM2	PUM2_1	chr21	14961807	14961814	-	245	252	405	2	4.78788	0.000283	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14961653-14962058(-)	PUM2	PUM2_1	chr21	14961803	14961810	-	249	256	405	2	4.69697	0.000481	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14961653-14962058(-)	PUM2	PUM2_1	chr21	14961777	14961784	-	275	282	405	2	4.69697	0.000481	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14961654-14962059(-)	PUM2	PUM2_1	chr21	14962047	14962054	-	6	13	405	2	4.69697	0.000481	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14961654-14962059(-)	PUM2	PUM2_1	chr21	14962038	14962045	-	15	22	405	2	4.71717	0.000332	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14961654-14962059(-)	PUM2	PUM2_1	chr21	14962036	14962043	-	17	24	405	2	4.71717	0.000332	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14961654-14962059(-)	PUM2	PUM2_1	chr21	14962034	14962041	-	19	26	405	2	4.71717	0.000332	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14961654-14962059(-)	PUM2	PUM2_1	chr21	14962032	14962039	-	21	28	405	2	4.71717	0.000332	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14961654-14962059(-)	PUM2	PUM2_1	chr21	14962030	14962037	-	23	30	405	2	4.71717	0.000332	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14961654-14962059(-)	PUM2	PUM2_1	chr21	14962028	14962035	-	25	32	405	2	4.71717	0.000332	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14961654-14962059(-)	PUM2	PUM2_1	chr21	14962026	14962033	-	27	34	405	2	4.71717	0.000332	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14961654-14962059(-)	PUM2	PUM2_1	chr21	14962024	14962031	-	29	36	405	2	4.71717	0.000332	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14961654-14962059(-)	PUM2	PUM2_1	chr21	14962022	14962029	-	31	38	405	2	4.71717	0.000332	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14961654-14962059(-)	PUM2	PUM2_1	chr21	14962020	14962027	-	33	40	405	2	4.71717	0.000332	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14961654-14962059(-)	PUM2	PUM2_1	chr21	14962018	14962025	-	35	42	405	2	4.71717	0.000332	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14961654-14962059(-)	PUM2	PUM2_1	chr21	14962016	14962023	-	37	44	405	2	4.71717	0.000332	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14961654-14962059(-)	PUM2	PUM2_1	chr21	14962005	14962012	-	48	55	405	2	14.3636	1.62e-05	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14961654-14962059(-)	PUM2	PUM2_1	chr21	14962003	14962010	-	50	57	405	2	4.71717	0.000332	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14961654-14962059(-)	PUM2	PUM2_1	chr21	14962001	14962008	-	52	59	405	2	4.71717	0.000332	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14961654-14962059(-)	PUM2	PUM2_1	chr21	14961999	14962006	-	54	61	405	2	4.71717	0.000332	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14961654-14962059(-)	PUM2	PUM2_1	chr21	14961997	14962004	-	56	63	405	2	4.71717	0.000332	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14961654-14962059(-)	PUM2	PUM2_1	chr21	14961945	14961952	-	108	115	405	2	14.2121	3.34e-05	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14961654-14962059(-)	PUM2	PUM2_1	chr21	14961861	14961868	-	192	199	405	2	12.0303	6.48e-05	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14961654-14962059(-)	PUM2	PUM2_1	chr21	14961842	14961849	-	211	218	405	2	14.2121	3.34e-05	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14961654-14962059(-)	PUM2	PUM2_1	chr21	14961807	14961814	-	246	253	405	2	4.78788	0.000283	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14961654-14962059(-)	PUM2	PUM2_1	chr21	14961803	14961810	-	250	257	405	2	4.69697	0.000481	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14961654-14962059(-)	PUM2	PUM2_1	chr21	14961777	14961784	-	276	283	405	2	4.69697	0.000481	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14961234-14961429(-)	PUM2	PUM2_1	chr21	14961325	14961332	-	98	105	195	2	12.9798	4.95e-05	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14962129-14962314(-)	PUM2	PUM2_1	chr21	14962220	14962227	-	88	95	185	2	10.404	0.000113	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:17788950-17789135(-)	PUM2	PUM2_1	chr21	17789055	17789062	-	74	81	185	2	4.71717	0.000332	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:17788950-17789135(-)	PUM2	PUM2_1	chr21	17789024	17789031	-	105	112	185	2	14.3636	1.62e-05	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:17788966-17789136(-)	PUM2	PUM2_1	chr21	17789055	17789062	-	75	82	170	2	4.71717	0.000332	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:17788966-17789136(-)	PUM2	PUM2_1	chr21	17789024	17789031	-	106	113	170	2	14.3636	1.62e-05	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:28928288-28928403(-)	PUM2	PUM2_1	chr21	28928381	28928388	-	16	23	115	1	4.78788	0.000283	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:28928288-28928403(-)	PUM2	PUM2_1	chr21	28928377	28928384	-	20	27	115	1	12.9798	4.95e-05	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:29345143-29345258(+)	PUM2	PUM2_1	chr21	29345209	29345216	+	66	73	115	1	12.0303	6.48e-05	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:29345713-29345908(+)	PUM2	PUM2_1	chr21	29345791	29345798	+	78	85	195	1	14.2121	3.34e-05	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:29326058-29326273(+)	PUM2	PUM2_1	chr21	29326166	29326173	+	108	115	215	1	12.9798	4.95e-05	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:31668760-31668905(+)	PUM2	PUM2_1	chr21	31668867	31668874	+	107	114	145	1	4.63636	0.000578	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:31671207-31671477(-)	PUM2	PUM2_1	chr21	31671211	31671218	-	260	267	270	1	4.54545	0.000789	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:32628758-32628913(-)	PUM2	PUM2_1	chr21	32628809	32628816	-	98	105	155	1	12.9798	4.95e-05	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:32734523-32735023(-)	PUM2	PUM2_1	chr21	32734896	32734903	-	121	128	500	1	11.8788	8.1e-05	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:32734523-32735023(-)	PUM2	PUM2_1	chr21	32734887	32734894	-	130	137	500	1	14.3636	1.62e-05	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:32734523-32735023(-)	PUM2	PUM2_1	chr21	32734647	32734654	-	370	377	500	1	11.8788	8.1e-05	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:32734523-32735023(-)	PUM2	PUM2_1	chr21	32734638	32734645	-	379	386	500	1	4.63636	0.000578	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:32734523-32735023(-)	PUM2	PUM2_1	chr21	32734630	32734637	-	387	394	500	1	4.69697	0.000481	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:32734523-32735023(-)	PUM2	PUM2_1	chr21	32734626	32734633	-	391	398	500	1	4.71717	0.000332	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:32733913-32734158(-)	PUM2	PUM2_1	chr21	32734055	32734062	-	97	104	245	1	4.78788	0.000283	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:32733913-32734158(-)	PUM2	PUM2_1	chr21	32734041	32734048	-	111	118	245	1	14.2121	3.34e-05	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:32733913-32734158(-)	PUM2	PUM2_1	chr21	32733935	32733942	-	217	224	245	1	4.63636	0.000578	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:33437237-33437521(+)	PUM2	PUM2_1	chr21	33437400	33437407	+	163	170	284	1	3.64646	0.000819	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:33437237-33437521(+)	PUM2	PUM2_1	chr21	33437428	33437435	+	191	198	284	1	4.63636	0.000578	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:33437237-33437521(+)	PUM2	PUM2_1	chr21	33437440	33437447	+	203	210	284	1	14.2121	3.34e-05	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:33437237-33437521(+)	PUM2	PUM2_1	chr21	33437481	33437488	+	244	251	284	1	4.54545	0.000789	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:33450581-33450681(-)	PUM2	PUM2_1	chr21	33450630	33450637	-	45	52	100	1	4.63636	0.000578	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:33450581-33450681(-)	PUM2	PUM2_1	chr21	33450622	33450629	-	53	60	100	1	14.3636	1.62e-05	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:33524008-33524183(-)	PUM2	PUM2_1	chr21	33524100	33524107	-	77	84	175	1	4.78788	0.000283	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:33576514-33576844(+)	PUM2	PUM2_1	chr21	33576643	33576650	+	129	136	330	1	14.2121	3.34e-05	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:33576514-33576844(+)	PUM2	PUM2_1	chr21	33576671	33576678	+	157	164	330	1	4.54545	0.000789	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:33576514-33576844(+)	PUM2	PUM2_1	chr21	33576685	33576692	+	171	178	330	1	4.54545	0.000789	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:33576514-33576844(+)	PUM2	PUM2_1	chr21	33576727	33576734	+	213	220	330	1	4.78788	0.000283	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:33576514-33576844(+)	PUM2	PUM2_1	chr21	33576754	33576761	+	240	247	330	1	4.78788	0.000283	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:33558740-33558910(+)	PUM2	PUM2_1	chr21	33558894	33558901	+	154	161	170	1	5.0303	0.000159	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:33560501-33560667(+)	PUM2	PUM2_1	chr21	33560567	33560574	+	66	73	166	1	14.3636	1.62e-05	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:33560501-33560667(+)	PUM2	PUM2_1	chr21	33560569	33560576	+	68	75	166	1	4.71717	0.000332	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:33560501-33560667(+)	PUM2	PUM2_1	chr21	33560577	33560584	+	76	83	166	1	14.2121	3.34e-05	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:33560501-33560667(+)	PUM2	PUM2_1	chr21	33560583	33560590	+	82	89	166	1	4.71717	0.000332	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:33560501-33560667(+)	PUM2	PUM2_1	chr21	33560585	33560592	+	84	91	166	1	4.71717	0.000332	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:33560501-33560667(+)	PUM2	PUM2_1	chr21	33560587	33560594	+	86	93	166	1	4.71717	0.000332	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:33560501-33560667(+)	PUM2	PUM2_1	chr21	33560605	33560612	+	104	111	166	1	4.78788	0.000283	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:33577980-33578190(-)	PUM2	PUM2_1	chr21	33578071	33578078	-	113	120	210	1	12.0303	6.48e-05	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:34105529-34105709(+)	PUM2	PUM2_1	chr21	34105602	34105609	+	73	80	180	3	12.0303	6.48e-05	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:34105529-34105709(+)	PUM2	PUM2_1	chr21	34105611	34105618	+	82	89	180	3	3.64646	0.000819	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:34098610-34098805(+)	PUM2	PUM2_1	chr21	34098705	34098712	+	95	102	195	2	4.63636	0.000578	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:34099660-34099825(+)	PUM2	PUM2_1	chr21	34099722	34099729	+	62	69	165	2	4.78788	0.000283	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:34099660-34099825(+)	PUM2	PUM2_1	chr21	34099724	34099731	+	64	71	165	2	14.3636	1.62e-05	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:34099660-34099825(+)	PUM2	PUM2_1	chr21	34099762	34099769	+	102	109	165	2	14.2121	3.34e-05	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:34142892-34143034(+)	PUM2	PUM2_1	chr21	34142958	34142965	+	66	73	142	2	4.54545	0.000789	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:34142890-34143080(+)	PUM2	PUM2_1	chr21	34142958	34142965	+	68	75	190	2	4.54545	0.000789	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:34105530-34105710(+)	PUM2	PUM2_1	chr21	34105602	34105609	+	72	79	180	3	12.0303	6.48e-05	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:34105530-34105710(+)	PUM2	PUM2_1	chr21	34105611	34105618	+	81	88	180	3	3.64646	0.000819	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:34100020-34100120(+)	PUM2	PUM2_1	chr21	34100074	34100081	+	54	61	100	2	4.78788	0.000283	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:34100020-34100120(+)	PUM2	PUM2_1	chr21	34100076	34100083	+	56	63	100	2	12.0303	6.48e-05	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:34100017-34100122(+)	PUM2	PUM2_1	chr21	34100074	34100081	+	57	64	105	2	4.78788	0.000283	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:34100017-34100122(+)	PUM2	PUM2_1	chr21	34100076	34100083	+	59	66	105	2	12.0303	6.48e-05	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:34098612-34098807(+)	PUM2	PUM2_1	chr21	34098705	34098712	+	93	100	195	2	4.63636	0.000578	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:34099657-34099827(+)	PUM2	PUM2_1	chr21	34099722	34099729	+	65	72	170	2	4.78788	0.000283	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:34099657-34099827(+)	PUM2	PUM2_1	chr21	34099724	34099731	+	67	74	170	2	14.3636	1.62e-05	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:34099657-34099827(+)	PUM2	PUM2_1	chr21	34099762	34099769	+	105	112	170	2	14.2121	3.34e-05	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:34105532-34105707(+)	PUM2	PUM2_1	chr21	34105602	34105609	+	70	77	175	3	12.0303	6.48e-05	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:34105532-34105707(+)	PUM2	PUM2_1	chr21	34105611	34105618	+	79	86	175	3	3.64646	0.000819	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:34788275-34788440(-)	PUM2	PUM2_1	chr21	34788433	34788440	-	1	8	165	1	4.54545	0.000789	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:34788275-34788440(-)	PUM2	PUM2_1	chr21	34788319	34788326	-	115	122	165	1	4.69697	0.000481	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:34887632-34887827(-)	PUM2	PUM2_1	chr21	34887732	34887739	-	89	96	195	1	14.2121	3.34e-05	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:34887632-34887827(-)	PUM2	PUM2_1	chr21	34887705	34887712	-	116	123	195	1	14.3636	1.62e-05	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:34887632-34887827(-)	PUM2	PUM2_1	chr21	34887697	34887704	-	124	131	195	1	4.71717	0.000332	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:34887632-34887827(-)	PUM2	PUM2_1	chr21	34887695	34887702	-	126	133	195	1	4.71717	0.000332	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:34791730-34791905(-)	PUM2	PUM2_1	chr21	34791779	34791786	-	120	127	175	1	4.63636	0.000578	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:36375227-36375972(+)	PUM2	PUM2_1	chr21	36375534	36375541	+	307	314	745	1	14.2121	3.34e-05	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:36375227-36375972(+)	PUM2	PUM2_1	chr21	36375544	36375551	+	317	324	745	1	4.63636	0.000578	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:36375227-36375972(+)	PUM2	PUM2_1	chr21	36375731	36375738	+	504	511	745	1	4.56566	0.00063	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:36375227-36375972(+)	PUM2	PUM2_1	chr21	36375744	36375751	+	517	524	745	1	4.56566	0.00063	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:36375227-36375972(+)	PUM2	PUM2_1	chr21	36375812	36375819	+	585	592	745	1	4.69697	0.000481	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:36375227-36375972(+)	PUM2	PUM2_1	chr21	36375845	36375852	+	618	625	745	1	4.54545	0.000789	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:36376182-36376512(+)	PUM2	PUM2_1	chr21	36376310	36376317	+	128	135	330	1	14.3636	1.62e-05	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:36376182-36376512(+)	PUM2	PUM2_1	chr21	36376312	36376319	+	130	137	330	1	4.71717	0.000332	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:36376182-36376512(+)	PUM2	PUM2_1	chr21	36376422	36376429	+	240	247	330	1	4.78788	0.000283	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:37202909-37203104(+)	PUM2	PUM2_1	chr21	37203027	37203034	+	118	125	195	1	12.9798	4.95e-05	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:37223419-37223584(-)	PUM2	PUM2_1	chr21	37223515	37223522	-	63	70	165	1	4.54545	0.000789	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:37223419-37223584(-)	PUM2	PUM2_1	chr21	37223459	37223466	-	119	126	165	1	12.0303	6.48e-05	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:37223419-37223584(-)	PUM2	PUM2_1	chr21	37223424	37223431	-	154	161	165	1	4.69697	0.000481	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:37223419-37223584(-)	PUM2	PUM2_1	chr21	37223420	37223427	-	158	165	165	1	4.56566	0.00063	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:37513660-37513945(+)	PUM2	PUM2_1	chr21	37513892	37513899	+	232	239	285	1	4.63636	0.000578	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:37514945-37515225(+)	PUM2	PUM2_1	chr21	37515015	37515022	+	70	77	280	1	4.54545	0.000789	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:37514945-37515225(+)	PUM2	PUM2_1	chr21	37515084	37515091	+	139	146	280	1	4.78788	0.000283	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:37514945-37515225(+)	PUM2	PUM2_1	chr21	37515086	37515093	+	141	148	280	1	12.0303	6.48e-05	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:37514610-37514715(+)	PUM2	PUM2_1	chr21	37514674	37514681	+	64	71	105	1	4.63636	0.000578	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:38156333-38156511(+)	PUM2	PUM2_1	chr21	38156461	38156468	+	128	135	178	1	10.6465	9.62e-05	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:38823543-38823783(+)	PUM2	PUM2_1	chr21	38823684	38823691	+	141	148	240	1	10.6465	9.62e-05	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:38823273-38823463(+)	PUM2	PUM2_1	chr21	38823341	38823348	+	68	75	190	1	14.3636	1.62e-05	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:38823273-38823463(+)	PUM2	PUM2_1	chr21	38823390	38823397	+	117	124	190	1	4.78788	0.000283	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:38823273-38823463(+)	PUM2	PUM2_1	chr21	38823406	38823413	+	133	140	190	1	12.0303	6.48e-05	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:39175448-39175648(-)	PUM2	PUM2_1	chr21	39175562	39175569	-	80	87	200	1	12.0303	6.48e-05	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:39175448-39175648(-)	PUM2	PUM2_1	chr21	39175515	39175522	-	127	134	200	1	8.07071	0.000128	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:39175448-39175648(-)	PUM2	PUM2_1	chr21	39175463	39175470	-	179	186	200	1	4.54545	0.000789	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:41988240-41988435(-)	PUM2	PUM2_1	chr21	41988361	41988368	-	68	75	195	1	14.2121	3.34e-05	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:41988240-41988435(-)	PUM2	PUM2_1	chr21	41988342	41988349	-	87	94	195	1	4.63636	0.000578	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:41988240-41988435(-)	PUM2	PUM2_1	chr21	41988303	41988310	-	126	133	195	1	4.63636	0.000578	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:43760950-43761125(+)	PUM2	PUM2_1	chr21	43761044	43761051	+	94	101	175	1	12.0303	6.48e-05	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:43982948-43983178(+)	PUM2	PUM2_1	chr21	43983059	43983066	+	111	118	230	1	14.2121	3.34e-05	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:44805616-44805856(-)	PUM2	PUM2_1	chr21	44805668	44805675	-	182	189	240	1	10.6465	9.62e-05	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:44805616-44805856(-)	PUM2	PUM2_1	chr21	44805641	44805648	-	209	216	240	1	4.54545	0.000789	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:44805616-44805856(-)	PUM2	PUM2_1	chr21	44805634	44805641	-	216	223	240	1	4.54545	0.000789	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:44861162-44861271(-)	PUM2	PUM2_1	chr21	44861192	44861199	-	73	80	109	1	11.8788	8.1e-05	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:45602615-45602770(+)	PUM2	PUM2_1	chr21	45602699	45602706	+	84	91	155	1	12.0303	6.48e-05	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:45602615-45602770(+)	PUM2	PUM2_1	chr21	45602733	45602740	+	118	125	155	1	4.87879	0.000191	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:46324121-46324226(+)	PUM2	PUM2_1	chr21	46324158	46324165	+	37	44	105	1	14.2121	3.34e-05	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:46569284-46569479(+)	PUM2	PUM2_1	chr21	46569301	46569308	+	17	24	195	1	3.40404	0.00091	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:46569284-46569479(+)	PUM2	PUM2_1	chr21	46569382	46569389	+	98	105	195	1	4.63636	0.000578	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:46569554-46569659(+)	PUM2	PUM2_1	chr21	46569594	46569601	+	40	47	105	1	11.8788	8.1e-05	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:46569554-46569659(+)	PUM2	PUM2_1	chr21	46569651	46569658	+	97	104	105	1	5.0303	0.000159	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14371114-14371439(-)	PUM2	PUM2_2	chr21	14371383	14371390	-	50	57	325	1	6.30303	0.000377	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14371114-14371439(-)	PUM2	PUM2_2	chr21	14371187	14371194	-	246	253	325	1	-3.17172	0.000497	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14485592-14485887(-)	PUM2	PUM2_2	chr21	14485768	14485775	-	113	120	295	1	6.30303	0.000377	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14961188-14961428(-)	PUM2	PUM2_2	chr21	14961325	14961332	-	97	104	240	2	6.30303	0.000377	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14961188-14961428(-)	PUM2	PUM2_2	chr21	14961274	14961281	-	148	155	240	2	-3.24242	0.000754	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14961653-14962058(-)	PUM2	PUM2_2	chr21	14961712	14961719	-	340	347	405	2	6.40404	0.0001	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14961653-14962058(-)	PUM2	PUM2_2	chr21	14961666	14961673	-	386	393	405	2	6.40404	0.0001	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14961654-14962059(-)	PUM2	PUM2_2	chr21	14961712	14961719	-	341	348	405	2	6.40404	0.0001	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14961654-14962059(-)	PUM2	PUM2_2	chr21	14961666	14961673	-	387	394	405	2	6.40404	0.0001	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14961234-14961429(-)	PUM2	PUM2_2	chr21	14961325	14961332	-	98	105	195	2	6.30303	0.000377	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14961234-14961429(-)	PUM2	PUM2_2	chr21	14961274	14961281	-	149	156	195	2	-3.24242	0.000754	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:28928288-28928403(-)	PUM2	PUM2_2	chr21	28928377	28928384	-	20	27	115	1	6.30303	0.000377	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:29326058-29326273(+)	PUM2	PUM2_2	chr21	29326166	29326173	+	108	115	215	1	6.30303	0.000377	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:29326058-29326273(+)	PUM2	PUM2_2	chr21	29326260	29326267	+	202	209	215	1	-3.24242	0.000754	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:32628758-32628913(-)	PUM2	PUM2_2	chr21	32628809	32628816	-	98	105	155	1	6.30303	0.000377	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:33437237-33437521(+)	PUM2	PUM2_2	chr21	33437400	33437407	+	163	170	284	1	15.9798	1.5e-05	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:33504080-33504270(-)	PUM2	PUM2_2	chr21	33504165	33504172	-	99	106	190	1	6.31313	0.000284	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:33576514-33576844(+)	PUM2	PUM2_2	chr21	33576612	33576619	+	98	105	330	1	-3.24242	0.000754	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:34105529-34105709(+)	PUM2	PUM2_2	chr21	34105530	34105537	+	1	8	180	1	-3.17172	0.000497	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:34105529-34105709(+)	PUM2	PUM2_2	chr21	34105611	34105618	+	82	89	180	3	6.30303	0.000377	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:34099660-34099825(+)	PUM2	PUM2_2	chr21	34099702	34099709	+	42	49	165	2	6.31313	0.000284	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:34105530-34105710(+)	PUM2	PUM2_2	chr21	34105611	34105618	+	81	88	180	3	6.30303	0.000377	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:34099657-34099827(+)	PUM2	PUM2_2	chr21	34099702	34099709	+	45	52	170	2	6.31313	0.000284	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:34105532-34105707(+)	PUM2	PUM2_2	chr21	34105611	34105618	+	79	86	175	3	6.30303	0.000377	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:36375227-36375972(+)	PUM2	PUM2_2	chr21	36375341	36375348	+	114	121	745	1	6.31313	0.000284	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:37202909-37203104(+)	PUM2	PUM2_2	chr21	37203027	37203034	+	118	125	195	1	6.30303	0.000377	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:37513660-37513945(+)	PUM2	PUM2_2	chr21	37513708	37513715	+	48	55	285	1	6.40404	0.0001	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:38156333-38156511(+)	PUM2	PUM2_2	chr21	38156461	38156468	+	128	135	178	1	6.30303	0.000377	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:38823543-38823783(+)	PUM2	PUM2_2	chr21	38823684	38823691	+	141	148	240	1	6.30303	0.000377	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:43982948-43983178(+)	PUM2	PUM2_2	chr21	43983067	43983074	+	119	126	230	1	6.31313	0.000284	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:44805616-44805856(-)	PUM2	PUM2_2	chr21	44805847	44805854	-	3	10	240	1	-3.17172	0.000497	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:44805616-44805856(-)	PUM2	PUM2_2	chr21	44805668	44805675	-	182	189	240	1	6.30303	0.000377	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:45602615-45602770(+)	PUM2	PUM2_2	chr21	45602708	45602715	+	93	100	155	1	6.31313	0.000284	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:46569554-46569659(+)	PUM2	PUM2_2	chr21	46569651	46569658	+	97	104	105	1	6.30303	0.000377	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:5240799-5240909(-)	PUM2	PUM2_3	chr21	5240861	5240868	-	42	49	110	1	15.7778	1.72e-05	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14371114-14371439(-)	PUM2	PUM2_3	chr21	14371143	14371150	-	290	297	325	1	15.7778	1.72e-05	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14485592-14485887(-)	PUM2	PUM2_3	chr21	14485810	14485817	-	71	78	295	1	15.7778	1.72e-05	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14485592-14485887(-)	PUM2	PUM2_3	chr21	14485768	14485775	-	113	120	295	1	6.20202	0.000212	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14485592-14485887(-)	PUM2	PUM2_3	chr21	14485730	14485737	-	151	158	295	1	6.20202	0.000212	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14485592-14485887(-)	PUM2	PUM2_3	chr21	14485692	14485699	-	189	196	295	1	6.20202	0.000212	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14485227-14485462(-)	PUM2	PUM2_3	chr21	14485285	14485292	-	171	178	235	1	15.7778	1.72e-05	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14485227-14485462(-)	PUM2	PUM2_3	chr21	14485254	14485261	-	202	209	235	1	6.20202	0.000212	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14962128-14962318(-)	PUM2	PUM2_3	chr21	14962220	14962227	-	92	99	190	2	6.20202	0.000212	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14961188-14961428(-)	PUM2	PUM2_3	chr21	14961325	14961332	-	97	104	240	2	6.20202	0.000212	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14961653-14962058(-)	PUM2	PUM2_3	chr21	14962005	14962012	-	47	54	405	2	6.20202	0.000212	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14961653-14962058(-)	PUM2	PUM2_3	chr21	14961945	14961952	-	107	114	405	2	15.7778	1.72e-05	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14961653-14962058(-)	PUM2	PUM2_3	chr21	14961842	14961849	-	210	217	405	2	15.7778	1.72e-05	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14961654-14962059(-)	PUM2	PUM2_3	chr21	14962005	14962012	-	48	55	405	2	6.20202	0.000212	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14961654-14962059(-)	PUM2	PUM2_3	chr21	14961945	14961952	-	108	115	405	2	15.7778	1.72e-05	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14961654-14962059(-)	PUM2	PUM2_3	chr21	14961842	14961849	-	211	218	405	2	15.7778	1.72e-05	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14961234-14961429(-)	PUM2	PUM2_3	chr21	14961325	14961332	-	98	105	195	2	6.20202	0.000212	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14962129-14962314(-)	PUM2	PUM2_3	chr21	14962220	14962227	-	88	95	185	2	6.20202	0.000212	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:17788950-17789135(-)	PUM2	PUM2_3	chr21	17789024	17789031	-	105	112	185	2	6.20202	0.000212	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:17788966-17789136(-)	PUM2	PUM2_3	chr21	17789024	17789031	-	106	113	170	2	6.20202	0.000212	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:28928288-28928403(-)	PUM2	PUM2_3	chr21	28928377	28928384	-	20	27	115	1	6.20202	0.000212	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:29345713-29345908(+)	PUM2	PUM2_3	chr21	29345791	29345798	+	78	85	195	1	15.7778	1.72e-05	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:29326058-29326273(+)	PUM2	PUM2_3	chr21	29326166	29326173	+	108	115	215	1	6.20202	0.000212	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:31668760-31668905(+)	PUM2	PUM2_3	chr21	31668867	31668874	+	107	114	145	1	6.20202	0.000212	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:31671207-31671477(-)	PUM2	PUM2_3	chr21	31671211	31671218	-	260	267	270	1	6.11111	0.000423	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:32628758-32628913(-)	PUM2	PUM2_3	chr21	32628809	32628816	-	98	105	155	1	6.20202	0.000212	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:32734523-32735023(-)	PUM2	PUM2_3	chr21	32734896	32734903	-	121	128	500	1	6.20202	0.000212	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:32734523-32735023(-)	PUM2	PUM2_3	chr21	32734887	32734894	-	130	137	500	1	6.20202	0.000212	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:32734523-32735023(-)	PUM2	PUM2_3	chr21	32734647	32734654	-	370	377	500	1	6.20202	0.000212	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:32734523-32735023(-)	PUM2	PUM2_3	chr21	32734638	32734645	-	379	386	500	1	6.20202	0.000212	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:32733913-32734158(-)	PUM2	PUM2_3	chr21	32734041	32734048	-	111	118	245	1	15.7778	1.72e-05	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:32733913-32734158(-)	PUM2	PUM2_3	chr21	32733935	32733942	-	217	224	245	1	6.20202	0.000212	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:33437237-33437521(+)	PUM2	PUM2_3	chr21	33437428	33437435	+	191	198	284	1	6.20202	0.000212	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:33437237-33437521(+)	PUM2	PUM2_3	chr21	33437440	33437447	+	203	210	284	1	15.7778	1.72e-05	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:33437237-33437521(+)	PUM2	PUM2_3	chr21	33437481	33437488	+	244	251	284	1	6.11111	0.000423	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:33450581-33450681(-)	PUM2	PUM2_3	chr21	33450630	33450637	-	45	52	100	1	6.20202	0.000212	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:33450581-33450681(-)	PUM2	PUM2_3	chr21	33450622	33450629	-	53	60	100	1	6.20202	0.000212	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:33576514-33576844(+)	PUM2	PUM2_3	chr21	33576643	33576650	+	129	136	330	1	15.7778	1.72e-05	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:33576514-33576844(+)	PUM2	PUM2_3	chr21	33576671	33576678	+	157	164	330	1	6.11111	0.000423	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:33576514-33576844(+)	PUM2	PUM2_3	chr21	33576685	33576692	+	171	178	330	1	6.11111	0.000423	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:33560501-33560667(+)	PUM2	PUM2_3	chr21	33560567	33560574	+	66	73	166	1	6.20202	0.000212	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:33560501-33560667(+)	PUM2	PUM2_3	chr21	33560577	33560584	+	76	83	166	1	15.7778	1.72e-05	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:34098610-34098805(+)	PUM2	PUM2_3	chr21	34098705	34098712	+	95	102	195	2	6.20202	0.000212	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:34099660-34099825(+)	PUM2	PUM2_3	chr21	34099724	34099731	+	64	71	165	2	6.20202	0.000212	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:34099660-34099825(+)	PUM2	PUM2_3	chr21	34099762	34099769	+	102	109	165	2	15.7778	1.72e-05	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:34142892-34143034(+)	PUM2	PUM2_3	chr21	34142958	34142965	+	66	73	142	2	6.11111	0.000423	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:34142890-34143080(+)	PUM2	PUM2_3	chr21	34142958	34142965	+	68	75	190	2	6.11111	0.000423	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:34098612-34098807(+)	PUM2	PUM2_3	chr21	34098705	34098712	+	93	100	195	2	6.20202	0.000212	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:34099657-34099827(+)	PUM2	PUM2_3	chr21	34099724	34099731	+	67	74	170	2	6.20202	0.000212	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:34099657-34099827(+)	PUM2	PUM2_3	chr21	34099762	34099769	+	105	112	170	2	15.7778	1.72e-05	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:34788275-34788440(-)	PUM2	PUM2_3	chr21	34788433	34788440	-	1	8	165	1	6.11111	0.000423	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:34887632-34887827(-)	PUM2	PUM2_3	chr21	34887732	34887739	-	89	96	195	1	15.7778	1.72e-05	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:34887632-34887827(-)	PUM2	PUM2_3	chr21	34887705	34887712	-	116	123	195	1	6.20202	0.000212	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:34791730-34791905(-)	PUM2	PUM2_3	chr21	34791779	34791786	-	120	127	175	1	6.20202	0.000212	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:36375227-36375972(+)	PUM2	PUM2_3	chr21	36375534	36375541	+	307	314	745	1	15.7778	1.72e-05	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:36375227-36375972(+)	PUM2	PUM2_3	chr21	36375544	36375551	+	317	324	745	1	6.20202	0.000212	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:36375227-36375972(+)	PUM2	PUM2_3	chr21	36375731	36375738	+	504	511	745	1	6.13131	0.000264	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:36375227-36375972(+)	PUM2	PUM2_3	chr21	36375744	36375751	+	517	524	745	1	6.13131	0.000264	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:36375227-36375972(+)	PUM2	PUM2_3	chr21	36375845	36375852	+	618	625	745	1	6.11111	0.000423	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:36376182-36376512(+)	PUM2	PUM2_3	chr21	36376310	36376317	+	128	135	330	1	6.20202	0.000212	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:37202909-37203104(+)	PUM2	PUM2_3	chr21	37203027	37203034	+	118	125	195	1	6.20202	0.000212	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:37223419-37223584(-)	PUM2	PUM2_3	chr21	37223515	37223522	-	63	70	165	1	6.11111	0.000423	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:37223419-37223584(-)	PUM2	PUM2_3	chr21	37223420	37223427	-	158	165	165	1	6.13131	0.000264	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:37513660-37513945(+)	PUM2	PUM2_3	chr21	37513892	37513899	+	232	239	285	1	6.20202	0.000212	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:37514945-37515225(+)	PUM2	PUM2_3	chr21	37515015	37515022	+	70	77	280	1	6.11111	0.000423	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:37514610-37514715(+)	PUM2	PUM2_3	chr21	37514674	37514681	+	64	71	105	1	6.20202	0.000212	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:38823273-38823463(+)	PUM2	PUM2_3	chr21	38823341	38823348	+	68	75	190	1	6.20202	0.000212	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:39175448-39175648(-)	PUM2	PUM2_3	chr21	39175463	39175470	-	179	186	200	1	6.11111	0.000423	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:41988240-41988435(-)	PUM2	PUM2_3	chr21	41988361	41988368	-	68	75	195	1	15.7778	1.72e-05	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:41988240-41988435(-)	PUM2	PUM2_3	chr21	41988342	41988349	-	87	94	195	1	6.20202	0.000212	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:41988240-41988435(-)	PUM2	PUM2_3	chr21	41988303	41988310	-	126	133	195	1	6.20202	0.000212	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:43982948-43983178(+)	PUM2	PUM2_3	chr21	43983059	43983066	+	111	118	230	1	15.7778	1.72e-05	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:44805616-44805856(-)	PUM2	PUM2_3	chr21	44805641	44805648	-	209	216	240	1	6.11111	0.000423	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:44805616-44805856(-)	PUM2	PUM2_3	chr21	44805634	44805641	-	216	223	240	1	6.11111	0.000423	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:44861162-44861271(-)	PUM2	PUM2_3	chr21	44861192	44861199	-	73	80	109	1	6.20202	0.000212	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:45602615-45602770(+)	PUM2	PUM2_3	chr21	45602733	45602740	+	118	125	155	1	6.20202	0.000212	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:46324121-46324226(+)	PUM2	PUM2_3	chr21	46324158	46324165	+	37	44	105	1	15.7778	1.72e-05	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:46569284-46569479(+)	PUM2	PUM2_3	chr21	46569382	46569389	+	98	105	195	1	6.20202	0.000212	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:46569554-46569659(+)	PUM2	PUM2_3	chr21	46569594	46569601	+	40	47	105	1	6.20202	0.000212	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:5240799-5240909(-)	PUM2	PUM2_4	chr21	5240861	5240868	-	42	49	110	1	6.20202	0.000255	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14371114-14371439(-)	PUM2	PUM2_4	chr21	14371143	14371150	-	290	297	325	1	6.20202	0.000255	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14485592-14485887(-)	PUM2	PUM2_4	chr21	14485810	14485817	-	71	78	295	1	6.20202	0.000255	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14485592-14485887(-)	PUM2	PUM2_4	chr21	14485768	14485775	-	113	120	295	1	6.20202	0.000255	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14485227-14485462(-)	PUM2	PUM2_4	chr21	14485393	14485400	-	63	70	235	1	-3.30303	0.0008	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14485227-14485462(-)	PUM2	PUM2_4	chr21	14485285	14485292	-	171	178	235	1	6.20202	0.000255	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14962128-14962318(-)	PUM2	PUM2_4	chr21	14962220	14962227	-	92	99	190	2	15.8485	1.64e-05	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14962128-14962318(-)	PUM2	PUM2_4	chr21	14962178	14962185	-	134	141	190	2	6.20202	0.000255	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14961188-14961428(-)	PUM2	PUM2_4	chr21	14961325	14961332	-	97	104	240	2	6.20202	0.000255	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14961653-14962058(-)	PUM2	PUM2_4	chr21	14962005	14962012	-	47	54	405	2	6.20202	0.000255	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14961653-14962058(-)	PUM2	PUM2_4	chr21	14961945	14961952	-	107	114	405	2	6.20202	0.000255	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14961653-14962058(-)	PUM2	PUM2_4	chr21	14961842	14961849	-	210	217	405	2	6.20202	0.000255	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14961654-14962059(-)	PUM2	PUM2_4	chr21	14962005	14962012	-	48	55	405	2	6.20202	0.000255	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14961654-14962059(-)	PUM2	PUM2_4	chr21	14961945	14961952	-	108	115	405	2	6.20202	0.000255	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14961654-14962059(-)	PUM2	PUM2_4	chr21	14961842	14961849	-	211	218	405	2	6.20202	0.000255	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14961234-14961429(-)	PUM2	PUM2_4	chr21	14961325	14961332	-	98	105	195	2	6.20202	0.000255	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14962129-14962314(-)	PUM2	PUM2_4	chr21	14962220	14962227	-	88	95	185	2	15.8485	1.64e-05	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14962129-14962314(-)	PUM2	PUM2_4	chr21	14962178	14962185	-	130	137	185	2	6.20202	0.000255	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:17788950-17789135(-)	PUM2	PUM2_4	chr21	17789024	17789031	-	105	112	185	2	6.20202	0.000255	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:17788966-17789136(-)	PUM2	PUM2_4	chr21	17789024	17789031	-	106	113	170	2	6.20202	0.000255	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:28928288-28928403(-)	PUM2	PUM2_4	chr21	28928377	28928384	-	20	27	115	1	6.20202	0.000255	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:28928288-28928403(-)	PUM2	PUM2_4	chr21	28928347	28928354	-	50	57	115	1	-3.30303	0.0008	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:29345713-29345908(+)	PUM2	PUM2_4	chr21	29345791	29345798	+	78	85	195	1	6.20202	0.000255	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:29326058-29326273(+)	PUM2	PUM2_4	chr21	29326130	29326137	+	72	79	215	1	-3.30303	0.0008	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:29326058-29326273(+)	PUM2	PUM2_4	chr21	29326166	29326173	+	108	115	215	1	6.20202	0.000255	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:32628758-32628913(-)	PUM2	PUM2_4	chr21	32628809	32628816	-	98	105	155	1	6.20202	0.000255	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:32734523-32735023(-)	PUM2	PUM2_4	chr21	32734887	32734894	-	130	137	500	1	6.20202	0.000255	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:32733913-32734158(-)	PUM2	PUM2_4	chr21	32734041	32734048	-	111	118	245	1	6.20202	0.000255	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:33437237-33437521(+)	PUM2	PUM2_4	chr21	33437440	33437447	+	203	210	284	1	6.20202	0.000255	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:33450581-33450681(-)	PUM2	PUM2_4	chr21	33450622	33450629	-	53	60	100	1	6.20202	0.000255	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:33524008-33524183(-)	PUM2	PUM2_4	chr21	33524055	33524062	-	122	129	175	1	-3.30303	0.0008	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:33576514-33576844(+)	PUM2	PUM2_4	chr21	33576568	33576575	+	54	61	330	1	6.18182	0.000406	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:33576514-33576844(+)	PUM2	PUM2_4	chr21	33576643	33576650	+	129	136	330	1	6.20202	0.000255	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:33560501-33560667(+)	PUM2	PUM2_4	chr21	33560567	33560574	+	66	73	166	1	6.20202	0.000255	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:33560501-33560667(+)	PUM2	PUM2_4	chr21	33560577	33560584	+	76	83	166	1	6.20202	0.000255	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:33577980-33578190(-)	PUM2	PUM2_4	chr21	33578135	33578142	-	49	56	210	1	6.20202	0.000255	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:34099660-34099825(+)	PUM2	PUM2_4	chr21	34099724	34099731	+	64	71	165	2	6.20202	0.000255	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:34099660-34099825(+)	PUM2	PUM2_4	chr21	34099762	34099769	+	102	109	165	2	6.20202	0.000255	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:34099657-34099827(+)	PUM2	PUM2_4	chr21	34099724	34099731	+	67	74	170	2	6.20202	0.000255	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:34099657-34099827(+)	PUM2	PUM2_4	chr21	34099762	34099769	+	105	112	170	2	6.20202	0.000255	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:34887632-34887827(-)	PUM2	PUM2_4	chr21	34887732	34887739	-	89	96	195	1	6.20202	0.000255	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:34887632-34887827(-)	PUM2	PUM2_4	chr21	34887705	34887712	-	116	123	195	1	6.20202	0.000255	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:36375227-36375972(+)	PUM2	PUM2_4	chr21	36375230	36375237	+	3	10	745	1	-3.30303	0.0008	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:36375227-36375972(+)	PUM2	PUM2_4	chr21	36375236	36375243	+	9	16	745	1	-3.30303	0.0008	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:36375227-36375972(+)	PUM2	PUM2_4	chr21	36375374	36375381	+	147	154	745	1	6.20202	0.000255	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:36375227-36375972(+)	PUM2	PUM2_4	chr21	36375534	36375541	+	307	314	745	1	6.20202	0.000255	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:36376182-36376512(+)	PUM2	PUM2_4	chr21	36376310	36376317	+	128	135	330	1	6.20202	0.000255	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:37202909-37203104(+)	PUM2	PUM2_4	chr21	37203027	37203034	+	118	125	195	1	6.20202	0.000255	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:37514610-37514715(+)	PUM2	PUM2_4	chr21	37514693	37514700	+	83	90	105	1	-3.30303	0.0008	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:38823273-38823463(+)	PUM2	PUM2_4	chr21	38823341	38823348	+	68	75	190	1	6.20202	0.000255	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:39175448-39175648(-)	PUM2	PUM2_4	chr21	39175515	39175522	-	127	134	200	1	6.27273	0.000156	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:39175448-39175648(-)	PUM2	PUM2_4	chr21	39175449	39175456	-	193	200	200	1	-3.30303	0.0008	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:41988240-41988435(-)	PUM2	PUM2_4	chr21	41988373	41988380	-	56	63	195	1	6.18182	0.000406	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:41988240-41988435(-)	PUM2	PUM2_4	chr21	41988361	41988368	-	68	75	195	1	6.20202	0.000255	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:41988240-41988435(-)	PUM2	PUM2_4	chr21	41988324	41988331	-	105	112	195	1	6.18182	0.000406	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:43982948-43983178(+)	PUM2	PUM2_4	chr21	43983059	43983066	+	111	118	230	1	6.20202	0.000255	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:46324121-46324226(+)	PUM2	PUM2_4	chr21	46324158	46324165	+	37	44	105	1	6.20202	0.000255	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:5240799-5240909(-)	PUM2	PUM2_5	chr21	5240861	5240870	-	40	49	110	1	13.7677	4.96e-06	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14371114-14371439(-)	PUM2	PUM2_5	chr21	14371383	14371392	-	48	57	325	1	11.4646	6.71e-05	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14371114-14371439(-)	PUM2	PUM2_5	chr21	14371231	14371240	-	200	209	325	1	7.60606	0.000682	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14371114-14371439(-)	PUM2	PUM2_5	chr21	14371201	14371210	-	230	239	325	1	8.43434	0.000461	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14371114-14371439(-)	PUM2	PUM2_5	chr21	14371170	14371179	-	261	270	325	1	8.27273	0.000508	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14371114-14371439(-)	PUM2	PUM2_5	chr21	14371143	14371152	-	288	297	325	1	11.9293	4.81e-05	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14485592-14485887(-)	PUM2	PUM2_5	chr21	14485810	14485819	-	69	78	295	1	13.7677	4.96e-06	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14485592-14485887(-)	PUM2	PUM2_5	chr21	14485768	14485777	-	111	120	295	1	13.2727	8.98e-06	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14485592-14485887(-)	PUM2	PUM2_5	chr21	14485719	14485728	-	160	169	295	1	8.47475	0.000457	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14485227-14485462(-)	PUM2	PUM2_5	chr21	14485285	14485294	-	169	178	235	1	11.1212	8.74e-05	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14962128-14962318(-)	PUM2	PUM2_5	chr21	14962220	14962229	-	90	99	190	2	10.0909	0.00019	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14961188-14961428(-)	PUM2	PUM2_5	chr21	14961325	14961334	-	95	104	240	2	11.6566	6.11e-05	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14961653-14962058(-)	PUM2	PUM2_5	chr21	14962045	14962054	-	5	14	405	2	7.66667	0.000664	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14961653-14962058(-)	PUM2	PUM2_5	chr21	14962038	14962047	-	12	21	405	2	8.90909	0.00037	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14961653-14962058(-)	PUM2	PUM2_5	chr21	14962036	14962045	-	14	23	405	2	11.0303	9.55e-05	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14961653-14962058(-)	PUM2	PUM2_5	chr21	14962034	14962043	-	16	25	405	2	10.2424	0.000165	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14961653-14962058(-)	PUM2	PUM2_5	chr21	14962032	14962041	-	18	27	405	2	10.2424	0.000165	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14961653-14962058(-)	PUM2	PUM2_5	chr21	14962030	14962039	-	20	29	405	2	10.2424	0.000165	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14961653-14962058(-)	PUM2	PUM2_5	chr21	14962028	14962037	-	22	31	405	2	10.2424	0.000165	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14961653-14962058(-)	PUM2	PUM2_5	chr21	14962026	14962035	-	24	33	405	2	10.2424	0.000165	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14961653-14962058(-)	PUM2	PUM2_5	chr21	14962024	14962033	-	26	35	405	2	10.2424	0.000165	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14961653-14962058(-)	PUM2	PUM2_5	chr21	14962022	14962031	-	28	37	405	2	10.2424	0.000165	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14961653-14962058(-)	PUM2	PUM2_5	chr21	14962020	14962029	-	30	39	405	2	10.2424	0.000165	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14961653-14962058(-)	PUM2	PUM2_5	chr21	14962018	14962027	-	32	41	405	2	10.2424	0.000165	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14961653-14962058(-)	PUM2	PUM2_5	chr21	14962016	14962025	-	34	43	405	2	10.2424	0.000165	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14961653-14962058(-)	PUM2	PUM2_5	chr21	14962014	14962023	-	36	45	405	2	6.91919	0.000926	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14961653-14962058(-)	PUM2	PUM2_5	chr21	14962005	14962014	-	45	54	405	2	13.9192	3.92e-06	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14961653-14962058(-)	PUM2	PUM2_5	chr21	14962003	14962012	-	47	56	405	2	9.43434	0.00027	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14961653-14962058(-)	PUM2	PUM2_5	chr21	14962001	14962010	-	49	58	405	2	10.2424	0.000165	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14961653-14962058(-)	PUM2	PUM2_5	chr21	14961999	14962008	-	51	60	405	2	10.2424	0.000165	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14961653-14962058(-)	PUM2	PUM2_5	chr21	14961997	14962006	-	53	62	405	2	10.2424	0.000165	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14961653-14962058(-)	PUM2	PUM2_5	chr21	14961995	14962004	-	55	64	405	2	9.52525	0.000262	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14961653-14962058(-)	PUM2	PUM2_5	chr21	14961945	14961954	-	105	114	405	2	10.8384	0.000118	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14961653-14962058(-)	PUM2	PUM2_5	chr21	14961908	14961917	-	142	151	405	2	8.29293	0.000501	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14961653-14962058(-)	PUM2	PUM2_5	chr21	14961861	14961870	-	189	198	405	2	10.5455	0.000137	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14961653-14962058(-)	PUM2	PUM2_5	chr21	14961850	14961859	-	200	209	405	2	7.50505	0.000711	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14961653-14962058(-)	PUM2	PUM2_5	chr21	14961842	14961851	-	208	217	405	2	11.1212	8.74e-05	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14961653-14962058(-)	PUM2	PUM2_5	chr21	14961777	14961786	-	273	282	405	2	10.8384	0.000118	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14961653-14962058(-)	PUM2	PUM2_5	chr21	14961704	14961713	-	346	355	405	2	7.15152	0.000846	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14961654-14962059(-)	PUM2	PUM2_5	chr21	14962045	14962054	-	6	15	405	2	7.66667	0.000664	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14961654-14962059(-)	PUM2	PUM2_5	chr21	14962038	14962047	-	13	22	405	2	8.90909	0.00037	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14961654-14962059(-)	PUM2	PUM2_5	chr21	14962036	14962045	-	15	24	405	2	11.0303	9.55e-05	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14961654-14962059(-)	PUM2	PUM2_5	chr21	14962034	14962043	-	17	26	405	2	10.2424	0.000165	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14961654-14962059(-)	PUM2	PUM2_5	chr21	14962032	14962041	-	19	28	405	2	10.2424	0.000165	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14961654-14962059(-)	PUM2	PUM2_5	chr21	14962030	14962039	-	21	30	405	2	10.2424	0.000165	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14961654-14962059(-)	PUM2	PUM2_5	chr21	14962028	14962037	-	23	32	405	2	10.2424	0.000165	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14961654-14962059(-)	PUM2	PUM2_5	chr21	14962026	14962035	-	25	34	405	2	10.2424	0.000165	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14961654-14962059(-)	PUM2	PUM2_5	chr21	14962024	14962033	-	27	36	405	2	10.2424	0.000165	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14961654-14962059(-)	PUM2	PUM2_5	chr21	14962022	14962031	-	29	38	405	2	10.2424	0.000165	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14961654-14962059(-)	PUM2	PUM2_5	chr21	14962020	14962029	-	31	40	405	2	10.2424	0.000165	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14961654-14962059(-)	PUM2	PUM2_5	chr21	14962018	14962027	-	33	42	405	2	10.2424	0.000165	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14961654-14962059(-)	PUM2	PUM2_5	chr21	14962016	14962025	-	35	44	405	2	10.2424	0.000165	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14961654-14962059(-)	PUM2	PUM2_5	chr21	14962014	14962023	-	37	46	405	2	6.91919	0.000926	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14961654-14962059(-)	PUM2	PUM2_5	chr21	14962005	14962014	-	46	55	405	2	13.9192	3.92e-06	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14961654-14962059(-)	PUM2	PUM2_5	chr21	14962003	14962012	-	48	57	405	2	9.43434	0.00027	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14961654-14962059(-)	PUM2	PUM2_5	chr21	14962001	14962010	-	50	59	405	2	10.2424	0.000165	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14961654-14962059(-)	PUM2	PUM2_5	chr21	14961999	14962008	-	52	61	405	2	10.2424	0.000165	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14961654-14962059(-)	PUM2	PUM2_5	chr21	14961997	14962006	-	54	63	405	2	10.2424	0.000165	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14961654-14962059(-)	PUM2	PUM2_5	chr21	14961995	14962004	-	56	65	405	2	9.52525	0.000262	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14961654-14962059(-)	PUM2	PUM2_5	chr21	14961945	14961954	-	106	115	405	2	10.8384	0.000118	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14961654-14962059(-)	PUM2	PUM2_5	chr21	14961908	14961917	-	143	152	405	2	8.29293	0.000501	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14961654-14962059(-)	PUM2	PUM2_5	chr21	14961861	14961870	-	190	199	405	2	10.5455	0.000137	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14961654-14962059(-)	PUM2	PUM2_5	chr21	14961850	14961859	-	201	210	405	2	7.50505	0.000711	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14961654-14962059(-)	PUM2	PUM2_5	chr21	14961842	14961851	-	209	218	405	2	11.1212	8.74e-05	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14961654-14962059(-)	PUM2	PUM2_5	chr21	14961777	14961786	-	274	283	405	2	10.8384	0.000118	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14961654-14962059(-)	PUM2	PUM2_5	chr21	14961704	14961713	-	347	356	405	2	7.15152	0.000846	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14961234-14961429(-)	PUM2	PUM2_5	chr21	14961325	14961334	-	96	105	195	2	11.6566	6.11e-05	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:14962129-14962314(-)	PUM2	PUM2_5	chr21	14962220	14962229	-	86	95	185	2	10.0909	0.00019	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:17788950-17789135(-)	PUM2	PUM2_5	chr21	17789055	17789064	-	72	81	185	2	8.12121	0.000548	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:17788950-17789135(-)	PUM2	PUM2_5	chr21	17789053	17789062	-	74	83	185	2	10.3131	0.00016	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:17788950-17789135(-)	PUM2	PUM2_5	chr21	17789024	17789033	-	103	112	185	2	12.0404	4.11e-05	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:17788950-17789135(-)	PUM2	PUM2_5	chr21	17789022	17789031	-	105	114	185	2	7.45455	0.000727	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:17788966-17789136(-)	PUM2	PUM2_5	chr21	17789055	17789064	-	73	82	170	2	8.12121	0.000548	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:17788966-17789136(-)	PUM2	PUM2_5	chr21	17789053	17789062	-	75	84	170	2	10.3131	0.00016	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:17788966-17789136(-)	PUM2	PUM2_5	chr21	17789024	17789033	-	104	113	170	2	12.0404	4.11e-05	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:17788966-17789136(-)	PUM2	PUM2_5	chr21	17789022	17789031	-	106	115	170	2	7.45455	0.000727	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:28928288-28928403(-)	PUM2	PUM2_5	chr21	28928377	28928386	-	18	27	115	1	13.5354	7.95e-06	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:29345143-29345258(+)	PUM2	PUM2_5	chr21	29345207	29345216	+	64	73	115	1	12.3737	2.89e-05	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:29345713-29345908(+)	PUM2	PUM2_5	chr21	29345789	29345798	+	76	85	195	1	12.1515	3.69e-05	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:29326058-29326273(+)	PUM2	PUM2_5	chr21	29326164	29326173	+	106	115	215	1	11.6768	6.01e-05	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:31668760-31668905(+)	PUM2	PUM2_5	chr21	31668798	31668807	+	38	47	145	1	6.87879	0.000939	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:31671207-31671477(-)	PUM2	PUM2_5	chr21	31671335	31671344	-	134	143	270	1	8.55556	0.000433	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:32628758-32628913(-)	PUM2	PUM2_5	chr21	32628809	32628818	-	96	105	155	1	12.7071	2.2e-05	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:32734523-32735023(-)	PUM2	PUM2_5	chr21	32734896	32734905	-	119	128	500	1	11.4545	6.81e-05	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:32734523-32735023(-)	PUM2	PUM2_5	chr21	32734887	32734896	-	128	137	500	1	14.7071	9.81e-07	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:32734523-32735023(-)	PUM2	PUM2_5	chr21	32734885	32734894	-	130	139	500	1	7.45455	0.000727	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:32734523-32735023(-)	PUM2	PUM2_5	chr21	32734879	32734888	-	136	145	500	1	10.2323	0.000167	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:32734523-32735023(-)	PUM2	PUM2_5	chr21	32734862	32734871	-	153	162	500	1	7.77778	0.00064	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:32734523-32735023(-)	PUM2	PUM2_5	chr21	32734647	32734656	-	368	377	500	1	10.404	0.000149	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:32734523-32735023(-)	PUM2	PUM2_5	chr21	32734638	32734647	-	377	386	500	1	8.50505	0.000445	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:32734523-32735023(-)	PUM2	PUM2_5	chr21	32734626	32734635	-	389	398	500	1	8.41414	0.000465	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:32734523-32735023(-)	PUM2	PUM2_5	chr21	32734624	32734633	-	391	400	500	1	9.52525	0.000262	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:32733913-32734158(-)	PUM2	PUM2_5	chr21	32734041	32734050	-	109	118	245	1	12.7172	2.11e-05	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:32733913-32734158(-)	PUM2	PUM2_5	chr21	32733941	32733950	-	209	218	245	1	8.0	0.000585	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:32733913-32734158(-)	PUM2	PUM2_5	chr21	32733935	32733944	-	215	224	245	1	9.31313	0.00029	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:33437237-33437521(+)	PUM2	PUM2_5	chr21	33437398	33437407	+	161	170	284	1	8.80808	0.000397	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:33437237-33437521(+)	PUM2	PUM2_5	chr21	33437426	33437435	+	189	198	284	1	8.26263	0.000513	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:33437237-33437521(+)	PUM2	PUM2_5	chr21	33437438	33437447	+	201	210	284	1	11.9394	4.69e-05	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:33437237-33437521(+)	PUM2	PUM2_5	chr21	33437493	33437502	+	256	265	284	1	10.9091	0.000109	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:33450581-33450681(-)	PUM2	PUM2_5	chr21	33450622	33450631	-	51	60	100	1	13.9192	3.92e-06	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:33504080-33504270(-)	PUM2	PUM2_5	chr21	33504165	33504174	-	97	106	190	1	6.72727	0.000983	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:33524008-33524183(-)	PUM2	PUM2_5	chr21	33524156	33524165	-	19	28	175	1	9.38384	0.000279	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:33524008-33524183(-)	PUM2	PUM2_5	chr21	33524135	33524144	-	40	49	175	1	8.35354	0.000481	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:33524008-33524183(-)	PUM2	PUM2_5	chr21	33524083	33524092	-	92	101	175	1	8.48485	0.000453	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:33524008-33524183(-)	PUM2	PUM2_5	chr21	33524047	33524056	-	128	137	175	1	10.9293	0.000107	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:33524008-33524183(-)	PUM2	PUM2_5	chr21	33524030	33524039	-	145	154	175	1	8.61616	0.000424	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:33576514-33576844(+)	PUM2	PUM2_5	chr21	33576641	33576650	+	127	136	330	1	11.6263	6.33e-05	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:33576514-33576844(+)	PUM2	PUM2_5	chr21	33576669	33576678	+	155	164	330	1	9.56566	0.000256	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:33576514-33576844(+)	PUM2	PUM2_5	chr21	33576683	33576692	+	169	178	330	1	9.54545	0.00026	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:33576514-33576844(+)	PUM2	PUM2_5	chr21	33576725	33576734	+	211	220	330	1	9.9899	0.000199	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:33576514-33576844(+)	PUM2	PUM2_5	chr21	33576754	33576763	+	240	249	330	1	7.64646	0.000672	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:33558740-33558910(+)	PUM2	PUM2_5	chr21	33558832	33558841	+	92	101	170	1	7.71717	0.000655	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:33558740-33558910(+)	PUM2	PUM2_5	chr21	33558869	33558878	+	129	138	170	1	7.56566	0.000695	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:33558740-33558910(+)	PUM2	PUM2_5	chr21	33558892	33558901	+	152	161	170	1	10.1111	0.000186	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:33560501-33560667(+)	PUM2	PUM2_5	chr21	33560565	33560574	+	64	73	166	1	12.0404	4.11e-05	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:33560501-33560667(+)	PUM2	PUM2_5	chr21	33560567	33560576	+	66	75	166	1	9.43434	0.00027	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:33560501-33560667(+)	PUM2	PUM2_5	chr21	33560569	33560578	+	68	77	166	1	8.26263	0.000513	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:33560501-33560667(+)	PUM2	PUM2_5	chr21	33560575	33560584	+	74	83	166	1	12.9798	1.4e-05	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:33560501-33560667(+)	PUM2	PUM2_5	chr21	33560581	33560590	+	80	89	166	1	9.19192	0.000314	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:33560501-33560667(+)	PUM2	PUM2_5	chr21	33560583	33560592	+	82	91	166	1	10.2424	0.000165	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:33560501-33560667(+)	PUM2	PUM2_5	chr21	33560585	33560594	+	84	93	166	1	10.2424	0.000165	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:33560501-33560667(+)	PUM2	PUM2_5	chr21	33560587	33560596	+	86	95	166	1	7.34343	0.000766	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:33577980-33578190(-)	PUM2	PUM2_5	chr21	33578071	33578080	-	111	120	210	1	12.9394	1.5e-05	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:34105529-34105709(+)	PUM2	PUM2_5	chr21	34105600	34105609	+	71	80	180	3	10.2525	0.000164	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:34105529-34105709(+)	PUM2	PUM2_5	chr21	34105609	34105618	+	80	89	180	3	10.7475	0.000121	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:34105529-34105709(+)	PUM2	PUM2_5	chr21	34105653	34105662	+	124	133	180	3	7.06061	0.000878	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:34098610-34098805(+)	PUM2	PUM2_5	chr21	34098703	34098712	+	93	102	195	2	8.50505	0.000445	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:34099660-34099825(+)	PUM2	PUM2_5	chr21	34099720	34099729	+	60	69	165	2	8.27273	0.000508	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:34099660-34099825(+)	PUM2	PUM2_5	chr21	34099722	34099731	+	62	71	165	2	13.1111	1.1e-05	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:34099660-34099825(+)	PUM2	PUM2_5	chr21	34099760	34099769	+	100	109	165	2	12.1515	3.69e-05	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:34105530-34105710(+)	PUM2	PUM2_5	chr21	34105600	34105609	+	70	79	180	3	10.2525	0.000164	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:34105530-34105710(+)	PUM2	PUM2_5	chr21	34105609	34105618	+	79	88	180	3	10.7475	0.000121	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:34105530-34105710(+)	PUM2	PUM2_5	chr21	34105653	34105662	+	123	132	180	3	7.06061	0.000878	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:34100020-34100120(+)	PUM2	PUM2_5	chr21	34100072	34100081	+	52	61	100	2	7.25253	0.000803	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:34100020-34100120(+)	PUM2	PUM2_5	chr21	34100074	34100083	+	54	63	100	2	12.3939	2.8e-05	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:34100020-34100120(+)	PUM2	PUM2_5	chr21	34100082	34100091	+	62	71	100	2	9.24242	0.000306	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:34100017-34100122(+)	PUM2	PUM2_5	chr21	34100072	34100081	+	55	64	105	2	7.25253	0.000803	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:34100017-34100122(+)	PUM2	PUM2_5	chr21	34100074	34100083	+	57	66	105	2	12.3939	2.8e-05	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:34100017-34100122(+)	PUM2	PUM2_5	chr21	34100082	34100091	+	65	74	105	2	9.24242	0.000306	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:34098612-34098807(+)	PUM2	PUM2_5	chr21	34098703	34098712	+	91	100	195	2	8.50505	0.000445	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:34099657-34099827(+)	PUM2	PUM2_5	chr21	34099720	34099729	+	63	72	170	2	8.27273	0.000508	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:34099657-34099827(+)	PUM2	PUM2_5	chr21	34099722	34099731	+	65	74	170	2	13.1111	1.1e-05	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:34099657-34099827(+)	PUM2	PUM2_5	chr21	34099760	34099769	+	103	112	170	2	12.1515	3.69e-05	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:34105532-34105707(+)	PUM2	PUM2_5	chr21	34105600	34105609	+	68	77	175	3	10.2525	0.000164	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:34105532-34105707(+)	PUM2	PUM2_5	chr21	34105609	34105618	+	77	86	175	3	10.7475	0.000121	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:34105532-34105707(+)	PUM2	PUM2_5	chr21	34105653	34105662	+	121	130	175	3	7.06061	0.000878	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:34788275-34788440(-)	PUM2	PUM2_5	chr21	34788319	34788328	-	113	122	165	1	9.17172	0.00032	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:34887632-34887827(-)	PUM2	PUM2_5	chr21	34887755	34887764	-	64	73	195	1	6.70707	0.000993	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:34887632-34887827(-)	PUM2	PUM2_5	chr21	34887737	34887746	-	82	91	195	1	7.24242	0.000807	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:34887632-34887827(-)	PUM2	PUM2_5	chr21	34887732	34887741	-	87	96	195	1	12.7172	2.11e-05	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:34887632-34887827(-)	PUM2	PUM2_5	chr21	34887705	34887714	-	114	123	195	1	13.9192	3.92e-06	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:34887632-34887827(-)	PUM2	PUM2_5	chr21	34887703	34887712	-	116	125	195	1	8.71717	0.000411	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:34887632-34887827(-)	PUM2	PUM2_5	chr21	34887697	34887706	-	122	131	195	1	9.17172	0.00032	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:34887632-34887827(-)	PUM2	PUM2_5	chr21	34887695	34887704	-	124	133	195	1	11.0303	9.55e-05	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:36375227-36375972(+)	PUM2	PUM2_5	chr21	36375339	36375348	+	112	121	745	1	7.25253	0.000803	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:36375227-36375972(+)	PUM2	PUM2_5	chr21	36375372	36375381	+	145	154	745	1	7.20202	0.00083	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:36375227-36375972(+)	PUM2	PUM2_5	chr21	36375532	36375541	+	305	314	745	1	11.9293	4.81e-05	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:36375227-36375972(+)	PUM2	PUM2_5	chr21	36375542	36375551	+	315	324	745	1	10.101	0.000188	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:36375227-36375972(+)	PUM2	PUM2_5	chr21	36375655	36375664	+	428	437	745	1	7.67677	0.000661	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:36375227-36375972(+)	PUM2	PUM2_5	chr21	36375742	36375751	+	515	524	745	1	9.0202	0.000355	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:36375227-36375972(+)	PUM2	PUM2_5	chr21	36375810	36375819	+	583	592	745	1	12.101	3.79e-05	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:36375227-36375972(+)	PUM2	PUM2_5	chr21	36375812	36375821	+	585	594	745	1	7.77778	0.00064	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:36375227-36375972(+)	PUM2	PUM2_5	chr21	36375929	36375938	+	702	711	745	1	7.92929	0.000611	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:36376182-36376512(+)	PUM2	PUM2_5	chr21	36376308	36376317	+	126	135	330	1	13.9192	3.92e-06	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:36376182-36376512(+)	PUM2	PUM2_5	chr21	36376310	36376319	+	128	137	330	1	9.43434	0.00027	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:36376182-36376512(+)	PUM2	PUM2_5	chr21	36376343	36376352	+	161	170	330	1	6.92929	0.000923	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:36376182-36376512(+)	PUM2	PUM2_5	chr21	36376469	36376478	+	287	296	330	1	9.29293	0.000294	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:37202909-37203104(+)	PUM2	PUM2_5	chr21	37203025	37203034	+	116	125	195	1	14.3232	1.95e-06	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:37223419-37223584(-)	PUM2	PUM2_5	chr21	37223459	37223468	-	117	126	165	1	11.0606	9.24e-05	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:37223419-37223584(-)	PUM2	PUM2_5	chr21	37223447	37223456	-	129	138	165	1	8.59596	0.000428	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:37223419-37223584(-)	PUM2	PUM2_5	chr21	37223420	37223429	-	156	165	165	1	7.16162	0.000846	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:37513660-37513945(+)	PUM2	PUM2_5	chr21	37513905	37513914	+	245	254	285	1	7.0404	0.000882	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:37514945-37515225(+)	PUM2	PUM2_5	chr21	37515006	37515015	+	61	70	280	1	7.15152	0.000846	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:37514945-37515225(+)	PUM2	PUM2_5	chr21	37515084	37515093	+	139	148	280	1	12.3939	2.8e-05	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:37514945-37515225(+)	PUM2	PUM2_5	chr21	37515122	37515131	+	177	186	280	1	7.71717	0.000655	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:37514610-37514715(+)	PUM2	PUM2_5	chr21	37514620	37514629	+	10	19	105	1	7.35354	0.00076	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:37514610-37514715(+)	PUM2	PUM2_5	chr21	37514672	37514681	+	62	71	105	1	10.101	0.000188	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:38156333-38156511(+)	PUM2	PUM2_5	chr21	38156459	38156468	+	126	135	178	1	11.7677	5.5e-05	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:38823543-38823783(+)	PUM2	PUM2_5	chr21	38823550	38823559	+	7	16	240	1	6.92929	0.000923	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:38823543-38823783(+)	PUM2	PUM2_5	chr21	38823557	38823566	+	14	23	240	1	8.07071	0.000563	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:38823543-38823783(+)	PUM2	PUM2_5	chr21	38823682	38823691	+	139	148	240	1	13.6061	6.92e-06	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:38823543-38823783(+)	PUM2	PUM2_5	chr21	38823760	38823769	+	217	226	240	1	9.9697	0.000204	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:38823273-38823463(+)	PUM2	PUM2_5	chr21	38823339	38823348	+	66	75	190	1	14.7071	9.81e-07	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:38823273-38823463(+)	PUM2	PUM2_5	chr21	38823341	38823350	+	68	77	190	1	8.71717	0.000411	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:38823273-38823463(+)	PUM2	PUM2_5	chr21	38823388	38823397	+	115	124	190	1	8.89899	0.000373	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:38823273-38823463(+)	PUM2	PUM2_5	chr21	38823404	38823413	+	131	140	190	1	12.9394	1.5e-05	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:38823273-38823463(+)	PUM2	PUM2_5	chr21	38823411	38823420	+	138	147	190	1	8.33333	0.00049	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:39175448-39175648(-)	PUM2	PUM2_5	chr21	39175591	39175600	-	49	58	200	1	8.66667	0.000419	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:39175448-39175648(-)	PUM2	PUM2_5	chr21	39175562	39175571	-	78	87	200	1	11.3434	7.4e-05	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:39175448-39175648(-)	PUM2	PUM2_5	chr21	39175515	39175524	-	125	134	200	1	10.1616	0.000175	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:39175448-39175648(-)	PUM2	PUM2_5	chr21	39175463	39175472	-	177	186	200	1	10.1111	0.000186	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:41988240-41988435(-)	PUM2	PUM2_5	chr21	41988361	41988370	-	66	75	195	1	11.1515	8.53e-05	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:41988240-41988435(-)	PUM2	PUM2_5	chr21	41988342	41988351	-	85	94	195	1	9.05051	0.000345	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:41988240-41988435(-)	PUM2	PUM2_5	chr21	41988257	41988266	-	170	179	195	1	8.60606	0.000427	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:43693279-43693514(+)	PUM2	PUM2_5	chr21	43693399	43693408	+	120	129	235	1	7.35354	0.00076	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:43693279-43693514(+)	PUM2	PUM2_5	chr21	43693415	43693424	+	136	145	235	1	12.2929	3.08e-05	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:43760950-43761125(+)	PUM2	PUM2_5	chr21	43761042	43761051	+	92	101	175	1	12.1515	3.69e-05	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:43982948-43983178(+)	PUM2	PUM2_5	chr21	43983057	43983066	+	109	118	230	1	12.1717	3.39e-05	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:44805616-44805856(-)	PUM2	PUM2_5	chr21	44805799	44805808	-	49	58	240	1	6.82828	0.000958	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:44805616-44805856(-)	PUM2	PUM2_5	chr21	44805668	44805677	-	180	189	240	1	13.6061	6.92e-06	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:44861162-44861271(-)	PUM2	PUM2_5	chr21	44861192	44861201	-	71	80	109	1	13.0505	1.29e-05	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:45512427-45512547(+)	PUM2	PUM2_5	chr21	45512511	45512520	+	84	93	120	1	8.51515	0.000442	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:45602615-45602770(+)	PUM2	PUM2_5	chr21	45602619	45602628	+	4	13	155	1	7.25253	0.000803	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:45602615-45602770(+)	PUM2	PUM2_5	chr21	45602697	45602706	+	82	91	155	1	12.1515	3.69e-05	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:45602615-45602770(+)	PUM2	PUM2_5	chr21	45602706	45602715	+	91	100	155	1	7.77778	0.00064	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:45602615-45602770(+)	PUM2	PUM2_5	chr21	45602731	45602740	+	116	125	155	1	10.1717	0.000174	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:46324121-46324226(+)	PUM2	PUM2_5	chr21	46324156	46324165	+	35	44	105	1	11.1212	8.74e-05	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:46569284-46569479(+)	PUM2	PUM2_5	chr21	46569299	46569308	+	15	24	195	1	6.81818	0.00096	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:46569284-46569479(+)	PUM2	PUM2_5	chr21	46569388	46569397	+	104	113	195	1	11.5051	6.62e-05	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:46569554-46569659(+)	PUM2	PUM2_5	chr21	46569555	46569564	+	1	10	105	1	9.0101	0.000356	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:46569554-46569659(+)	PUM2	PUM2_5	chr21	46569592	46569601	+	38	47	105	1	11.2222	8.1e-05	-	-	-sbAn7Po
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	chr21:46569554-46569659(+)	PUM2	PUM2_5	chr21	46569649	46569658	+	95	104	105	1	10.1919	0.000172	-	-	-sbAn7Po
diff -r 000000000000 -r 7dd2835ce566 test-data/motif_hit_stats.rbpbench_search.slbp_user.tsv
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/motif_hit_stats.rbpbench_search.slbp_user.tsv	Sun Dec 03 12:51:54 2023 +0000
@@ -0,0 +1,2 @@
+data_id	method_id	run_id	motif_db	region_id	rbp_id	motif_id	chr_id	gen_s	gen_e	strand	region_s	region_e	region_len	uniq_count	fimo_score	fimo_pval	cms_score	cms_eval	internal_id
+data_id	method_id	run_id	user	chr1:50-113(+)	SLBP_USER	RF00032	chr1	89	113	+	39	63	63	1	-	-	27.8	1.5e-08	RuDIjV1k
diff -r 000000000000 -r 7dd2835ce566 test-data/motif_hit_stats.rbpbench_search.tsv
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/motif_hit_stats.rbpbench_search.tsv	Sun Dec 03 12:51:54 2023 +0000
@@ -0,0 +1,6 @@
+data_id	method_id	run_id	motif_db	region_id	rbp_id	motif_id	chr_id	gen_s	gen_e	strand	region_s	region_e	region_len	uniq_count	fimo_score	fimo_pval	cms_score	cms_eval	internal_id
+data_id	method_id	run_id	human_v0.1	chr1:10-80(+)	PUM1	PUM1_3	chr1	24	31	+	14	21	70	1	12.8182	4.87e-05	-	-	h2FelLqa
+data_id	method_id	run_id	human_v0.1	chr1:10-80(+)	PUM2	PUM2_1	chr1	24	31	+	14	21	70	1	10.404	0.000113	-	-	HcD7_nJz
+data_id	method_id	run_id	human_v0.1	chr1:10-80(+)	PUM2	PUM2_3	chr1	24	31	+	14	21	70	1	6.20202	0.000212	-	-	HcD7_nJz
+data_id	method_id	run_id	human_v0.1	chr1:10-80(+)	PUM2	PUM2_4	chr1	24	31	+	14	21	70	1	15.8485	1.64e-05	-	-	HcD7_nJz
+data_id	method_id	run_id	human_v0.1	chr1:10-80(+)	PUM2	PUM2_5	chr1	22	31	+	12	21	70	1	10.8788	0.000113	-	-	HcD7_nJz
diff -r 000000000000 -r 7dd2835ce566 test-data/motif_hit_stats.table_test.tsv
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/motif_hit_stats.table_test.tsv	Sun Dec 03 12:51:54 2023 +0000
@@ -0,0 +1,6 @@
+data_id	method_id	run_id	motif_db	region_id	rbp_id	motif_id	chr_id	gen_s	gen_e	strand	region_s	region_e	region_len	uniq_count	fimo_score	fimo_pval	cms_score	cms_eval	internal_id
+did1	mid1	run_id	human_v0.1	chr1:10-80(+)	PUM1	PUM1_3	chr1	24	31	+	14	21	70	1	12.8182	4.87e-05	-	-	NInGOqIN
+did2	mid2	run_id	human_v0.1	chr1:10-80(+)	PUM2	PUM2_1	chr1	24	31	+	14	21	70	1	10.404	0.000113	-	-	u7eY1SoG
+did2	mid2	run_id	human_v0.1	chr1:10-80(+)	PUM2	PUM2_3	chr1	24	31	+	14	21	70	1	6.20202	0.000212	-	-	u7eY1SoG
+did2	mid2	run_id	human_v0.1	chr1:10-80(+)	PUM2	PUM2_4	chr1	24	31	+	14	21	70	1	15.8485	1.64e-05	-	-	u7eY1SoG
+did2	mid2	run_id	human_v0.1	chr1:10-80(+)	PUM2	PUM2_5	chr1	22	31	+	12	21	70	1	10.8788	0.000113	-	-	u7eY1SoG
diff -r 000000000000 -r 7dd2835ce566 test-data/motif_hit_stats.test_batch.tsv
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/motif_hit_stats.test_batch.tsv	Sun Dec 03 12:51:54 2023 +0000
@@ -0,0 +1,6 @@
+data_id	method_id	run_id	motif_db	region_id	rbp_id	motif_id	chr_id	gen_s	gen_e	strand	region_s	region_e	region_len	uniq_count	fimo_score	fimo_pval	cms_score	cms_eval	internal_id
+data-id1	method-id1	run_id	human_v0.1	chr1:10-80(+)	PUM1	PUM1_3	chr1	24	31	+	14	21	70	1	12.8182	4.87e-05	-	-	TT41sPJM
+data-id2	method-id2	run_id	human_v0.1	chr1:10-80(+)	PUM2	PUM2_1	chr1	24	31	+	14	21	70	1	10.404	0.000113	-	-	-dJ6C0OI
+data-id2	method-id2	run_id	human_v0.1	chr1:10-80(+)	PUM2	PUM2_3	chr1	24	31	+	14	21	70	1	6.20202	0.000212	-	-	-dJ6C0OI
+data-id2	method-id2	run_id	human_v0.1	chr1:10-80(+)	PUM2	PUM2_4	chr1	24	31	+	14	21	70	1	15.8485	1.64e-05	-	-	-dJ6C0OI
+data-id2	method-id2	run_id	human_v0.1	chr1:10-80(+)	PUM2	PUM2_5	chr1	22	31	+	12	21	70	1	10.8788	0.000113	-	-	-dJ6C0OI
diff -r 000000000000 -r 7dd2835ce566 test-data/motif_hits.rbpbench_batch.table_test.bed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/motif_hits.rbpbench_batch.table_test.bed	Sun Dec 03 12:51:54 2023 +0000
@@ -0,0 +1,5 @@
+chr1	23	31	PUM1,PUM1_3;1;mid1,did1	0	+	12.8182	4.87e-05	-1.0	-1.0
+chr1	23	31	PUM2,PUM2_1;1;mid2,did2	0	+	10.404	0.000113	-1.0	-1.0
+chr1	23	31	PUM2,PUM2_3;1;mid2,did2	0	+	6.20202	0.000212	-1.0	-1.0
+chr1	23	31	PUM2,PUM2_4;1;mid2,did2	0	+	15.8485	1.64e-05	-1.0	-1.0
+chr1	21	31	PUM2,PUM2_5;1;mid2,did2	0	+	10.8788	0.000113	-1.0	-1.0
diff -r 000000000000 -r 7dd2835ce566 test-data/motif_hits.rbpbench_batch.test_batch.bed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/motif_hits.rbpbench_batch.test_batch.bed	Sun Dec 03 12:51:54 2023 +0000
@@ -0,0 +1,5 @@
+chr1	23	31	PUM1,PUM1_3;1;method-id1,data-id1	0	+	12.8182	4.87e-05	-1.0	-1.0
+chr1	23	31	PUM2,PUM2_1;1;method-id2,data-id2	0	+	10.404	0.000113	-1.0	-1.0
+chr1	23	31	PUM2,PUM2_3;1;method-id2,data-id2	0	+	6.20202	0.000212	-1.0	-1.0
+chr1	23	31	PUM2,PUM2_4;1;method-id2,data-id2	0	+	15.8485	1.64e-05	-1.0	-1.0
+chr1	21	31	PUM2,PUM2_5;1;method-id2,data-id2	0	+	10.8788	0.000113	-1.0	-1.0
diff -r 000000000000 -r 7dd2835ce566 test-data/motif_hits.rbpbench_compare.test.bed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/motif_hits.rbpbench_compare.test.bed	Sun Dec 03 12:51:54 2023 +0000
@@ -0,0 +1,479 @@
+chr21	43687623	43687629	PUM1_1;k562_eclip,human_v0.1,PUM1;clipper_idr,dewseq_w100_s5	0	+
+chr21	8397362	8397368	PUM1_1;k562_eclip,human_v0.1,PUM1;clipper_idr,dewseq_w100_s5	0	+
+chr21	8215042	8215048	PUM1_1;k562_eclip,human_v0.1,PUM1;clipper_idr	0	+
+chr21	8215045	8215051	PUM1_1;k562_eclip,human_v0.1,PUM1;clipper_idr	0	+
+chr21	8215075	8215081	PUM1_1;k562_eclip,human_v0.1,PUM1;clipper_idr	0	+
+chr21	8214324	8214330	PUM1_1;k562_eclip,human_v0.1,PUM1;clipper_idr,dewseq_w100_s5	0	+
+chr21	36375632	36375640	PUM1_2;k562_eclip,human_v0.1,PUM1;clipper_idr,dewseq_w100_s5	0	+
+chr21	32764358	32764366	PUM1_2;k562_eclip,human_v0.1,PUM1;clipper_idr,dewseq_w100_s5	0	-
+chr21	8214298	8214304	PUM1_1;k562_eclip,human_v0.1,PUM1;dewseq_w100_s5	0	+
+chr21	8218698	8218704	PUM1_1;k562_eclip,human_v0.1,PUM1;dewseq_w100_s5	0	+
+chr21	8214075	8214081	PUM1_1;k562_eclip,human_v0.1,PUM1;dewseq_w100_s5	0	+
+chr21	8217841	8217847	PUM1_1;k562_eclip,human_v0.1,PUM1;dewseq_w100_s5	0	+
+chr21	8217884	8217890	PUM1_1;k562_eclip,human_v0.1,PUM1;dewseq_w100_s5	0	+
+chr21	8217961	8217967	PUM1_1;k562_eclip,human_v0.1,PUM1;dewseq_w100_s5	0	+
+chr21	8217962	8217968	PUM1_1;k562_eclip,human_v0.1,PUM1;dewseq_w100_s5	0	+
+chr21	8401737	8401743	PUM1_1;k562_eclip,human_v0.1,PUM1;dewseq_w100_s5	0	+
+chr21	8397514	8397520	PUM1_1;k562_eclip,human_v0.1,PUM1;dewseq_w100_s5	0	+
+chr21	8397534	8397540	PUM1_1;k562_eclip,human_v0.1,PUM1;dewseq_w100_s5	0	+
+chr21	8397536	8397542	PUM1_1;k562_eclip,human_v0.1,PUM1;dewseq_w100_s5	0	+
+chr21	8397540	8397546	PUM1_1;k562_eclip,human_v0.1,PUM1;dewseq_w100_s5	0	+
+chr21	8397544	8397550	PUM1_1;k562_eclip,human_v0.1,PUM1;dewseq_w100_s5	0	+
+chr21	8397554	8397560	PUM1_1;k562_eclip,human_v0.1,PUM1;dewseq_w100_s5	0	+
+chr21	8397556	8397562	PUM1_1;k562_eclip,human_v0.1,PUM1;dewseq_w100_s5	0	+
+chr21	8397680	8397686	PUM1_1;k562_eclip,human_v0.1,PUM1;dewseq_w100_s5	0	+
+chr21	8397336	8397342	PUM1_1;k562_eclip,human_v0.1,PUM1;dewseq_w100_s5	0	+
+chr21	36375534	36375541	PUM1_3;k562_eclip,human_v0.1,PUM1;dewseq_w100_s5	0	+
+chr21	36375556	36375563	PUM1_3;k562_eclip,human_v0.1,PUM1;dewseq_w100_s5	0	+
+chr21	14371170	14371177	PUM2_1;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	-
+chr21	14371168	14371175	PUM2_1;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	-
+chr21	14371143	14371150	PUM2_1;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	-
+chr21	32734896	32734903	PUM2_1;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	-
+chr21	32734887	32734894	PUM2_1;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	-
+chr21	32734055	32734062	PUM2_1;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	-
+chr21	32734041	32734048	PUM2_1;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	-
+chr21	14961325	14961332	PUM2_1;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	-
+chr21	28945911	28945918	PUM2_1;k562_eclip,human_v0.1,PUM2;clipper_idr	0	-
+chr21	33576754	33576761	PUM2_1;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	+
+chr21	33576671	33576678	PUM2_1;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	+
+chr21	33576685	33576692	PUM2_1;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	+
+chr21	33576643	33576650	PUM2_1;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	+
+chr21	36376310	36376317	PUM2_1;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	+
+chr21	36376312	36376319	PUM2_1;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	+
+chr21	37223459	37223466	PUM2_1;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	-
+chr21	37203027	37203034	PUM2_1;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	+
+chr21	46569382	46569389	PUM2_1;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	+
+chr21	36375544	36375551	PUM2_1;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	+
+chr21	33560605	33560612	PUM2_1;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	+
+chr21	14485730	14485737	PUM2_1;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	-
+chr21	14485692	14485699	PUM2_1;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	-
+chr21	17789024	17789031	PUM2_1;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	-
+chr21	45602699	45602706	PUM2_1;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	+
+chr21	45602733	45602740	PUM2_1;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	+
+chr21	37515084	37515091	PUM2_1;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	+
+chr21	37515086	37515093	PUM2_1;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	+
+chr21	32628809	32628816	PUM2_1;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	-
+chr21	43761044	43761051	PUM2_1;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	+
+chr21	46324158	46324165	PUM2_1;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	+
+chr21	29345209	29345216	PUM2_1;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	+
+chr21	34099722	34099729	PUM2_1;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	+
+chr21	34099724	34099731	PUM2_1;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	+
+chr21	34099762	34099769	PUM2_1;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	+
+chr21	39175562	39175569	PUM2_1;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	-
+chr21	39175515	39175522	PUM2_1;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	-
+chr21	34791779	34791786	PUM2_1;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	-
+chr21	33524100	33524107	PUM2_1;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	-
+chr21	38156461	38156468	PUM2_1;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	+
+chr21	38823684	38823691	PUM2_1;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	+
+chr21	33437440	33437447	PUM2_1;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	+
+chr21	33437400	33437407	PUM2_1;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	+
+chr21	33437428	33437435	PUM2_1;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	+
+chr21	14961842	14961849	PUM2_1;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	-
+chr21	14961807	14961814	PUM2_1;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	-
+chr21	14961803	14961810	PUM2_1;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	-
+chr21	14961861	14961868	PUM2_1;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	-
+chr21	36376422	36376429	PUM2_1;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	+
+chr21	29326166	29326173	PUM2_1;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	+
+chr21	44861192	44861199	PUM2_1;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	-
+chr21	14485254	14485261	PUM2_1;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	-
+chr21	14485285	14485292	PUM2_1;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	-
+chr21	34105602	34105609	PUM2_1;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	+
+chr21	34105611	34105618	PUM2_1;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	+
+chr21	34098705	34098712	PUM2_1;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	+
+chr21	32734647	32734654	PUM2_1;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	-
+chr21	32734638	32734645	PUM2_1;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	-
+chr21	44805668	44805675	PUM2_1;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	-
+chr21	44805641	44805648	PUM2_1;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	-
+chr21	44805634	44805641	PUM2_1;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	-
+chr21	37513892	37513899	PUM2_1;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	+
+chr21	14961945	14961952	PUM2_1;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	-
+chr21	34887732	34887739	PUM2_1;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	-
+chr21	34887705	34887712	PUM2_1;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	-
+chr21	34887697	34887704	PUM2_1;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	-
+chr21	34887695	34887702	PUM2_1;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	-
+chr21	33578071	33578078	PUM2_1;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	-
+chr21	43983059	43983066	PUM2_1;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	+
+chr21	14961325	14961332	PUM2_2;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	-
+chr21	33504165	33504172	PUM2_2;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	-
+chr21	33576612	33576619	PUM2_2;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	+
+chr21	37203027	37203034	PUM2_2;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	+
+chr21	45602708	45602715	PUM2_2;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	+
+chr21	32628809	32628816	PUM2_2;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	-
+chr21	34099702	34099709	PUM2_2;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	+
+chr21	38156461	38156468	PUM2_2;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	+
+chr21	38823684	38823691	PUM2_2;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	+
+chr21	33437400	33437407	PUM2_2;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	+
+chr21	29326166	29326173	PUM2_2;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	+
+chr21	34105611	34105618	PUM2_2;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	+
+chr21	44805668	44805675	PUM2_2;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	-
+chr21	14961274	14961281	PUM2_2;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	-
+chr21	36375341	36375348	PUM2_2;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	+
+chr21	43983067	43983074	PUM2_2;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	+
+chr21	14371143	14371150	PUM2_3;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	-
+chr21	32734896	32734903	PUM2_3;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	-
+chr21	32734887	32734894	PUM2_3;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	-
+chr21	32734041	32734048	PUM2_3;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	-
+chr21	14961325	14961332	PUM2_3;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	-
+chr21	28945911	28945918	PUM2_3;k562_eclip,human_v0.1,PUM2;clipper_idr	0	-
+chr21	33576671	33576678	PUM2_3;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	+
+chr21	33576685	33576692	PUM2_3;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	+
+chr21	33576643	33576650	PUM2_3;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	+
+chr21	36376310	36376317	PUM2_3;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	+
+chr21	37203027	37203034	PUM2_3;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	+
+chr21	46569382	46569389	PUM2_3;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	+
+chr21	36375544	36375551	PUM2_3;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	+
+chr21	14485730	14485737	PUM2_3;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	-
+chr21	14485692	14485699	PUM2_3;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	-
+chr21	17789024	17789031	PUM2_3;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	-
+chr21	45602733	45602740	PUM2_3;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	+
+chr21	32628809	32628816	PUM2_3;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	-
+chr21	46324158	46324165	PUM2_3;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	+
+chr21	34099724	34099731	PUM2_3;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	+
+chr21	34099762	34099769	PUM2_3;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	+
+chr21	34791779	34791786	PUM2_3;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	-
+chr21	33437440	33437447	PUM2_3;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	+
+chr21	33437428	33437435	PUM2_3;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	+
+chr21	14961842	14961849	PUM2_3;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	-
+chr21	29326166	29326173	PUM2_3;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	+
+chr21	44861192	44861199	PUM2_3;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	-
+chr21	14485254	14485261	PUM2_3;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	-
+chr21	14485285	14485292	PUM2_3;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	-
+chr21	34098705	34098712	PUM2_3;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	+
+chr21	32734647	32734654	PUM2_3;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	-
+chr21	32734638	32734645	PUM2_3;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	-
+chr21	44805641	44805648	PUM2_3;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	-
+chr21	44805634	44805641	PUM2_3;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	-
+chr21	37513892	37513899	PUM2_3;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	+
+chr21	14961945	14961952	PUM2_3;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	-
+chr21	34887732	34887739	PUM2_3;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	-
+chr21	34887705	34887712	PUM2_3;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	-
+chr21	43983059	43983066	PUM2_3;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	+
+chr21	14371143	14371150	PUM2_4;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	-
+chr21	32734887	32734894	PUM2_4;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	-
+chr21	32734041	32734048	PUM2_4;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	-
+chr21	14961325	14961332	PUM2_4;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	-
+chr21	28945911	28945918	PUM2_4;k562_eclip,human_v0.1,PUM2;clipper_idr	0	-
+chr21	33576643	33576650	PUM2_4;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	+
+chr21	36376310	36376317	PUM2_4;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	+
+chr21	37203027	37203034	PUM2_4;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	+
+chr21	17789024	17789031	PUM2_4;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	-
+chr21	32628809	32628816	PUM2_4;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	-
+chr21	46324158	46324165	PUM2_4;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	+
+chr21	34099724	34099731	PUM2_4;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	+
+chr21	34099762	34099769	PUM2_4;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	+
+chr21	39175515	39175522	PUM2_4;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	-
+chr21	33524055	33524062	PUM2_4;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	-
+chr21	33437440	33437447	PUM2_4;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	+
+chr21	14961842	14961849	PUM2_4;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	-
+chr21	29326166	29326173	PUM2_4;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	+
+chr21	29326130	29326137	PUM2_4;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	+
+chr21	14485285	14485292	PUM2_4;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	-
+chr21	14961945	14961952	PUM2_4;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	-
+chr21	34887732	34887739	PUM2_4;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	-
+chr21	34887705	34887712	PUM2_4;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	-
+chr21	43983059	43983066	PUM2_4;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	+
+chr21	14371170	14371179	PUM2_5;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	-
+chr21	14371143	14371152	PUM2_5;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	-
+chr21	32734896	32734905	PUM2_5;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	-
+chr21	32734887	32734896	PUM2_5;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	-
+chr21	32734885	32734894	PUM2_5;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	-
+chr21	32734879	32734888	PUM2_5;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	-
+chr21	32734041	32734050	PUM2_5;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	-
+chr21	14961325	14961334	PUM2_5;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	-
+chr21	28945911	28945920	PUM2_5;k562_eclip,human_v0.1,PUM2;clipper_idr	0	-
+chr21	33576754	33576763	PUM2_5;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	+
+chr21	33504165	33504174	PUM2_5;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	-
+chr21	33576669	33576678	PUM2_5;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	+
+chr21	33576683	33576692	PUM2_5;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	+
+chr21	33576641	33576650	PUM2_5;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	+
+chr21	36376308	36376317	PUM2_5;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	+
+chr21	36376310	36376319	PUM2_5;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	+
+chr21	36376343	36376352	PUM2_5;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	+
+chr21	37223459	37223468	PUM2_5;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	-
+chr21	37203025	37203034	PUM2_5;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	+
+chr21	46569388	46569397	PUM2_5;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	+
+chr21	36375542	36375551	PUM2_5;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	+
+chr21	36375655	36375664	PUM2_5;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	+
+chr21	17789024	17789033	PUM2_5;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	-
+chr21	17789022	17789031	PUM2_5;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	-
+chr21	45602697	45602706	PUM2_5;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	+
+chr21	45602706	45602715	PUM2_5;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	+
+chr21	45602731	45602740	PUM2_5;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	+
+chr21	37515122	37515131	PUM2_5;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	+
+chr21	37515084	37515093	PUM2_5;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	+
+chr21	32628809	32628818	PUM2_5;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	-
+chr21	43761042	43761051	PUM2_5;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	+
+chr21	46324156	46324165	PUM2_5;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	+
+chr21	29345207	29345216	PUM2_5;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	+
+chr21	34099720	34099729	PUM2_5;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	+
+chr21	34099722	34099731	PUM2_5;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	+
+chr21	34099760	34099769	PUM2_5;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	+
+chr21	39175562	39175571	PUM2_5;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	-
+chr21	39175515	39175524	PUM2_5;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	-
+chr21	33524083	33524092	PUM2_5;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	-
+chr21	33524047	33524056	PUM2_5;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	-
+chr21	33524030	33524039	PUM2_5;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	-
+chr21	38156459	38156468	PUM2_5;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	+
+chr21	43693415	43693424	PUM2_5;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	+
+chr21	43693399	43693408	PUM2_5;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	+
+chr21	38823682	38823691	PUM2_5;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	+
+chr21	33437438	33437447	PUM2_5;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	+
+chr21	33437398	33437407	PUM2_5;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	+
+chr21	33437426	33437435	PUM2_5;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	+
+chr21	14961842	14961851	PUM2_5;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	-
+chr21	14961861	14961870	PUM2_5;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	-
+chr21	45512511	45512520	PUM2_5;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	+
+chr21	33558832	33558841	PUM2_5;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	+
+chr21	44861192	44861201	PUM2_5;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	-
+chr21	14485285	14485294	PUM2_5;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	-
+chr21	34105600	34105609	PUM2_5;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	+
+chr21	34105609	34105618	PUM2_5;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	+
+chr21	32734647	32734656	PUM2_5;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	-
+chr21	32734638	32734647	PUM2_5;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	-
+chr21	44805668	44805677	PUM2_5;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	-
+chr21	37513905	37513914	PUM2_5;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	+
+chr21	14961945	14961954	PUM2_5;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	-
+chr21	32734862	32734871	PUM2_5;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	-
+chr21	34887737	34887746	PUM2_5;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	-
+chr21	34887732	34887741	PUM2_5;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	-
+chr21	34887705	34887714	PUM2_5;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	-
+chr21	34887703	34887712	PUM2_5;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	-
+chr21	34887697	34887706	PUM2_5;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	-
+chr21	34887695	34887704	PUM2_5;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	-
+chr21	36375339	36375348	PUM2_5;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	+
+chr21	33578071	33578080	PUM2_5;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	-
+chr21	31671335	31671344	PUM2_5;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	-
+chr21	43983057	43983066	PUM2_5;k562_eclip,human_v0.1,PUM2;clipper_idr,dewseq_w100_s5	0	+
+chr21	5240861	5240868	PUM2_1;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	-
+chr21	14371383	14371390	PUM2_1;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	-
+chr21	14371233	14371240	PUM2_1;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	-
+chr21	14371201	14371208	PUM2_1;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	-
+chr21	14485810	14485817	PUM2_1;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	-
+chr21	14485768	14485775	PUM2_1;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	-
+chr21	14962220	14962227	PUM2_1;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	-
+chr21	14962047	14962054	PUM2_1;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	-
+chr21	14962038	14962045	PUM2_1;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	-
+chr21	14962036	14962043	PUM2_1;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	-
+chr21	14962034	14962041	PUM2_1;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	-
+chr21	14962032	14962039	PUM2_1;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	-
+chr21	14962030	14962037	PUM2_1;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	-
+chr21	14962028	14962035	PUM2_1;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	-
+chr21	14962026	14962033	PUM2_1;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	-
+chr21	14962024	14962031	PUM2_1;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	-
+chr21	14962022	14962029	PUM2_1;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	-
+chr21	14962020	14962027	PUM2_1;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	-
+chr21	14962018	14962025	PUM2_1;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	-
+chr21	14962016	14962023	PUM2_1;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	-
+chr21	14962005	14962012	PUM2_1;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	-
+chr21	14962003	14962010	PUM2_1;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	-
+chr21	14962001	14962008	PUM2_1;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	-
+chr21	14961999	14962006	PUM2_1;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	-
+chr21	14961997	14962004	PUM2_1;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	-
+chr21	14961777	14961784	PUM2_1;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	-
+chr21	17789055	17789062	PUM2_1;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	-
+chr21	28928381	28928388	PUM2_1;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	-
+chr21	28928377	28928384	PUM2_1;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	-
+chr21	29345791	29345798	PUM2_1;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	+
+chr21	31668867	31668874	PUM2_1;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	+
+chr21	31671211	31671218	PUM2_1;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	-
+chr21	32734630	32734637	PUM2_1;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	-
+chr21	32734626	32734633	PUM2_1;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	-
+chr21	32733935	32733942	PUM2_1;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	-
+chr21	33437481	33437488	PUM2_1;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	+
+chr21	33450630	33450637	PUM2_1;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	-
+chr21	33450622	33450629	PUM2_1;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	-
+chr21	33576727	33576734	PUM2_1;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	+
+chr21	33558894	33558901	PUM2_1;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	+
+chr21	33560567	33560574	PUM2_1;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	+
+chr21	33560569	33560576	PUM2_1;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	+
+chr21	33560577	33560584	PUM2_1;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	+
+chr21	33560583	33560590	PUM2_1;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	+
+chr21	33560585	33560592	PUM2_1;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	+
+chr21	33560587	33560594	PUM2_1;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	+
+chr21	34142958	34142965	PUM2_1;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	+
+chr21	34100074	34100081	PUM2_1;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	+
+chr21	34100076	34100083	PUM2_1;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	+
+chr21	34788433	34788440	PUM2_1;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	-
+chr21	34788319	34788326	PUM2_1;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	-
+chr21	36375534	36375541	PUM2_1;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	+
+chr21	36375731	36375738	PUM2_1;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	+
+chr21	36375744	36375751	PUM2_1;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	+
+chr21	36375812	36375819	PUM2_1;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	+
+chr21	36375845	36375852	PUM2_1;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	+
+chr21	37223515	37223522	PUM2_1;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	-
+chr21	37223424	37223431	PUM2_1;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	-
+chr21	37223420	37223427	PUM2_1;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	-
+chr21	37515015	37515022	PUM2_1;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	+
+chr21	37514674	37514681	PUM2_1;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	+
+chr21	38823341	38823348	PUM2_1;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	+
+chr21	38823390	38823397	PUM2_1;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	+
+chr21	38823406	38823413	PUM2_1;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	+
+chr21	39175463	39175470	PUM2_1;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	-
+chr21	41988361	41988368	PUM2_1;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	-
+chr21	41988342	41988349	PUM2_1;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	-
+chr21	41988303	41988310	PUM2_1;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	-
+chr21	46569301	46569308	PUM2_1;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	+
+chr21	46569594	46569601	PUM2_1;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	+
+chr21	46569651	46569658	PUM2_1;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	+
+chr21	14371383	14371390	PUM2_2;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	-
+chr21	14371187	14371194	PUM2_2;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	-
+chr21	14485768	14485775	PUM2_2;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	-
+chr21	14961712	14961719	PUM2_2;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	-
+chr21	14961666	14961673	PUM2_2;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	-
+chr21	28928377	28928384	PUM2_2;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	-
+chr21	29326260	29326267	PUM2_2;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	+
+chr21	34105530	34105537	PUM2_2;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	+
+chr21	37513708	37513715	PUM2_2;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	+
+chr21	44805847	44805854	PUM2_2;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	-
+chr21	46569651	46569658	PUM2_2;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	+
+chr21	5240861	5240868	PUM2_3;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	-
+chr21	14485810	14485817	PUM2_3;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	-
+chr21	14485768	14485775	PUM2_3;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	-
+chr21	14962220	14962227	PUM2_3;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	-
+chr21	14962005	14962012	PUM2_3;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	-
+chr21	28928377	28928384	PUM2_3;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	-
+chr21	29345791	29345798	PUM2_3;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	+
+chr21	31668867	31668874	PUM2_3;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	+
+chr21	31671211	31671218	PUM2_3;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	-
+chr21	32733935	32733942	PUM2_3;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	-
+chr21	33437481	33437488	PUM2_3;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	+
+chr21	33450630	33450637	PUM2_3;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	-
+chr21	33450622	33450629	PUM2_3;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	-
+chr21	33560567	33560574	PUM2_3;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	+
+chr21	33560577	33560584	PUM2_3;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	+
+chr21	34142958	34142965	PUM2_3;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	+
+chr21	34788433	34788440	PUM2_3;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	-
+chr21	36375534	36375541	PUM2_3;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	+
+chr21	36375731	36375738	PUM2_3;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	+
+chr21	36375744	36375751	PUM2_3;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	+
+chr21	36375845	36375852	PUM2_3;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	+
+chr21	37223515	37223522	PUM2_3;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	-
+chr21	37223420	37223427	PUM2_3;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	-
+chr21	37515015	37515022	PUM2_3;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	+
+chr21	37514674	37514681	PUM2_3;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	+
+chr21	38823341	38823348	PUM2_3;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	+
+chr21	39175463	39175470	PUM2_3;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	-
+chr21	41988361	41988368	PUM2_3;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	-
+chr21	41988342	41988349	PUM2_3;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	-
+chr21	41988303	41988310	PUM2_3;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	-
+chr21	46569594	46569601	PUM2_3;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	+
+chr21	5240861	5240868	PUM2_4;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	-
+chr21	14485810	14485817	PUM2_4;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	-
+chr21	14485768	14485775	PUM2_4;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	-
+chr21	14485393	14485400	PUM2_4;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	-
+chr21	14962220	14962227	PUM2_4;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	-
+chr21	14962178	14962185	PUM2_4;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	-
+chr21	14962005	14962012	PUM2_4;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	-
+chr21	28928377	28928384	PUM2_4;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	-
+chr21	28928347	28928354	PUM2_4;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	-
+chr21	29345791	29345798	PUM2_4;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	+
+chr21	33450622	33450629	PUM2_4;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	-
+chr21	33576568	33576575	PUM2_4;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	+
+chr21	33560567	33560574	PUM2_4;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	+
+chr21	33560577	33560584	PUM2_4;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	+
+chr21	33578135	33578142	PUM2_4;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	-
+chr21	36375230	36375237	PUM2_4;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	+
+chr21	36375236	36375243	PUM2_4;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	+
+chr21	36375374	36375381	PUM2_4;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	+
+chr21	36375534	36375541	PUM2_4;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	+
+chr21	37514693	37514700	PUM2_4;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	+
+chr21	38823341	38823348	PUM2_4;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	+
+chr21	39175449	39175456	PUM2_4;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	-
+chr21	41988373	41988380	PUM2_4;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	-
+chr21	41988361	41988368	PUM2_4;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	-
+chr21	41988324	41988331	PUM2_4;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	-
+chr21	5240861	5240870	PUM2_5;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	-
+chr21	14371383	14371392	PUM2_5;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	-
+chr21	14371231	14371240	PUM2_5;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	-
+chr21	14371201	14371210	PUM2_5;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	-
+chr21	14485810	14485819	PUM2_5;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	-
+chr21	14485768	14485777	PUM2_5;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	-
+chr21	14485719	14485728	PUM2_5;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	-
+chr21	14962220	14962229	PUM2_5;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	-
+chr21	14962045	14962054	PUM2_5;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	-
+chr21	14962038	14962047	PUM2_5;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	-
+chr21	14962036	14962045	PUM2_5;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	-
+chr21	14962034	14962043	PUM2_5;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	-
+chr21	14962032	14962041	PUM2_5;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	-
+chr21	14962030	14962039	PUM2_5;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	-
+chr21	14962028	14962037	PUM2_5;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	-
+chr21	14962026	14962035	PUM2_5;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	-
+chr21	14962024	14962033	PUM2_5;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	-
+chr21	14962022	14962031	PUM2_5;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	-
+chr21	14962020	14962029	PUM2_5;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	-
+chr21	14962018	14962027	PUM2_5;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	-
+chr21	14962016	14962025	PUM2_5;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	-
+chr21	14962014	14962023	PUM2_5;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	-
+chr21	14962005	14962014	PUM2_5;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	-
+chr21	14962003	14962012	PUM2_5;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	-
+chr21	14962001	14962010	PUM2_5;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	-
+chr21	14961999	14962008	PUM2_5;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	-
+chr21	14961997	14962006	PUM2_5;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	-
+chr21	14961995	14962004	PUM2_5;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	-
+chr21	14961908	14961917	PUM2_5;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	-
+chr21	14961850	14961859	PUM2_5;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	-
+chr21	14961777	14961786	PUM2_5;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	-
+chr21	14961704	14961713	PUM2_5;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	-
+chr21	17789055	17789064	PUM2_5;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	-
+chr21	17789053	17789062	PUM2_5;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	-
+chr21	28928377	28928386	PUM2_5;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	-
+chr21	29345789	29345798	PUM2_5;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	+
+chr21	29326164	29326173	PUM2_5;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	+
+chr21	31668798	31668807	PUM2_5;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	+
+chr21	32734626	32734635	PUM2_5;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	-
+chr21	32734624	32734633	PUM2_5;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	-
+chr21	32733941	32733950	PUM2_5;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	-
+chr21	32733935	32733944	PUM2_5;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	-
+chr21	33437493	33437502	PUM2_5;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	+
+chr21	33450622	33450631	PUM2_5;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	-
+chr21	33524156	33524165	PUM2_5;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	-
+chr21	33524135	33524144	PUM2_5;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	-
+chr21	33576725	33576734	PUM2_5;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	+
+chr21	33558869	33558878	PUM2_5;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	+
+chr21	33558892	33558901	PUM2_5;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	+
+chr21	33560565	33560574	PUM2_5;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	+
+chr21	33560567	33560576	PUM2_5;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	+
+chr21	33560569	33560578	PUM2_5;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	+
+chr21	33560575	33560584	PUM2_5;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	+
+chr21	33560581	33560590	PUM2_5;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	+
+chr21	33560583	33560592	PUM2_5;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	+
+chr21	33560585	33560594	PUM2_5;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	+
+chr21	33560587	33560596	PUM2_5;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	+
+chr21	34105653	34105662	PUM2_5;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	+
+chr21	34098703	34098712	PUM2_5;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	+
+chr21	34100072	34100081	PUM2_5;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	+
+chr21	34100074	34100083	PUM2_5;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	+
+chr21	34100082	34100091	PUM2_5;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	+
+chr21	34788319	34788328	PUM2_5;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	-
+chr21	34887755	34887764	PUM2_5;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	-
+chr21	36375372	36375381	PUM2_5;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	+
+chr21	36375532	36375541	PUM2_5;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	+
+chr21	36375742	36375751	PUM2_5;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	+
+chr21	36375810	36375819	PUM2_5;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	+
+chr21	36375812	36375821	PUM2_5;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	+
+chr21	36375929	36375938	PUM2_5;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	+
+chr21	36376469	36376478	PUM2_5;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	+
+chr21	37223447	37223456	PUM2_5;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	-
+chr21	37223420	37223429	PUM2_5;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	-
+chr21	37515006	37515015	PUM2_5;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	+
+chr21	37514620	37514629	PUM2_5;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	+
+chr21	37514672	37514681	PUM2_5;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	+
+chr21	38823550	38823559	PUM2_5;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	+
+chr21	38823557	38823566	PUM2_5;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	+
+chr21	38823760	38823769	PUM2_5;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	+
+chr21	38823339	38823348	PUM2_5;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	+
+chr21	38823341	38823350	PUM2_5;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	+
+chr21	38823388	38823397	PUM2_5;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	+
+chr21	38823404	38823413	PUM2_5;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	+
+chr21	38823411	38823420	PUM2_5;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	+
+chr21	39175591	39175600	PUM2_5;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	-
+chr21	39175463	39175472	PUM2_5;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	-
+chr21	41988361	41988370	PUM2_5;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	-
+chr21	41988342	41988351	PUM2_5;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	-
+chr21	41988257	41988266	PUM2_5;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	-
+chr21	44805799	44805808	PUM2_5;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	-
+chr21	45602619	45602628	PUM2_5;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	+
+chr21	46569299	46569308	PUM2_5;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	+
+chr21	46569555	46569564	PUM2_5;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	+
+chr21	46569592	46569601	PUM2_5;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	+
+chr21	46569649	46569658	PUM2_5;k562_eclip,human_v0.1,PUM2;dewseq_w100_s5	0	+
diff -r 000000000000 -r 7dd2835ce566 test-data/motif_hits.rbpbench_compare.test.tsv
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/motif_hits.rbpbench_compare.test.tsv	Sun Dec 03 12:51:54 2023 +0000
@@ -0,0 +1,480 @@
+combined_id	motif_hit_id	method_data_ids_with_hit
+k562_eclip,human_v0.1,PUM1	chr21:43687623-43687629(+),PUM1_1	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM1	chr21:8397362-8397368(+),PUM1_1	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM1	chr21:8215042-8215048(+),PUM1_1	clipper_idr
+k562_eclip,human_v0.1,PUM1	chr21:8215045-8215051(+),PUM1_1	clipper_idr
+k562_eclip,human_v0.1,PUM1	chr21:8215075-8215081(+),PUM1_1	clipper_idr
+k562_eclip,human_v0.1,PUM1	chr21:8214324-8214330(+),PUM1_1	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM1	chr21:36375632-36375640(+),PUM1_2	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM1	chr21:32764358-32764366(-),PUM1_2	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM1	chr21:8214298-8214304(+),PUM1_1	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM1	chr21:8218698-8218704(+),PUM1_1	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM1	chr21:8214075-8214081(+),PUM1_1	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM1	chr21:8217841-8217847(+),PUM1_1	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM1	chr21:8217884-8217890(+),PUM1_1	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM1	chr21:8217961-8217967(+),PUM1_1	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM1	chr21:8217962-8217968(+),PUM1_1	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM1	chr21:8401737-8401743(+),PUM1_1	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM1	chr21:8397514-8397520(+),PUM1_1	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM1	chr21:8397534-8397540(+),PUM1_1	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM1	chr21:8397536-8397542(+),PUM1_1	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM1	chr21:8397540-8397546(+),PUM1_1	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM1	chr21:8397544-8397550(+),PUM1_1	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM1	chr21:8397554-8397560(+),PUM1_1	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM1	chr21:8397556-8397562(+),PUM1_1	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM1	chr21:8397680-8397686(+),PUM1_1	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM1	chr21:8397336-8397342(+),PUM1_1	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM1	chr21:36375534-36375541(+),PUM1_3	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM1	chr21:36375556-36375563(+),PUM1_3	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:14371170-14371177(-),PUM2_1	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:14371168-14371175(-),PUM2_1	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:14371143-14371150(-),PUM2_1	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:32734896-32734903(-),PUM2_1	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:32734887-32734894(-),PUM2_1	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:32734055-32734062(-),PUM2_1	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:32734041-32734048(-),PUM2_1	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:14961325-14961332(-),PUM2_1	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:28945911-28945918(-),PUM2_1	clipper_idr
+k562_eclip,human_v0.1,PUM2	chr21:33576754-33576761(+),PUM2_1	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:33576671-33576678(+),PUM2_1	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:33576685-33576692(+),PUM2_1	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:33576643-33576650(+),PUM2_1	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:36376310-36376317(+),PUM2_1	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:36376312-36376319(+),PUM2_1	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:37223459-37223466(-),PUM2_1	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:37203027-37203034(+),PUM2_1	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:46569382-46569389(+),PUM2_1	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:36375544-36375551(+),PUM2_1	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:33560605-33560612(+),PUM2_1	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:14485730-14485737(-),PUM2_1	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:14485692-14485699(-),PUM2_1	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:17789024-17789031(-),PUM2_1	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:45602699-45602706(+),PUM2_1	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:45602733-45602740(+),PUM2_1	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:37515084-37515091(+),PUM2_1	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:37515086-37515093(+),PUM2_1	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:32628809-32628816(-),PUM2_1	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:43761044-43761051(+),PUM2_1	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:46324158-46324165(+),PUM2_1	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:29345209-29345216(+),PUM2_1	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:34099722-34099729(+),PUM2_1	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:34099724-34099731(+),PUM2_1	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:34099762-34099769(+),PUM2_1	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:39175562-39175569(-),PUM2_1	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:39175515-39175522(-),PUM2_1	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:34791779-34791786(-),PUM2_1	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:33524100-33524107(-),PUM2_1	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:38156461-38156468(+),PUM2_1	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:38823684-38823691(+),PUM2_1	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:33437440-33437447(+),PUM2_1	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:33437400-33437407(+),PUM2_1	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:33437428-33437435(+),PUM2_1	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:14961842-14961849(-),PUM2_1	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:14961807-14961814(-),PUM2_1	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:14961803-14961810(-),PUM2_1	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:14961861-14961868(-),PUM2_1	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:36376422-36376429(+),PUM2_1	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:29326166-29326173(+),PUM2_1	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:44861192-44861199(-),PUM2_1	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:14485254-14485261(-),PUM2_1	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:14485285-14485292(-),PUM2_1	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:34105602-34105609(+),PUM2_1	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:34105611-34105618(+),PUM2_1	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:34098705-34098712(+),PUM2_1	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:32734647-32734654(-),PUM2_1	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:32734638-32734645(-),PUM2_1	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:44805668-44805675(-),PUM2_1	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:44805641-44805648(-),PUM2_1	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:44805634-44805641(-),PUM2_1	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:37513892-37513899(+),PUM2_1	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:14961945-14961952(-),PUM2_1	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:34887732-34887739(-),PUM2_1	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:34887705-34887712(-),PUM2_1	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:34887697-34887704(-),PUM2_1	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:34887695-34887702(-),PUM2_1	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:33578071-33578078(-),PUM2_1	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:43983059-43983066(+),PUM2_1	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:14961325-14961332(-),PUM2_2	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:33504165-33504172(-),PUM2_2	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:33576612-33576619(+),PUM2_2	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:37203027-37203034(+),PUM2_2	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:45602708-45602715(+),PUM2_2	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:32628809-32628816(-),PUM2_2	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:34099702-34099709(+),PUM2_2	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:38156461-38156468(+),PUM2_2	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:38823684-38823691(+),PUM2_2	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:33437400-33437407(+),PUM2_2	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:29326166-29326173(+),PUM2_2	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:34105611-34105618(+),PUM2_2	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:44805668-44805675(-),PUM2_2	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:14961274-14961281(-),PUM2_2	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:36375341-36375348(+),PUM2_2	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:43983067-43983074(+),PUM2_2	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:14371143-14371150(-),PUM2_3	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:32734896-32734903(-),PUM2_3	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:32734887-32734894(-),PUM2_3	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:32734041-32734048(-),PUM2_3	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:14961325-14961332(-),PUM2_3	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:28945911-28945918(-),PUM2_3	clipper_idr
+k562_eclip,human_v0.1,PUM2	chr21:33576671-33576678(+),PUM2_3	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:33576685-33576692(+),PUM2_3	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:33576643-33576650(+),PUM2_3	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:36376310-36376317(+),PUM2_3	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:37203027-37203034(+),PUM2_3	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:46569382-46569389(+),PUM2_3	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:36375544-36375551(+),PUM2_3	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:14485730-14485737(-),PUM2_3	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:14485692-14485699(-),PUM2_3	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:17789024-17789031(-),PUM2_3	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:45602733-45602740(+),PUM2_3	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:32628809-32628816(-),PUM2_3	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:46324158-46324165(+),PUM2_3	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:34099724-34099731(+),PUM2_3	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:34099762-34099769(+),PUM2_3	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:34791779-34791786(-),PUM2_3	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:33437440-33437447(+),PUM2_3	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:33437428-33437435(+),PUM2_3	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:14961842-14961849(-),PUM2_3	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:29326166-29326173(+),PUM2_3	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:44861192-44861199(-),PUM2_3	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:14485254-14485261(-),PUM2_3	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:14485285-14485292(-),PUM2_3	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:34098705-34098712(+),PUM2_3	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:32734647-32734654(-),PUM2_3	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:32734638-32734645(-),PUM2_3	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:44805641-44805648(-),PUM2_3	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:44805634-44805641(-),PUM2_3	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:37513892-37513899(+),PUM2_3	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:14961945-14961952(-),PUM2_3	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:34887732-34887739(-),PUM2_3	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:34887705-34887712(-),PUM2_3	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:43983059-43983066(+),PUM2_3	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:14371143-14371150(-),PUM2_4	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:32734887-32734894(-),PUM2_4	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:32734041-32734048(-),PUM2_4	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:14961325-14961332(-),PUM2_4	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:28945911-28945918(-),PUM2_4	clipper_idr
+k562_eclip,human_v0.1,PUM2	chr21:33576643-33576650(+),PUM2_4	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:36376310-36376317(+),PUM2_4	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:37203027-37203034(+),PUM2_4	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:17789024-17789031(-),PUM2_4	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:32628809-32628816(-),PUM2_4	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:46324158-46324165(+),PUM2_4	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:34099724-34099731(+),PUM2_4	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:34099762-34099769(+),PUM2_4	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:39175515-39175522(-),PUM2_4	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:33524055-33524062(-),PUM2_4	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:33437440-33437447(+),PUM2_4	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:14961842-14961849(-),PUM2_4	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:29326166-29326173(+),PUM2_4	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:29326130-29326137(+),PUM2_4	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:14485285-14485292(-),PUM2_4	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:14961945-14961952(-),PUM2_4	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:34887732-34887739(-),PUM2_4	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:34887705-34887712(-),PUM2_4	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:43983059-43983066(+),PUM2_4	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:14371170-14371179(-),PUM2_5	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:14371143-14371152(-),PUM2_5	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:32734896-32734905(-),PUM2_5	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:32734887-32734896(-),PUM2_5	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:32734885-32734894(-),PUM2_5	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:32734879-32734888(-),PUM2_5	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:32734041-32734050(-),PUM2_5	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:14961325-14961334(-),PUM2_5	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:28945911-28945920(-),PUM2_5	clipper_idr
+k562_eclip,human_v0.1,PUM2	chr21:33576754-33576763(+),PUM2_5	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:33504165-33504174(-),PUM2_5	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:33576669-33576678(+),PUM2_5	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:33576683-33576692(+),PUM2_5	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:33576641-33576650(+),PUM2_5	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:36376308-36376317(+),PUM2_5	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:36376310-36376319(+),PUM2_5	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:36376343-36376352(+),PUM2_5	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:37223459-37223468(-),PUM2_5	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:37203025-37203034(+),PUM2_5	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:46569388-46569397(+),PUM2_5	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:36375542-36375551(+),PUM2_5	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:36375655-36375664(+),PUM2_5	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:17789024-17789033(-),PUM2_5	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:17789022-17789031(-),PUM2_5	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:45602697-45602706(+),PUM2_5	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:45602706-45602715(+),PUM2_5	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:45602731-45602740(+),PUM2_5	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:37515122-37515131(+),PUM2_5	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:37515084-37515093(+),PUM2_5	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:32628809-32628818(-),PUM2_5	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:43761042-43761051(+),PUM2_5	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:46324156-46324165(+),PUM2_5	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:29345207-29345216(+),PUM2_5	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:34099720-34099729(+),PUM2_5	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:34099722-34099731(+),PUM2_5	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:34099760-34099769(+),PUM2_5	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:39175562-39175571(-),PUM2_5	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:39175515-39175524(-),PUM2_5	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:33524083-33524092(-),PUM2_5	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:33524047-33524056(-),PUM2_5	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:33524030-33524039(-),PUM2_5	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:38156459-38156468(+),PUM2_5	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:43693415-43693424(+),PUM2_5	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:43693399-43693408(+),PUM2_5	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:38823682-38823691(+),PUM2_5	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:33437438-33437447(+),PUM2_5	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:33437398-33437407(+),PUM2_5	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:33437426-33437435(+),PUM2_5	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:14961842-14961851(-),PUM2_5	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:14961861-14961870(-),PUM2_5	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:45512511-45512520(+),PUM2_5	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:33558832-33558841(+),PUM2_5	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:44861192-44861201(-),PUM2_5	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:14485285-14485294(-),PUM2_5	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:34105600-34105609(+),PUM2_5	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:34105609-34105618(+),PUM2_5	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:32734647-32734656(-),PUM2_5	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:32734638-32734647(-),PUM2_5	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:44805668-44805677(-),PUM2_5	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:37513905-37513914(+),PUM2_5	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:14961945-14961954(-),PUM2_5	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:32734862-32734871(-),PUM2_5	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:34887737-34887746(-),PUM2_5	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:34887732-34887741(-),PUM2_5	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:34887705-34887714(-),PUM2_5	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:34887703-34887712(-),PUM2_5	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:34887697-34887706(-),PUM2_5	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:34887695-34887704(-),PUM2_5	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:36375339-36375348(+),PUM2_5	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:33578071-33578080(-),PUM2_5	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:31671335-31671344(-),PUM2_5	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:43983057-43983066(+),PUM2_5	clipper_idr,dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:5240861-5240868(-),PUM2_1	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:14371383-14371390(-),PUM2_1	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:14371233-14371240(-),PUM2_1	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:14371201-14371208(-),PUM2_1	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:14485810-14485817(-),PUM2_1	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:14485768-14485775(-),PUM2_1	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:14962220-14962227(-),PUM2_1	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:14962047-14962054(-),PUM2_1	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:14962038-14962045(-),PUM2_1	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:14962036-14962043(-),PUM2_1	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:14962034-14962041(-),PUM2_1	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:14962032-14962039(-),PUM2_1	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:14962030-14962037(-),PUM2_1	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:14962028-14962035(-),PUM2_1	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:14962026-14962033(-),PUM2_1	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:14962024-14962031(-),PUM2_1	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:14962022-14962029(-),PUM2_1	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:14962020-14962027(-),PUM2_1	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:14962018-14962025(-),PUM2_1	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:14962016-14962023(-),PUM2_1	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:14962005-14962012(-),PUM2_1	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:14962003-14962010(-),PUM2_1	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:14962001-14962008(-),PUM2_1	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:14961999-14962006(-),PUM2_1	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:14961997-14962004(-),PUM2_1	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:14961777-14961784(-),PUM2_1	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:17789055-17789062(-),PUM2_1	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:28928381-28928388(-),PUM2_1	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:28928377-28928384(-),PUM2_1	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:29345791-29345798(+),PUM2_1	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:31668867-31668874(+),PUM2_1	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:31671211-31671218(-),PUM2_1	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:32734630-32734637(-),PUM2_1	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:32734626-32734633(-),PUM2_1	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:32733935-32733942(-),PUM2_1	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:33437481-33437488(+),PUM2_1	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:33450630-33450637(-),PUM2_1	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:33450622-33450629(-),PUM2_1	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:33576727-33576734(+),PUM2_1	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:33558894-33558901(+),PUM2_1	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:33560567-33560574(+),PUM2_1	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:33560569-33560576(+),PUM2_1	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:33560577-33560584(+),PUM2_1	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:33560583-33560590(+),PUM2_1	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:33560585-33560592(+),PUM2_1	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:33560587-33560594(+),PUM2_1	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:34142958-34142965(+),PUM2_1	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:34100074-34100081(+),PUM2_1	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:34100076-34100083(+),PUM2_1	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:34788433-34788440(-),PUM2_1	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:34788319-34788326(-),PUM2_1	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:36375534-36375541(+),PUM2_1	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:36375731-36375738(+),PUM2_1	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:36375744-36375751(+),PUM2_1	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:36375812-36375819(+),PUM2_1	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:36375845-36375852(+),PUM2_1	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:37223515-37223522(-),PUM2_1	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:37223424-37223431(-),PUM2_1	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:37223420-37223427(-),PUM2_1	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:37515015-37515022(+),PUM2_1	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:37514674-37514681(+),PUM2_1	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:38823341-38823348(+),PUM2_1	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:38823390-38823397(+),PUM2_1	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:38823406-38823413(+),PUM2_1	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:39175463-39175470(-),PUM2_1	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:41988361-41988368(-),PUM2_1	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:41988342-41988349(-),PUM2_1	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:41988303-41988310(-),PUM2_1	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:46569301-46569308(+),PUM2_1	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:46569594-46569601(+),PUM2_1	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:46569651-46569658(+),PUM2_1	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:14371383-14371390(-),PUM2_2	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:14371187-14371194(-),PUM2_2	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:14485768-14485775(-),PUM2_2	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:14961712-14961719(-),PUM2_2	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:14961666-14961673(-),PUM2_2	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:28928377-28928384(-),PUM2_2	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:29326260-29326267(+),PUM2_2	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:34105530-34105537(+),PUM2_2	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:37513708-37513715(+),PUM2_2	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:44805847-44805854(-),PUM2_2	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:46569651-46569658(+),PUM2_2	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:5240861-5240868(-),PUM2_3	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:14485810-14485817(-),PUM2_3	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:14485768-14485775(-),PUM2_3	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:14962220-14962227(-),PUM2_3	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:14962005-14962012(-),PUM2_3	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:28928377-28928384(-),PUM2_3	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:29345791-29345798(+),PUM2_3	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:31668867-31668874(+),PUM2_3	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:31671211-31671218(-),PUM2_3	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:32733935-32733942(-),PUM2_3	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:33437481-33437488(+),PUM2_3	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:33450630-33450637(-),PUM2_3	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:33450622-33450629(-),PUM2_3	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:33560567-33560574(+),PUM2_3	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:33560577-33560584(+),PUM2_3	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:34142958-34142965(+),PUM2_3	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:34788433-34788440(-),PUM2_3	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:36375534-36375541(+),PUM2_3	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:36375731-36375738(+),PUM2_3	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:36375744-36375751(+),PUM2_3	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:36375845-36375852(+),PUM2_3	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:37223515-37223522(-),PUM2_3	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:37223420-37223427(-),PUM2_3	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:37515015-37515022(+),PUM2_3	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:37514674-37514681(+),PUM2_3	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:38823341-38823348(+),PUM2_3	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:39175463-39175470(-),PUM2_3	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:41988361-41988368(-),PUM2_3	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:41988342-41988349(-),PUM2_3	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:41988303-41988310(-),PUM2_3	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:46569594-46569601(+),PUM2_3	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:5240861-5240868(-),PUM2_4	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:14485810-14485817(-),PUM2_4	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:14485768-14485775(-),PUM2_4	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:14485393-14485400(-),PUM2_4	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:14962220-14962227(-),PUM2_4	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:14962178-14962185(-),PUM2_4	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:14962005-14962012(-),PUM2_4	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:28928377-28928384(-),PUM2_4	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:28928347-28928354(-),PUM2_4	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:29345791-29345798(+),PUM2_4	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:33450622-33450629(-),PUM2_4	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:33576568-33576575(+),PUM2_4	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:33560567-33560574(+),PUM2_4	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:33560577-33560584(+),PUM2_4	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:33578135-33578142(-),PUM2_4	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:36375230-36375237(+),PUM2_4	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:36375236-36375243(+),PUM2_4	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:36375374-36375381(+),PUM2_4	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:36375534-36375541(+),PUM2_4	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:37514693-37514700(+),PUM2_4	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:38823341-38823348(+),PUM2_4	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:39175449-39175456(-),PUM2_4	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:41988373-41988380(-),PUM2_4	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:41988361-41988368(-),PUM2_4	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:41988324-41988331(-),PUM2_4	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:5240861-5240870(-),PUM2_5	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:14371383-14371392(-),PUM2_5	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:14371231-14371240(-),PUM2_5	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:14371201-14371210(-),PUM2_5	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:14485810-14485819(-),PUM2_5	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:14485768-14485777(-),PUM2_5	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:14485719-14485728(-),PUM2_5	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:14962220-14962229(-),PUM2_5	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:14962045-14962054(-),PUM2_5	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:14962038-14962047(-),PUM2_5	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:14962036-14962045(-),PUM2_5	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:14962034-14962043(-),PUM2_5	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:14962032-14962041(-),PUM2_5	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:14962030-14962039(-),PUM2_5	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:14962028-14962037(-),PUM2_5	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:14962026-14962035(-),PUM2_5	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:14962024-14962033(-),PUM2_5	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:14962022-14962031(-),PUM2_5	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:14962020-14962029(-),PUM2_5	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:14962018-14962027(-),PUM2_5	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:14962016-14962025(-),PUM2_5	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:14962014-14962023(-),PUM2_5	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:14962005-14962014(-),PUM2_5	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:14962003-14962012(-),PUM2_5	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:14962001-14962010(-),PUM2_5	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:14961999-14962008(-),PUM2_5	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:14961997-14962006(-),PUM2_5	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:14961995-14962004(-),PUM2_5	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:14961908-14961917(-),PUM2_5	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:14961850-14961859(-),PUM2_5	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:14961777-14961786(-),PUM2_5	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:14961704-14961713(-),PUM2_5	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:17789055-17789064(-),PUM2_5	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:17789053-17789062(-),PUM2_5	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:28928377-28928386(-),PUM2_5	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:29345789-29345798(+),PUM2_5	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:29326164-29326173(+),PUM2_5	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:31668798-31668807(+),PUM2_5	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:32734626-32734635(-),PUM2_5	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:32734624-32734633(-),PUM2_5	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:32733941-32733950(-),PUM2_5	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:32733935-32733944(-),PUM2_5	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:33437493-33437502(+),PUM2_5	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:33450622-33450631(-),PUM2_5	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:33524156-33524165(-),PUM2_5	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:33524135-33524144(-),PUM2_5	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:33576725-33576734(+),PUM2_5	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:33558869-33558878(+),PUM2_5	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:33558892-33558901(+),PUM2_5	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:33560565-33560574(+),PUM2_5	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:33560567-33560576(+),PUM2_5	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:33560569-33560578(+),PUM2_5	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:33560575-33560584(+),PUM2_5	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:33560581-33560590(+),PUM2_5	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:33560583-33560592(+),PUM2_5	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:33560585-33560594(+),PUM2_5	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:33560587-33560596(+),PUM2_5	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:34105653-34105662(+),PUM2_5	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:34098703-34098712(+),PUM2_5	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:34100072-34100081(+),PUM2_5	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:34100074-34100083(+),PUM2_5	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:34100082-34100091(+),PUM2_5	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:34788319-34788328(-),PUM2_5	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:34887755-34887764(-),PUM2_5	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:36375372-36375381(+),PUM2_5	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:36375532-36375541(+),PUM2_5	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:36375742-36375751(+),PUM2_5	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:36375810-36375819(+),PUM2_5	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:36375812-36375821(+),PUM2_5	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:36375929-36375938(+),PUM2_5	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:36376469-36376478(+),PUM2_5	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:37223447-37223456(-),PUM2_5	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:37223420-37223429(-),PUM2_5	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:37515006-37515015(+),PUM2_5	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:37514620-37514629(+),PUM2_5	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:37514672-37514681(+),PUM2_5	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:38823550-38823559(+),PUM2_5	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:38823557-38823566(+),PUM2_5	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:38823760-38823769(+),PUM2_5	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:38823339-38823348(+),PUM2_5	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:38823341-38823350(+),PUM2_5	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:38823388-38823397(+),PUM2_5	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:38823404-38823413(+),PUM2_5	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:38823411-38823420(+),PUM2_5	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:39175591-39175600(-),PUM2_5	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:39175463-39175472(-),PUM2_5	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:41988361-41988370(-),PUM2_5	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:41988342-41988351(-),PUM2_5	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:41988257-41988266(-),PUM2_5	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:44805799-44805808(-),PUM2_5	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:45602619-45602628(+),PUM2_5	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:46569299-46569308(+),PUM2_5	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:46569555-46569564(+),PUM2_5	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:46569592-46569601(+),PUM2_5	dewseq_w100_s5
+k562_eclip,human_v0.1,PUM2	chr21:46569649-46569658(+),PUM2_5	dewseq_w100_s5
diff -r 000000000000 -r 7dd2835ce566 test-data/motif_hits.rbpbench_search.bed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/motif_hits.rbpbench_search.bed	Sun Dec 03 12:51:54 2023 +0000
@@ -0,0 +1,5 @@
+chr1	23	31	PUM1,PUM1_3;1;method_id,data_id	0	+	12.8182	4.87e-05	-1.0	-1.0
+chr1	23	31	PUM2,PUM2_1;1;method_id,data_id	0	+	10.404	0.000113	-1.0	-1.0
+chr1	23	31	PUM2,PUM2_3;1;method_id,data_id	0	+	6.20202	0.000212	-1.0	-1.0
+chr1	23	31	PUM2,PUM2_4;1;method_id,data_id	0	+	15.8485	1.64e-05	-1.0	-1.0
+chr1	21	31	PUM2,PUM2_5;1;method_id,data_id	0	+	10.8788	0.000113	-1.0	-1.0
diff -r 000000000000 -r 7dd2835ce566 test-data/motif_hits.rbpbench_search.test_all.bed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/motif_hits.rbpbench_search.test_all.bed	Sun Dec 03 12:51:54 2023 +0000
@@ -0,0 +1,56 @@
+chr1	66	76	ACIN1,ACIN1_2;1;method_id,data_id	0	+	7.83168	0.000976	-1.0	-1.0
+chr1	35	42	ADAR,ADAR_2;1;method_id,data_id	0	+	7.76761	0.000162	-1.0	-1.0
+chr1	21	28	BUD13,BUD13_4;1;method_id,data_id	0	+	8.50505	0.000528	-1.0	-1.0
+chr1	16	23	CELF6,CELF6_1;1;method_id,data_id	0	+	7.54545	0.000859	-1.0	-1.0
+chr1	20	32	DDX6,DDX6_1;1;method_id,data_id	0	+	11.1616	5.8e-05	-1.0	-1.0
+chr1	47	53	DDX54,DDX54_2;1;method_id,data_id	0	+	10.0101	0.000506	-1.0	-1.0
+chr1	20	31	DGCR8,DGCR8_1;1;method_id,data_id	0	+	10.4646	0.000102	-1.0	-1.0
+chr1	57	64	ELAVL4,ELAVL4_1;1;method_id,data_id	0	+	8.90909	0.000307	-1.0	-1.0
+chr1	31	39	EWSR1,EWSR1_2;1;method_id,data_id	0	+	7.39394	0.000281	-1.0	-1.0
+chr1	25	35	FMR1,FMR1_1;1;method_id,data_id	0	+	-1.28283	0.000939	-1.0	-1.0
+chr1	55	62	G3BP2,G3BP2_1;1;method_id,data_id	0	+	10.2323	0.00027	-1.0	-1.0
+chr1	20	29	GPKOW,GPKOW_1;1;method_id,data_id	0	+	7.56566	0.000629	-1.0	-1.0
+chr1	42	49	GPKOW,GPKOW_2;1;method_id,data_id	0	+	7.66337	0.000616	-1.0	-1.0
+chr1	13	20	HNRNPM,HNRNPM_2;1;method_id,data_id	0	+	9.36	0.000225	-1.0	-1.0
+chr1	65	74	LSM11,LSM11_4;1;method_id,data_id	0	+	7.32323	0.000681	-1.0	-1.0
+chr1	43	53	MTPAP,MTPAP_1;1;method_id,data_id	0	+	7.51485	0.000853	-1.0	-1.0
+chr1	65	75	NUP42,NUP42_1;1;method_id,data_id	0	+	7.56566	0.000678	-1.0	-1.0
+chr1	67	74	PABPC1,PABPC1_2;1;method_id,data_id	0	+	8.22	0.000763	-1.0	-1.0
+chr1	69	76	PABPC4,PABPC4_1;1;method_id,data_id	0	+	7.46	0.000936	-1.0	-1.0
+chr1	48	56	PCBP1,PCBP1_3;1;method_id,data_id	0	+	4.08081	0.00076	-1.0	-1.0
+chr1	35	41	PTBP1,PTBP1_5;1;method_id,data_id	0	+	9.37374	0.000653	-1.0	-1.0
+chr1	23	31	PUM1,PUM1_3;1;method_id,data_id	0	+	12.8182	4.87e-05	-1.0	-1.0
+chr1	23	31	PUM2,PUM2_1;1;method_id,data_id	0	+	10.404	0.000113	-1.0	-1.0
+chr1	23	31	PUM2,PUM2_3;1;method_id,data_id	0	+	6.20202	0.000212	-1.0	-1.0
+chr1	23	31	PUM2,PUM2_4;1;method_id,data_id	0	+	15.8485	1.64e-05	-1.0	-1.0
+chr1	21	31	PUM2,PUM2_5;1;method_id,data_id	0	+	10.8788	0.000113	-1.0	-1.0
+chr1	35	47	QKI,QKI_4;1;method_id,data_id	0	+	-5.90909	0.000181	-1.0	-1.0
+chr1	35	44	RBM5,RBM5_1;1;method_id,data_id	0	+	7.52525	5.21e-05	-1.0	-1.0
+chr1	60	67	RC3H1,RC3H1_2;1;method_id,data_id	0	+	7.76768	0.000997	-1.0	-1.0
+chr1	13	27	TROVE2,TROVE2_2;1;method_id,data_id	0	+	-20.1313	0.00042	-1.0	-1.0
+chr1	27	41	TROVE2,TROVE2_2;1;method_id,data_id	0	+	-20.1919	0.000704	-1.0	-1.0
+chr1	32	40	TROVE2,TROVE2_5;1;method_id,data_id	0	+	8.83	0.000368	-1.0	-1.0
+chr1	59	72	TROVE2,TROVE2_7;1;method_id,data_id	0	+	-12.6061	0.000794	-1.0	-1.0
+chr1	65	76	SAFB2,SAFB2_1;1;method_id,data_id	0	+	6.32	0.00098	-1.0	-1.0
+chr1	67	74	SART3,SART3_1;1;method_id,data_id	0	+	8.22	0.000763	-1.0	-1.0
+chr1	18	29	SF3A3,SF3A3_1;1;method_id,data_id	0	+	7.58416	0.000793	-1.0	-1.0
+chr1	35	46	SF3A3,SF3A3_1;1;method_id,data_id	0	+	10.3168	0.000128	-1.0	-1.0
+chr1	32	40	SF3A3,SF3A3_4;1;method_id,data_id	0	+	9.57	0.000254	-1.0	-1.0
+chr1	22	30	SF3B4,SF3B4_1;1;method_id,data_id	0	+	7.34	0.000985	-1.0	-1.0
+chr1	43	51	SRSF1,SRSF1_4;1;method_id,data_id	0	+	7.93939	0.000678	-1.0	-1.0
+chr1	50	59	SRSF2,SRSF2_8;1;method_id,data_id	0	+	11.4646	5.89e-05	-1.0	-1.0
+chr1	44	53	SRSF4,SRSF4_1;1;method_id,data_id	0	+	8.28283	0.000231	-1.0	-1.0
+chr1	44	52	SRSF5,SRSF5_1;1;method_id,data_id	0	+	3.93939	0.000409	-1.0	-1.0
+chr1	68	76	SRSF5,SRSF5_1;1;method_id,data_id	0	+	10.8081	0.0002	-1.0	-1.0
+chr1	67	78	SRSF7,SRSF7_2;1;method_id,data_id	0	+	7.27723	0.000652	-1.0	-1.0
+chr1	12	21	TAF15,TAF15_3;1;method_id,data_id	0	+	7.19	0.000808	-1.0	-1.0
+chr1	42	51	TRA2A,TRA2A_5;1;method_id,data_id	0	+	7.68317	0.000727	-1.0	-1.0
+chr1	26	33	TUT1,TUT1_1;1;method_id,data_id	0	+	9.56566	0.000191	-1.0	-1.0
+chr1	26	33	TUT1,TUT1_2;1;method_id,data_id	0	+	9.56566	0.000191	-1.0	-1.0
+chr1	36	45	U2AF1,U2AF1_1;1;method_id,data_id	0	+	10.03	0.000165	-1.0	-1.0
+chr1	36	45	U2AF2,U2AF2_1;1;method_id,data_id	0	+	9.9697	0.000192	-1.0	-1.0
+chr1	25	32	UNK,UNK_2;1;method_id,data_id	0	+	7.78	0.000861	-1.0	-1.0
+chr1	60	68	ZFP36,ZFP36_1;1;method_id,data_id	0	+	9.28	0.000317	-1.0	-1.0
+chr1	59	68	ZFP36L2,ZFP36L2_1;1;method_id,data_id	0	+	8.33333	0.000104	-1.0	-1.0
+chr1	59	68	ZFP36L2,ZFP36L2_2;1;method_id,data_id	0	+	8.33333	0.000104	-1.0	-1.0
+chr1	28	46	SLBP,RF00032;1;method_id,data_id	0	+	13.8	4.2e-05	-1.0	-1.0
diff -r 000000000000 -r 7dd2835ce566 test-data/rbp_hit_stats.compare_test.clipper_idr.tsv
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rbp_hit_stats.compare_test.clipper_idr.tsv	Sun Dec 03 12:51:54 2023 +0000
@@ -0,0 +1,3 @@
+data_id	method_id	run_id	motif_db	rbp_id	c_regions	mean_reg_len	median_reg_len	min_reg_len	max_reg_len	called_reg_size	effective_reg_size	c_reg_with_hits	perc_reg_with_hits	c_motif_hits	c_uniq_motif_hits	c_uniq_motif_nts	perc_uniq_motif_nts_cal_reg	perc_uniq_motif_nts_eff_reg	uniq_motif_hits_cal_1000nt	uniq_motif_hits_eff_1000nt	wc_pval	seq_motif_ids	seq_motif_hits	str_motif_ids	str_motif_hits	internal_id
+k562_eclip	clipper_idr	run_id	human_v0.1	PUM1	32	65.03	61	10	202	2081	2081	6	18.75	8	8	56	2.691013935607881	2.691013935607881	3.8443056222969725	3.8443056222969725	0.12193332097392165	PUM1_1,PUM1_2,PUM1_3	6,2,0	-	-	pZFAGsHH
+k562_eclip	clipper_idr	run_id	human_v0.1	PUM2	77	60.66	55	3	172	4671	4671	59	76.62337662337663	219	219	824	17.64076214943267	17.64076214943267	46.88503532434168	46.88503532434168	0.4736101622265477	PUM2_1,PUM2_2,PUM2_3,PUM2_4,PUM2_5	68,16,39,24,72	-	-	AJ40lTA6
diff -r 000000000000 -r 7dd2835ce566 test-data/rbp_hit_stats.compare_test.dewseq.tsv
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rbp_hit_stats.compare_test.dewseq.tsv	Sun Dec 03 12:51:54 2023 +0000
@@ -0,0 +1,3 @@
+data_id	method_id	run_id	motif_db	rbp_id	c_regions	mean_reg_len	median_reg_len	min_reg_len	max_reg_len	called_reg_size	effective_reg_size	c_reg_with_hits	perc_reg_with_hits	c_motif_hits	c_uniq_motif_hits	c_uniq_motif_nts	perc_uniq_motif_nts_cal_reg	perc_uniq_motif_nts_eff_reg	uniq_motif_hits_cal_1000nt	uniq_motif_hits_eff_1000nt	wc_pval	seq_motif_ids	seq_motif_hits	str_motif_ids	str_motif_hits	internal_id
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	PUM1	23	214.74	195	68	850	4939	4750	10	43.47826086956522	24	24	152	3.0775460619558612	3.2	4.859283255719781	5.052631578947368	0.0071490418994820636	PUM1_1,PUM1_2,PUM1_3	20,2,2	-	-	MVuT5ext
+k562_eclip	dewseq_w100_s5	run_id	human_v0.1	PUM2	70	203.41	187	100	745	14239	12333	65	92.85714285714286	559	448	1737	12.198890371514853	14.084164436876673	31.46288362946836	36.32530608935377	0.9472904311972452	PUM2_1,PUM2_2,PUM2_3,PUM2_4,PUM2_5	138,27,69,48,166	-	-	-sbAn7Po
diff -r 000000000000 -r 7dd2835ce566 test-data/rbp_hit_stats.rbpbench_search.slbp_user.tsv
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rbp_hit_stats.rbpbench_search.slbp_user.tsv	Sun Dec 03 12:51:54 2023 +0000
@@ -0,0 +1,2 @@
+data_id	method_id	run_id	motif_db	rbp_id	c_regions	mean_reg_len	median_reg_len	min_reg_len	max_reg_len	called_reg_size	effective_reg_size	c_reg_with_hits	perc_reg_with_hits	c_motif_hits	c_uniq_motif_hits	c_uniq_motif_nts	perc_uniq_motif_nts_cal_reg	perc_uniq_motif_nts_eff_reg	uniq_motif_hits_cal_1000nt	uniq_motif_hits_eff_1000nt	wc_pval	seq_motif_ids	seq_motif_hits	str_motif_ids	str_motif_hits	internal_id
+data_id	method_id	run_id	user	SLBP_USER	1	63	63	63	63	63	63	1	100.0	1	1	25	39.682539682539684	39.682539682539684	15.873015873015873	15.873015873015873	1.0	-	-	RF00032	1	RuDIjV1k
diff -r 000000000000 -r 7dd2835ce566 test-data/rbp_hit_stats.rbpbench_search.tsv
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rbp_hit_stats.rbpbench_search.tsv	Sun Dec 03 12:51:54 2023 +0000
@@ -0,0 +1,3 @@
+data_id	method_id	run_id	motif_db	rbp_id	c_regions	mean_reg_len	median_reg_len	min_reg_len	max_reg_len	called_reg_size	effective_reg_size	c_reg_with_hits	perc_reg_with_hits	c_motif_hits	c_uniq_motif_hits	c_uniq_motif_nts	perc_uniq_motif_nts_cal_reg	perc_uniq_motif_nts_eff_reg	uniq_motif_hits_cal_1000nt	uniq_motif_hits_eff_1000nt	wc_pval	seq_motif_ids	seq_motif_hits	str_motif_ids	str_motif_hits	internal_id
+data_id	method_id	run_id	human_v0.1	PUM1	1	70	70	70	70	70	70	1	100.0	1	1	8	11.428571428571429	11.428571428571429	14.285714285714285	14.285714285714285	1.0	PUM1_1,PUM1_2,PUM1_3	0,0,1	-	-	h2FelLqa
+data_id	method_id	run_id	human_v0.1	PUM2	1	70	70	70	70	70	70	1	100.0	4	4	10	14.285714285714285	14.285714285714285	57.14285714285714	57.14285714285714	1.0	PUM2_1,PUM2_2,PUM2_3,PUM2_4,PUM2_5	1,0,1,1,1	-	-	HcD7_nJz
diff -r 000000000000 -r 7dd2835ce566 test-data/rbp_hit_stats.table_test.tsv
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rbp_hit_stats.table_test.tsv	Sun Dec 03 12:51:54 2023 +0000
@@ -0,0 +1,3 @@
+data_id	method_id	run_id	motif_db	rbp_id	c_regions	mean_reg_len	median_reg_len	min_reg_len	max_reg_len	called_reg_size	effective_reg_size	c_reg_with_hits	perc_reg_with_hits	c_motif_hits	c_uniq_motif_hits	c_uniq_motif_nts	perc_uniq_motif_nts_cal_reg	perc_uniq_motif_nts_eff_reg	uniq_motif_hits_cal_1000nt	uniq_motif_hits_eff_1000nt	wc_pval	seq_motif_ids	seq_motif_hits	str_motif_ids	str_motif_hits	internal_id
+did1	mid1	run_id	human_v0.1	PUM1	1	70	70	70	70	70	70	1	100.0	1	1	8	11.428571428571429	11.428571428571429	14.285714285714285	14.285714285714285	1.0	PUM1_1,PUM1_2,PUM1_3	0,0,1	-	-	NInGOqIN
+did2	mid2	run_id	human_v0.1	PUM2	1	70	70	70	70	70	70	1	100.0	4	4	10	14.285714285714285	14.285714285714285	57.14285714285714	57.14285714285714	1.0	PUM2_1,PUM2_2,PUM2_3,PUM2_4,PUM2_5	1,0,1,1,1	-	-	u7eY1SoG
diff -r 000000000000 -r 7dd2835ce566 test-data/rbp_hit_stats.test_batch.tsv
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rbp_hit_stats.test_batch.tsv	Sun Dec 03 12:51:54 2023 +0000
@@ -0,0 +1,3 @@
+data_id	method_id	run_id	motif_db	rbp_id	c_regions	mean_reg_len	median_reg_len	min_reg_len	max_reg_len	called_reg_size	effective_reg_size	c_reg_with_hits	perc_reg_with_hits	c_motif_hits	c_uniq_motif_hits	c_uniq_motif_nts	perc_uniq_motif_nts_cal_reg	perc_uniq_motif_nts_eff_reg	uniq_motif_hits_cal_1000nt	uniq_motif_hits_eff_1000nt	wc_pval	seq_motif_ids	seq_motif_hits	str_motif_ids	str_motif_hits	internal_id
+data-id1	method-id1	run_id	human_v0.1	PUM1	1	70	70	70	70	70	70	1	100.0	1	1	8	11.428571428571429	11.428571428571429	14.285714285714285	14.285714285714285	1.0	PUM1_1,PUM1_2,PUM1_3	0,0,1	-	-	TT41sPJM
+data-id2	method-id2	run_id	human_v0.1	PUM2	1	70	70	70	70	70	70	1	100.0	4	4	10	14.285714285714285	14.285714285714285	57.14285714285714	57.14285714285714	1.0	PUM2_1,PUM2_2,PUM2_3,PUM2_4,PUM2_5	1,0,1,1,1	-	-	-dJ6C0OI
diff -r 000000000000 -r 7dd2835ce566 test-data/report.rbpbench_compare.test.html
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/report.rbpbench_compare.test.html	Sun Dec 03 12:51:54 2023 +0000
@@ -0,0 +1,98 @@
+<p><head>
+<title>RBPBench - Motif Search Comparison Report</title></p>
+<script src="/home/malong/miniconda3/envs/rbpbench/lib/python3.9/site-packages/rbpbench/content/sorttable.js" type="text/javascript"></script>
+<p></head></p>
+<h1>Comparison Report</h1>
+<p>List of available comparison statistics generated
+by RBPBench (rbpbench compare):</p>
+<ul>
+<li><a href="#method-tab-1">k562_eclip,human_v0.1,PUM1 method comparison table</a></li>
+<li><a href="#method-tab-2">k562_eclip,human_v0.1,PUM2 method comparison table</a></li>
+<li><a href="#method-venn-1">k562_eclip,human_v0.1,PUM1 method comparison plot</a></li>
+<li><a href="#method-venn-2">k562_eclip,human_v0.1,PUM2 method comparison plot</a></li>
+</ul>
+<p>&nbsp;</p>
+<h2 id="method-tab-1">k562_eclip,human_v0.1,PUM1 method comparison statistics</h2>
+<p><strong>Table:</strong> RBP motif hit statistics for combined ID "k562_eclip,human_v0.1,PUM1" (data ID, motif database ID, RBP ID) over different methods (method ID column).</p>
+<table class="sortable">
+<thead>
+<tr>
+<th style="text-align: center;">Method ID</th>
+<th style="text-align: center;"># regions</th>
+<th style="text-align: center;"># motif hits</th>
+<th style="text-align: center;">% regions with motifs</th>
+<th style="text-align: center;">% motif nucleotides</th>
+<th style="text-align: center;"># motif hits per 1000 nt</th>
+</tr>
+</thead>
+<tbody>
+<tr>
+<td style="text-align: center;">dewseq_w100_s5</td>
+<td style="text-align: center;">23</td>
+<td style="text-align: center;">24</td>
+<td style="text-align: center;">43.48</td>
+<td style="text-align: center;">3.20</td>
+<td style="text-align: center;">4.86</td>
+</tr>
+<tr>
+<td style="text-align: center;">clipper_idr</td>
+<td style="text-align: center;">32</td>
+<td style="text-align: center;">8</td>
+<td style="text-align: center;">18.75</td>
+<td style="text-align: center;">2.69</td>
+<td style="text-align: center;">3.84</td>
+</tr>
+</tbody>
+</table>
+<p>&nbsp;
+&nbsp;</p>
+<p>Column IDs have the following meanings: <strong>Method ID</strong> -&gt; method ID set for dataset (typically peak calling method ID), <strong># regions</strong> -&gt; number of peak regions used for motif search, <strong># motif hits</strong> -&gt; number of unique motif hits in peak regions (removed double counts), <strong>% regions with motifs</strong> -&gt; percentage of peak regions with motif hits, <strong>% motif nucleotides</strong> -&gt; percentage of unique motif nucleotides over effective peak region size (overlapping regions merged), <strong># motif hits per 1000 nt</strong> -&gt; number of motif hits over 1000 nt of called peak region size (overlapping regions NOT merged).</p>
+<h2 id="method-tab-2">k562_eclip,human_v0.1,PUM2 method comparison statistics</h2>
+<p><strong>Table:</strong> RBP motif hit statistics for combined ID "k562_eclip,human_v0.1,PUM2" (data ID, motif database ID, RBP ID) over different methods (method ID column).</p>
+<table class="sortable">
+<thead>
+<tr>
+<th style="text-align: center;">Method ID</th>
+<th style="text-align: center;"># regions</th>
+<th style="text-align: center;"># motif hits</th>
+<th style="text-align: center;">% regions with motifs</th>
+<th style="text-align: center;">% motif nucleotides</th>
+<th style="text-align: center;"># motif hits per 1000 nt</th>
+</tr>
+</thead>
+<tbody>
+<tr>
+<td style="text-align: center;">dewseq_w100_s5</td>
+<td style="text-align: center;">70</td>
+<td style="text-align: center;">448</td>
+<td style="text-align: center;">92.86</td>
+<td style="text-align: center;">14.08</td>
+<td style="text-align: center;">31.46</td>
+</tr>
+<tr>
+<td style="text-align: center;">clipper_idr</td>
+<td style="text-align: center;">77</td>
+<td style="text-align: center;">219</td>
+<td style="text-align: center;">76.62</td>
+<td style="text-align: center;">17.64</td>
+<td style="text-align: center;">46.89</td>
+</tr>
+</tbody>
+</table>
+<p>&nbsp;
+&nbsp;</p>
+<p>Column IDs have the following meanings: <strong>Method ID</strong> -&gt; method ID set for dataset (typically peak calling method ID), <strong># regions</strong> -&gt; number of peak regions used for motif search, <strong># motif hits</strong> -&gt; number of unique motif hits in peak regions (removed double counts), <strong>% regions with motifs</strong> -&gt; percentage of peak regions with motif hits, <strong>% motif nucleotides</strong> -&gt; percentage of unique motif nucleotides over effective peak region size (overlapping regions merged), <strong># motif hits per 1000 nt</strong> -&gt; number of motif hits over 1000 nt of called peak region size (overlapping regions NOT merged).</p>
+<h2 id="method-venn-1">k562_eclip,human_v0.1,PUM1 method comparison plot</h2>
+<p>Based on the same combined ID "k562_eclip,human_v0.1,PUM1" (data ID, motif database ID, RBP ID), motif hit occurrences for 2 different methods (clipper_idr,dewseq_w100_s5) are compared via Venn diagram.
+Any given motif hit can either be found only by one method, or be identified by any set (&gt;=2) of methods (intersection areas).</p>
+<p><img src="html_report_plots/venn_diagram.method_comp.k562_eclip,human_v0.1,PUM1.png" alt="dataset comparison plot k562_eclip,human_v0.1,PUM1
+title="dataset comparison plot k562_eclip,human_v0.1,PUM1" width="700" /></p>
+<p><strong>Figure:</strong> Venn diagram of motif hit occurrences for 2 different methods (clipper_idr,dewseq_w100_s5) with identical combined ID (k562_eclip,human_v0.1,PUM1) + corresponding percentages of total motif hits for each region (method exclusive and intersection(s)).</p>
+<p>&nbsp;</p>
+<h2 id="method-venn-2">k562_eclip,human_v0.1,PUM2 method comparison plot</h2>
+<p>Based on the same combined ID "k562_eclip,human_v0.1,PUM2" (data ID, motif database ID, RBP ID), motif hit occurrences for 2 different methods (clipper_idr,dewseq_w100_s5) are compared via Venn diagram.
+Any given motif hit can either be found only by one method, or be identified by any set (&gt;=2) of methods (intersection areas).</p>
+<p><img src="html_report_plots/venn_diagram.method_comp.k562_eclip,human_v0.1,PUM2.png" alt="dataset comparison plot k562_eclip,human_v0.1,PUM2
+title="dataset comparison plot k562_eclip,human_v0.1,PUM2" width="700" /></p>
+<p><strong>Figure:</strong> Venn diagram of motif hit occurrences for 2 different methods (clipper_idr,dewseq_w100_s5) with identical combined ID (k562_eclip,human_v0.1,PUM2) + corresponding percentages of total motif hits for each region (method exclusive and intersection(s)).</p>
+<p>&nbsp;</p>
diff -r 000000000000 -r 7dd2835ce566 test-data/report.rbpbench_search.html
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/report.rbpbench_search.html	Sun Dec 03 12:51:54 2023 +0000
@@ -0,0 +1,83 @@
+<p><head>
+<title>RBPBench - Search Report</title></p>
+<script src="/home/uhlm/Programme/miniconda3/envs/rbpbench/lib/python3.11/site-packages/rbpbench/content/sorttable.js" type="text/javascript"></script>
+<p></head></p>
+<h1>Search report</h1>
+<p>List of available statistics and plots generated
+by RBPBench (rbpbench search --report):</p>
+<ul>
+<li><a href="#rbp-enrich-stats">RBP motif enrichment statistics</a></li>
+<li><a href="#cooc-heat-map">RBP co-occurrences heat map</a></li>
+<li><a href="#corr-heat-map">RBP correlations heat map</a>
+&nbsp;</li>
+</ul>
+<h2 id="rbp-enrich-stats">RBP motif enrichment statistics</h2>
+<p><strong>Table:</strong> RBP motif enrichment statistics. Given a score for each genomic region (# input regions = 1), 
+RBPbench checks whether motifs are enriched 
+in higher-scoring regions (using Wilcoxon rank-sum test). A low Wilcoxon rank-sum test p-value for a given RBP thus indicates 
+that higher-scoring regions are more likely to contain motif hits of the respective RBP. NOTE that if scores associated to 
+input genomic regions are all the same, p-values become meaningless (i.e., they result in p-values of 1.0).</p>
+<table class="sortable">
+<thead>
+<tr>
+<th style="text-align: center;">RBP ID</th>
+<th style="text-align: center;"># hit regions</th>
+<th style="text-align: center;">% hit regions</th>
+<th style="text-align: center;"># motif hits</th>
+<th style="text-align: center;">p-value</th>
+</tr>
+</thead>
+<tbody>
+<tr>
+<td style="text-align: center;">PUM1</td>
+<td style="text-align: center;">1</td>
+<td style="text-align: center;">100.00</td>
+<td style="text-align: center;">1</td>
+<td style="text-align: center;">1.0</td>
+</tr>
+<tr>
+<td style="text-align: center;">PUM2</td>
+<td style="text-align: center;">1</td>
+<td style="text-align: center;">100.00</td>
+<td style="text-align: center;">4</td>
+<td style="text-align: center;">1.0</td>
+</tr>
+</tbody>
+</table>
+<p>&nbsp;
+&nbsp;</p>
+<p>Column IDs have the following meanings: <strong>RBP ID</strong> -&gt; RBP ID from database or user-defined (typically RBP name), <strong># hit regions</strong> -&gt; number of input genomic regions with motif hits (after filtering and optional extension), <strong>% hit regions</strong> -&gt; percentage of hit regions over all regions (i.e. how many input regions contain &gt;= 1 RBP binding motif), <strong># motif hits</strong> -&gt; number of unique motif hits in input regions (removed double counts), <strong>p-value</strong> -&gt; Wilcoxon rank-sum test p-value.</p>
+<h2 id="cooc-heat-map">RBP co-occurrences heat map</h2>
+<p>RBP co-occurrences heat map.</p>
+<div class=class="container-fluid" style="margin-top:40px">
+<iframe src="html_report_plots/co-occurrence_plot.plotly.html" width="1200" height="1200"></iframe>
+</div>
+
+<p><strong>Figure:</strong> Heat map of co-occurrences (Fisher's exact test p-values) between RBPs. 
+Legend color: negative logarithm (base 10) of Fisher's exact test p-value.
+Hover box: 1) RBP1. 2) RBP2. 3) p-value: Fisher's exact test p-value (calculated based on contingency table between RBP1 and RBP2). 
+4) RBPs compaired. 5) Counts[]: Contingency table of co-occurrence counts (i.e., number of genomic regions with/without shared motif hits) between compaired RBPs, 
+with format [[A, B], [C, D]], where 
+A: RBP1 AND RBP2, 
+B: NOT RBP1 AND RBP2
+C: RBP1 AND NOT RBP2
+D: NOT RBP1 AND NOT RBP2. </p>
+<p>&nbsp;</p>
+<h2 id="corr-heat-map">RBP correlations heat map</h2>
+<p>RBP correlations heat map.</p>
+<div class=class="container-fluid" style="margin-top:40px">
+<iframe src="html_report_plots/correlation_plot.plotly.html" width="1200" height="1200"></iframe>
+</div>
+
+<p><strong>Figure:</strong> Heat map of correlations (Pearson correlation coefficients) between RBPs. 
+Genomic regions are labelled 1 or 0 (RBP motif present or not), resulting in a vector of 1s and 0s for each RBP.
+Correlations are then calculated by comparing vectors for every pair of RBPs.
+Legend color: Pearson correlation coefficient. 
+Hover box: 1) RBP1. 2) RBP2.
+3) RBPs compaired. 5) Counts[]: Contingency table of co-occurrence counts (i.e., number of genomic regions with/without shared motif hits) between compaired RBPs, 
+with format [[A, B], [C, D]], where 
+A: RBP1 AND RBP2, 
+B: NOT RBP1 AND RBP2
+C: RBP1 AND NOT RBP2
+D: NOT RBP1 AND NOT RBP2. </p>
+<p>&nbsp;</p>
diff -r 000000000000 -r 7dd2835ce566 test-data/test.bed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/test.bed	Sun Dec 03 12:51:54 2023 +0000
@@ -0,0 +1,1 @@
+chr1	10	80	PUM1_K562_IDR	0	+
diff -r 000000000000 -r 7dd2835ce566 test-data/test.fa
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/test.fa	Sun Dec 03 12:51:54 2023 +0000
@@ -0,0 +1,2 @@
+>chr1
+TCTTATTAATACTGGTTGTGATTTGTAGATACTGGCTCTTCTCAGATGAAGTTCCAGGATTATTCATTGAAAAAGGCTGGGTACATGAC
diff -r 000000000000 -r 7dd2835ce566 test-data/test.slbp_user.bed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/test.slbp_user.bed	Sun Dec 03 12:51:54 2023 +0000
@@ -0,0 +1,1 @@
+chr1	50	113	SLBP_K562_IDR	0	+
diff -r 000000000000 -r 7dd2835ce566 test-data/test.slbp_user.fa
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/test.slbp_user.fa	Sun Dec 03 12:51:54 2023 +0000
@@ -0,0 +1,2 @@
+>chr1
+AACATCCAGGCTGTGCTACTGCCCAAGAAGACCGAGAGTCACCACAAGGCCAAAGGCAAATAATGTCTCCATAGAATCACTTTCCAATACAACGGCTCTTTTCAGAGCCACCT
diff -r 000000000000 -r 7dd2835ce566 test-data/test1.bed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/test1.bed	Sun Dec 03 12:51:54 2023 +0000
@@ -0,0 +1,1 @@
+chr1	10	80	PUM1_K562_IDR	0	+
diff -r 000000000000 -r 7dd2835ce566 test-data/test2.bed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/test2.bed	Sun Dec 03 12:51:54 2023 +0000
@@ -0,0 +1,1 @@
+chr1	10	80	PUM1_K562_IDR	0	+
diff -r 000000000000 -r 7dd2835ce566 test-data/test_custom.info.txt
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/test_custom.info.txt	Sun Dec 03 12:51:54 2023 +0000
@@ -0,0 +1,10 @@
+RBP_motif_id	RBP_name	Motif_type	Organism
+PUM1_1	PUM1	meme_xml	human
+PUM1_2	PUM1	meme_xml	human
+PUM1_3	PUM1	meme_xml	human
+PUM2_1	PUM2	meme_xml	human
+PUM2_2	PUM2	meme_xml	human
+PUM2_3	PUM2	meme_xml	human
+PUM2_4	PUM2	meme_xml	human
+PUM2_5	PUM2	meme_xml	human
+RF00032	SLBP	cm	human
diff -r 000000000000 -r 7dd2835ce566 test-data/test_custom.motif_hits.rbpbench_search.bed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/test_custom.motif_hits.rbpbench_search.bed	Sun Dec 03 12:51:54 2023 +0000
@@ -0,0 +1,6 @@
+chr1	23	31	PUM1,PUM1_3;1;method_id,data_id	0	+	12.8182	4.87e-05	-1.0	-1.0
+chr1	23	31	PUM2,PUM2_1;1;method_id,data_id	0	+	10.404	0.000113	-1.0	-1.0
+chr1	23	31	PUM2,PUM2_3;1;method_id,data_id	0	+	6.20202	0.000212	-1.0	-1.0
+chr1	23	31	PUM2,PUM2_4;1;method_id,data_id	0	+	15.8485	1.64e-05	-1.0	-1.0
+chr1	21	31	PUM2,PUM2_5;1;method_id,data_id	0	+	10.8788	0.000113	-1.0	-1.0
+chr1	28	46	SLBP,RF00032;1;method_id,data_id	0	+	13.8	4.2e-05	-1.0	-1.0
diff -r 000000000000 -r 7dd2835ce566 test-data/test_custom.seq_motifs.meme
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/test_custom.seq_motifs.meme	Sun Dec 03 12:51:54 2023 +0000
@@ -0,0 +1,99 @@
+MEME version 5
+
+ALPHABET= ACGT
+
+strands: +
+
+Background letter frequencies
+A 0.250000 C 0.250000 G 0.250000 T 0.250000
+
+MOTIF PUM1_1 
+letter-probability matrix: alength= 4 w= 7 nsites= 20 E= 0
+ 0.000000  0.000000  1.000000  0.000000 
+ 0.000000  0.000000  1.000000  0.000000 
+ 0.000000  0.000000  1.000000  0.000000 
+ 0.223900  0.184800  0.212700  0.378600 
+ 0.000000  0.000000  1.000000  0.000000 
+ 0.000000  0.000000  0.835718  0.164282 
+ 0.041300  0.041200  0.876300  0.041200 
+
+MOTIF PUM1_2 
+letter-probability matrix: alength= 4 w= 9 nsites= 20 E= 0
+ 0.000000  0.000000  0.000000  1.000000 
+ 0.000000  0.000000  0.500000  0.500000 
+ 0.000000  0.000000  0.000000  1.000000 
+ 1.000000  0.000000  0.000000  0.000000 
+ 1.000000  0.000000  0.000000  0.000000 
+ 0.000000  0.000000  0.000000  1.000000 
+ 0.500000  0.000000  0.500000  0.000000 
+ 0.000000  0.000000  0.000000  1.000000 
+ 0.000000  0.000000  0.000000  1.000000 
+
+MOTIF PUM1_3 
+letter-probability matrix: alength= 4 w= 8 nsites= 20 E= 0
+ 0.000000  0.000000  0.000000  1.000000 
+ 0.000000  0.000000  1.000000  0.000000 
+ 0.000000  0.000000  0.000000  1.000000 
+ 0.919505  0.080495  0.000000  0.000000 
+ 0.145800  0.458500  0.168500  0.227200 
+ 1.000000  0.000000  0.000000  0.000000 
+ 0.000000  0.000000  0.100031  0.899969 
+ 0.867950  0.132050  0.000000  0.000000 
+
+MOTIF PUM2_1 
+letter-probability matrix: alength= 4 w= 8 nsites= 20 E= 0
+ 0.000000  0.000000  0.000000  1.000000 
+ 0.000000  0.000000  1.000000  0.000000 
+ 0.000000  0.000000  0.000000  1.000000 
+ 1.000000  0.000000  0.000000  0.000000 
+ 0.397900  0.158200  0.026000  0.417900 
+ 1.000000  0.000000  0.000000  0.000000 
+ 0.000000  0.000000  0.000000  1.000000 
+ 0.843493  0.000000  0.000000  0.156507 
+
+MOTIF PUM2_2 
+letter-probability matrix: alength= 4 w= 8 nsites= 20 E= 0
+ 0.000000  0.000000  0.000000  1.000000 
+ 0.000000  0.000000  1.000000  0.000000 
+ 0.000000  0.000000  0.000000  1.000000 
+ 1.000000  0.000000  0.000000  0.000000 
+ 0.000000  1.000000  0.000000  0.000000 
+ 1.000000  0.000000  0.000000  0.000000 
+ 0.000000  0.000000  0.000000  1.000000 
+ 0.000000  1.000000  0.000000  0.000000 
+
+MOTIF PUM2_3 
+letter-probability matrix: alength= 4 w= 8 nsites= 20 E= 0
+ 0.000000  0.000000  0.000000  1.000000 
+ 0.000000  0.000000  1.000000  0.000000 
+ 0.000000  0.000000  0.000000  1.000000 
+ 1.000000  0.000000  0.000000  0.000000 
+ 1.000000  0.000000  0.000000  0.000000 
+ 1.000000  0.000000  0.000000  0.000000 
+ 0.000000  0.000000  0.000000  1.000000 
+ 1.000000  0.000000  0.000000  0.000000 
+
+MOTIF PUM2_4 
+letter-probability matrix: alength= 4 w= 8 nsites= 20 E= 0
+ 0.000000  0.000000  0.000000  1.000000 
+ 0.000000  0.000000  1.000000  0.000000 
+ 0.000000  0.000000  0.000000  1.000000 
+ 1.000000  0.000000  0.000000  0.000000 
+ 0.000000  0.000000  1.000000  0.000000 
+ 1.000000  0.000000  0.000000  0.000000 
+ 0.000000  0.000000  0.000000  1.000000 
+ 1.000000  0.000000  0.000000  0.000000 
+
+MOTIF PUM2_5 
+letter-probability matrix: alength= 4 w= 10 nsites= 20 E= 0
+ 0.253775  0.137486  0.112989  0.495750 
+ 0.270800  0.141400  0.146600  0.441200 
+ 0.000000  0.000000  0.000000  1.000000 
+ 0.072132  0.000000  0.896223  0.031646 
+ 0.000000  0.000000  0.000000  1.000000 
+ 0.968974  0.000000  0.031026  0.000000 
+ 0.232400  0.319800  0.028700  0.419100 
+ 0.932355  0.000000  0.000000  0.067645 
+ 0.121986  0.000000  0.173847  0.704167 
+ 0.517200  0.063500  0.123600  0.295700 
+
diff -r 000000000000 -r 7dd2835ce566 test-data/test_custom.str_motifs.cm
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/test_custom.str_motifs.cm	Sun Dec 03 12:51:54 2023 +0000
@@ -0,0 +1,385 @@
+INFERNAL1/a [1.1.3 | Nov 2019]
+NAME     Histone3
+ACC      RF00032
+DESC     Histone 3' UTR stem-loop
+STATES   142
+NODES    42
+CLEN     46
+W        57
+ALPH     RNA
+RF       no
+CONS     yes
+MAP      yes
+DATE     Fri Apr  4 13:03:46 2014
+COM      [1] /nfs/production/xfam/rfam/software/bin/cmbuild -F CM SEED
+COM      [2] /nfs/production/xfam/rfam/software/bin/cmcalibrate --mpi CM
+PBEGIN   0.05
+PEND     0.05
+WBETA    1e-07
+QDBBETA1 1e-07
+QDBBETA2 1e-15
+N2OMEGA  1.52588e-05
+N3OMEGA  1.52588e-05
+ELSELF   -0.08926734
+NSEQ     46
+EFFN     46.000000
+CKSUM    471917655
+NULL     0.000  0.000  0.000  0.000 
+GA       25.00
+TC       25.00
+NC       24.90
+EFP7GF   -8.9961 0.74543
+ECMLC    0.73248    -4.63583     3.49505     1600000      463131  0.002591
+ECMGC    0.50982    -9.05666     1.92502     1600000      108029  0.003703
+ECMLI    0.86412    -1.32523     4.80439     1600000      239617  0.005008
+ECMGI    0.55516    -6.80684     2.91667     1600000       88393  0.004525
+CM
+                                             [ ROOT    0 ]      -      - - - - -
+     S     0    -1 0     1     4     1     1    57    76 -10.705 -10.912  -0.004  -9.326                 
+    IL     1     1 2     1     4     1    19    64    83  -1.686  -2.369  -1.117  -4.855                  0.000  0.000  0.000  0.000 
+    IR     2     2 3     2     3     1    19    63    81  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL    1 ]      1      - c - - -
+    ML     3     2 3     5     3     1    19    57    76 -11.622  -0.002 -10.276                          0.274  0.676 -1.683 -0.183 
+     D     4     2 3     5     3     0    15    58    76  -6.174  -1.687  -0.566                         
+    IL     5     5 3     5     3     1    18    62    80  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL    2 ]      2      - c - - -
+    ML     6     5 3     8     3     1    18    56    75 -11.622  -0.002 -10.276                          0.562  0.685 -1.974 -0.595 
+     D     7     5 3     8     3     0    15    57    75  -6.174  -1.687  -0.566                         
+    IL     8     8 3     8     3     1    17    61    79  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL    3 ]      3      - A - - -
+    ML     9     8 3    11     3     1    17    55    74 -11.622  -0.002 -10.276                          1.588 -1.105 -4.684 -1.031 
+     D    10     8 3    11     3     0    14    56    74  -6.174  -1.687  -0.566                         
+    IL    11    11 3    11     3     1    17    60    78  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL    4 ]      4      - A - - -
+    ML    12    11 3    14     3     1    16    54    73 -11.622  -0.002 -10.276                          1.035 -0.025 -1.895 -0.517 
+     D    13    11 3    14     3     0    14    55    73  -6.174  -1.687  -0.566                         
+    IL    14    14 3    14     3     1    16    59    77  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL    5 ]      5      - a - - -
+    ML    15    14 3    17     3     1    15    53    72 -11.923  -0.687  -1.402                          0.970  0.662 -4.530 -1.266 
+     D    16    14 3    17     3     0    14    52    71  -5.620  -0.734  -1.403                         
+    IL    17    17 3    17     3     1    15    55    73  -1.925  -0.554  -4.164                          0.000  0.000  0.000  0.000 
+                                             [ MATR    6 ]      -     47 - U - -
+    MR    18    17 3    20     3     1    14    52    71 -11.239  -0.003  -9.556                         -1.280 -3.255 -0.399  1.446 
+     D    19    17 3    20     3     0    13    51    70 -11.650  -0.025  -5.880                         
+    IR    20    20 3    20     3     1    12    54    72  -1.925  -0.554  -4.164                          0.000  0.000  0.000  0.000 
+                                             [ MATR    7 ]      -     46 - g - -
+    MR    21    20 3    23     3     1    14    51    70 -11.923  -0.002 -10.241                          0.333 -0.456  0.341 -0.425 
+     D    22    20 3    23     3     0     8    50    68  -6.390  -1.568  -0.620                         
+    IR    23    23 3    23     3     1    12    53    71  -1.925  -0.554  -4.164                          0.000  0.000  0.000  0.000 
+                                             [ MATR    8 ]      -     45 - U - -
+    MR    24    23 3    26     3     1    13    50    69 -11.923  -0.002 -10.241                          0.022 -0.397 -2.351  1.021 
+     D    25    23 3    26     3     0     7    49    67  -6.390  -1.568  -0.620                         
+    IR    26    26 3    26     3     1    11    52    70  -1.925  -0.554  -4.164                          0.000  0.000  0.000  0.000 
+                                             [ MATR    9 ]      -     44 - u - -
+    MR    27    26 3    29     3     1    12    49    68 -11.923  -0.002 -10.241                          0.188 -0.473 -0.169  0.323 
+     D    28    26 3    29     3     0     6    48    66  -6.390  -1.568  -0.620                         
+    IR    29    29 3    29     3     1    10    51    69  -1.925  -0.554  -4.164                          0.000  0.000  0.000  0.000 
+                                             [ MATR   10 ]      -     43 - u - -
+    MR    30    29 3    32     3     1    11    48    67 -11.923  -0.002 -10.241                          0.043 -1.204  0.229  0.448 
+     D    31    29 3    32     3     0     5    47    65  -6.390  -1.568  -0.620                         
+    IR    32    32 3    32     3     1    10    50    68  -1.925  -0.554  -4.164                          0.000  0.000  0.000  0.000 
+                                             [ MATR   11 ]      -     42 - u - -
+    MR    33    32 3    35     3     1    10    47    66 -11.923  -0.037  -5.328                          0.283 -0.639 -0.668  0.596 
+     D    34    32 3    35     3     0     5    46    64  -6.390  -1.568  -0.620                         
+    IR    35    35 3    35     3     1     9    49    67  -1.925  -0.554  -4.164                          0.000  0.000  0.000  0.000 
+                                             [ MATR   12 ]      -     41 - a - -
+    MR    36    35 3    38     3     1     9    46    65 -11.888  -0.002 -10.205                          0.690 -2.247  0.302 -0.084 
+     D    37    35 3    38     3     0     4    45    64  -8.147  -0.315  -2.376                         
+    IR    38    38 3    38     3     1     7    48    66  -1.925  -0.554  -4.164                          0.000  0.000  0.000  0.000 
+                                             [ MATR   13 ]      -     40 - a - -
+    MR    39    38 3    41     3     1     8    45    64 -11.923  -0.002 -10.241                          0.896 -0.277 -0.185 -1.204 
+     D    40    38 3    41     3     0     2    44    62  -6.390  -1.568  -0.620                         
+    IR    41    41 3    41     3     1     6    47    65  -1.925  -0.554  -4.164                          0.000  0.000  0.000  0.000 
+                                             [ MATR   14 ]      -     39 - A - -
+    MR    42    41 3    44     3     1     7    44    63 -11.923  -0.002 -10.241                          1.147 -1.015 -0.320 -1.029 
+     D    43    41 3    44     3     0     1    43    61  -6.390  -1.568  -0.620                         
+    IR    44    44 3    44     3     1     5    46    64  -1.925  -0.554  -4.164                          0.000  0.000  0.000  0.000 
+                                             [ MATR   15 ]      -     38 - a - -
+    MR    45    44 3    47     3     1     7    43    62 -11.923  -0.027  -5.794                          0.871 -0.426 -0.479 -0.497 
+     D    46    44 3    47     3     0     1    42    60  -6.390  -1.568  -0.620                         
+    IR    47    47 3    47     3     1     5    45    63  -1.925  -0.554  -4.164                          0.000  0.000  0.000  0.000 
+                                             [ MATR   16 ]      -     37 - a - -
+    MR    48    47 3    50     3     1     6    42    61 -11.898  -0.002 -10.216                          0.726 -0.863 -0.477  0.109 
+     D    49    47 3    50     3     0     0    41    60  -7.823  -0.406  -2.053                         
+    IR    50    50 3    50     3     1     3    44    62  -1.925  -0.554  -4.164                          0.000  0.000  0.000  0.000 
+                                             [ MATR   17 ]      -     36 - a - -
+    MR    51    50 3    53     3     1     5    41    60 -11.923  -0.002 -10.241                          0.725 -1.911 -0.230  0.297 
+     D    52    50 3    53     3     0     0    40    58  -6.390  -1.568  -0.620                         
+    IR    53    53 3    53     3     1     3    43    61  -1.925  -0.554  -4.164                          0.000  0.000  0.000  0.000 
+                                             [ MATR   18 ]      -     35 - a - -
+    MR    54    53 3    56     3     1     4    40    59 -11.923  -0.002 -10.241                          0.828 -0.827 -1.719  0.441 
+     D    55    53 3    56     3     0     0    39    57  -6.390  -1.568  -0.620                         
+    IR    56    56 3    56     3     1     2    42    60  -1.925  -0.554  -4.164                          0.000  0.000  0.000  0.000 
+                                             [ MATR   19 ]      -     34 - c - -
+    MR    57    56 3    59     3     1     3    39    58 -11.923  -0.002 -10.241                          0.119  0.695 -0.517 -0.745 
+     D    58    56 3    59     3     0     0    38    56  -6.390  -1.568  -0.620                         
+    IR    59    59 3    59     3     1     2    41    59  -1.925  -0.554  -4.164                          0.000  0.000  0.000  0.000 
+                                             [ MATR   20 ]      -     33 - a - -
+    MR    60    59 3    62     3     1     2    38    57 -11.923  -0.002 -10.241                          0.569 -0.255 -1.396  0.378 
+     D    61    59 3    62     3     0     0    37    55  -6.390  -1.568  -0.620                         
+    IR    62    62 3    62     3     1     1    40    58  -1.925  -0.554  -4.164                          0.000  0.000  0.000  0.000 
+                                             [ MATR   21 ]      -     32 - u - -
+    MR    63    62 3    65     3     1     1    37    56 -11.923  -0.056  -4.714                          0.347 -0.205 -0.853  0.387 
+     D    64    62 3    65     3     0     0    36    54  -6.390  -1.568  -0.620                         
+    IR    65    65 3    65     3     1     1    39    57  -1.925  -0.554  -4.164                          0.000  0.000  0.000  0.000 
+                                             [ MATR   22 ]      -     31 - u - -
+    MR    66    65 3    68     3     1     3    36    55 -11.868  -0.002 -10.186                          0.706 -1.486 -1.611  0.752 
+     D    67    65 3    68     3     0     0    35    54  -8.618  -0.220  -2.847                         
+    IR    68    68 3    68     3     1     1    38    56  -1.925  -0.554  -4.164                          0.000  0.000  0.000  0.000 
+                                             [ MATR   23 ]      -     30 - u - -
+    MR    69    68 3    71     3     1     2    35    54 -11.923  -0.002 -10.241                         -0.972 -0.369  0.214  0.638 
+     D    70    68 3    71     3     0     0    34    52  -6.390  -1.568  -0.620                         
+    IR    71    71 3    71     3     1     1    37    55  -1.925  -0.554  -4.164                          0.000  0.000  0.000  0.000 
+                                             [ MATR   24 ]      -     29 - A - -
+    MR    72    71 3    74     3     1     1    34    53 -11.923  -0.047  -4.982                          1.166 -1.748 -1.275  0.063 
+     D    73    71 3    74     3     0     0    33    52  -6.390  -1.568  -0.620                         
+    IR    74    74 3    74     3     1     1    36    54  -1.925  -0.554  -4.164                          0.000  0.000  0.000  0.000 
+                                             [ MATR   25 ]      -     28 - c - -
+    MR    75    74 3    77     3     1     1    33    52 -11.878  -0.002 -10.195                         -0.910  0.584 -0.997  0.554 
+     D    76    74 3    77     3     0     0    32    51  -8.406  -0.258  -2.636                         
+    IR    77    77 3    77     3     1     1    35    53  -1.925  -0.554  -4.164                          0.000  0.000  0.000  0.000 
+                                             [ MATR   26 ]      -     27 - A - -
+    MR    78    77 3    80     3     1     1    32    51 -11.923  -0.071  -4.384                          1.458 -1.557 -2.019 -0.586 
+     D    79    77 3    80     3     0     0    31    50  -6.390  -1.568  -0.620                         
+    IR    80    80 3    80     3     1     1    34    52  -1.925  -0.554  -4.164                          0.000  0.000  0.000  0.000 
+                                             [ MATR   27 ]      -     26 - a - -
+    MR    81    80 3    83     3     1     1    31    50  -1.344  -0.725 -10.171                          0.698  0.567 -2.058 -0.607 
+     D    82    80 3    83     3     0     0    31    49  -0.277  -4.066  -3.118                         
+    IR    83    83 3    83     3     1     1    31    49  -6.042  -0.027  -8.281                          0.000  0.000  0.000  0.000 
+                                             [ MATR   28 ]      -     24 - c - -
+    MR    84    83 3    86     3     1     1    30    48 -11.923  -0.002 -10.241                          0.331  0.903 -2.658 -0.486 
+     D    85    83 3    86     3     0     0    29    47  -6.390  -1.568  -0.620                         
+    IR    86    86 3    86     3     1     1    31    49  -1.925  -0.554  -4.164                          0.000  0.000  0.000  0.000 
+                                             [ MATR   29 ]      -     23 - C - -
+    MR    87    86 3    89     3     1     1    29    47 -11.923  -0.002 -10.241                         -2.740  1.578 -5.132 -0.259 
+     D    88    86 3    89     3     0     0    28    46  -6.390  -1.568  -0.620                         
+    IR    89    89 3    89     3     1     1    30    48  -1.925  -0.554  -4.164                          0.000  0.000  0.000  0.000 
+                                             [ MATR   30 ]      -     22 - A - -
+    MR    90    89 3    92     5     1     1    28    46 -10.571  -0.003 -10.387 -10.599 -11.491          1.957 -3.517 -6.202 -6.036 
+     D    91    89 3    92     5     0     0    27    45  -5.352  -0.707  -2.978  -4.409  -2.404         
+    IR    92    92 3    92     5     1     1    28    47  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP   31 ]      6     21 G C - -
+    MP    93    92 3    97     6     2     2    27    45 -11.637 -11.577  -0.004 -10.353 -10.633 -11.028 -9.446 -6.202 -11.294 -3.624 -11.134 -7.406 -5.494 -10.940 -7.562  3.944 -7.769 -1.149 -5.842 -7.856 -7.917 -10.190 
+    ML    94    92 3    97     6     1     1    26    44  -6.250  -6.596  -1.310  -1.005  -6.446  -3.975  0.368 -0.385 -0.191  0.094 
+    MR    95    92 3    97     6     1     1    25    44  -6.988  -5.717  -1.625  -5.695  -0.829  -3.908  0.368 -0.385 -0.191  0.094 
+     D    96    92 3    97     6     0     0    23    42  -9.049  -7.747  -3.544  -4.226  -4.244  -0.319 
+    IL    97    97 5    97     6     1     1    27    45  -2.579  -2.842  -0.760  -4.497  -5.274  -4.934  0.000  0.000  0.000  0.000 
+    IR    98    98 6    98     5     1     1    26    45  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP   32 ]      7     20 G C - -
+    MP    99    98 6   103     6     2     2    25    43 -11.637 -11.577  -0.004 -10.353 -10.633 -11.028 -9.520 -6.204 -11.599 -3.658 -11.128 -7.383 -5.483 -11.144 -7.569  3.980 -7.767 -4.127 -5.848 -7.844 -7.915 -10.583 
+    ML   100    98 6   103     6     1     1    24    42  -6.250  -6.596  -1.310  -1.005  -6.446  -3.975  0.368 -0.385 -0.191  0.094 
+    MR   101    98 6   103     6     1     1    24    42  -6.988  -5.717  -1.625  -5.695  -0.829  -3.908  0.368 -0.385 -0.191  0.094 
+     D   102    98 6   103     6     0     0    21    40  -9.049  -7.747  -3.544  -4.226  -4.244  -0.319 
+    IL   103   103 5   103     6     1     1    25    43  -2.579  -2.842  -0.760  -4.497  -5.274  -4.934  0.000  0.000  0.000  0.000 
+    IR   104   104 6   104     5     1     1    24    43  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP   33 ]      8     19 C G - -
+    MP   105   104 6   109     6     2     2    23    41 -11.637 -11.577  -0.004 -10.353 -10.633 -11.028 -8.195 -8.273 -7.664  0.485 -6.102 -7.918  3.494 -6.975 -7.717 -4.266 -7.912 -6.303  1.648 -8.123 -3.772 -6.505 
+    ML   106   104 6   109     6     1     1    22    41  -6.250  -6.596  -1.310  -1.005  -6.446  -3.975  0.368 -0.385 -0.191  0.094 
+    MR   107   104 6   109     6     1     1    22    41  -6.988  -5.717  -1.625  -5.695  -0.829  -3.908  0.368 -0.385 -0.191  0.094 
+     D   108   104 6   109     6     0     0    20    39  -9.049  -7.747  -3.544  -4.226  -4.244  -0.319 
+    IL   109   109 5   109     6     1     1    23    41  -2.579  -2.842  -0.760  -4.497  -5.274  -4.934  0.000  0.000  0.000  0.000 
+    IR   110   110 6   110     5     1     1    22    41  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP   34 ]      9     18 U A - -
+    MP   111   110 6   115     6     2     2    21    39 -11.637 -11.577  -0.004 -10.353 -10.633 -11.028 -7.836 -7.795 -7.436 -3.794 -5.957 -7.798  2.220 -6.790 -7.445  1.323 -7.710 -5.649  3.103 -7.832 -3.590 -6.217 
+    ML   112   110 6   115     6     1     1    21    40  -6.250  -6.596  -1.310  -1.005  -6.446  -3.975  0.368 -0.385 -0.191  0.094 
+    MR   113   110 6   115     6     1     1    21    40  -6.988  -5.717  -1.625  -5.695  -0.829  -3.908  0.368 -0.385 -0.191  0.094 
+     D   114   110 6   115     6     0     0    19    38  -9.049  -7.747  -3.544  -4.226  -4.244  -0.319 
+    IL   115   115 5   115     6     1     1    21    40  -2.579  -2.842  -0.760  -4.497  -5.274  -4.934  0.000  0.000  0.000  0.000 
+    IR   116   116 6   116     5     1     1    21    39  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP   35 ]     10     17 C G - -
+    MP   117   116 6   121     6     2     2    19    37 -11.637 -11.577  -0.004 -10.353 -10.633 -11.028 -8.021 -8.050 -7.554 -4.088 -6.028 -7.856  3.184 -6.884 -7.587  0.019 -7.815 -5.994  2.506 -7.979 -3.679 -6.365 
+    ML   118   116 6   121     6     1     1    21    39  -6.250  -6.596  -1.310  -1.005  -6.446  -3.975  0.368 -0.385 -0.191  0.094 
+    MR   119   116 6   121     6     1     1    20    39  -6.988  -5.717  -1.625  -5.695  -0.829  -3.908  0.368 -0.385 -0.191  0.094 
+     D   120   116 6   121     6     0     0    19    38  -9.049  -7.747  -3.544  -4.226  -4.244  -0.319 
+    IL   121   121 5   121     6     1     1    20    39  -2.579  -2.842  -0.760  -4.497  -5.274  -4.934  0.000  0.000  0.000  0.000 
+    IR   122   122 6   122     5     1     1    20    38  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP   36 ]     11     16 U A - -
+    MP   123   122 6   127     4     2     2    17    35 -10.705 -10.912  -0.004  -9.326                 -8.498 -8.756 -7.833 -4.969 -6.193 -7.989  1.976 -7.104 -7.931 -4.927 -8.060 -7.105  3.379 -8.342  0.623 -6.731 
+    ML   124   122 6   127     4     1     1    20    39  -3.758  -3.940  -0.507  -2.670                  0.368 -0.385 -0.191  0.094 
+    MR   125   122 6   127     4     1     1    20    38  -4.809  -3.838  -1.706  -0.766                  0.368 -0.385 -0.191  0.094 
+     D   126   122 6   127     4     0     0    19    37  -4.568  -4.250  -2.265  -0.520                 
+    IL   127   127 5   127     4     1     1    22    40  -1.686  -2.369  -1.117  -4.855                  0.000  0.000  0.000  0.000 
+    IR   128   128 6   128     3     1     1    21    39  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   37 ]     12      - U - - -
+    ML   129   128 6   131     3     1     1    14    32 -11.622  -0.002 -10.276                          0.104 -1.394 -4.333  1.319 
+     D   130   128 6   131     3     0     0    16    34  -6.174  -1.687  -0.566                         
+    IL   131   131 3   131     3     1     1    20    38  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   38 ]     13      - U - - -
+    ML   132   131 3   134     3     1     1    12    31 -11.622  -0.002 -10.276                         -2.505  0.463 -5.033  1.272 
+     D   133   131 3   134     3     0     0    15    33  -6.174  -1.687  -0.566                         
+    IL   134   134 3   134     3     1     1    19    37  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   39 ]     14      - U - - -
+    ML   135   134 3   137     3     1     1    11    29 -11.622  -0.002 -10.276                         -7.616 -6.858 -8.607  1.994 
+     D   136   134 3   137     3     0     0    13    32  -6.174  -1.687  -0.566                         
+    IL   137   137 3   137     3     1     1    18    36  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   40 ]     15      - a - - -
+    ML   138   137 3   140     2     1     1     1     1       *   0.000                                  0.741  0.478 -2.313 -0.445 
+     D   139   137 3   140     2     0     0     0     0       *   0.000                                 
+    IL   140   140 3   140     2     1     1    13    28  -1.823  -0.479                                  0.000  0.000  0.000  0.000 
+                                             [ END    41 ]      -      - - - - -
+     E   141   140 3    -1     0     0     0     0     0                                                 
+//
+HMMER3/f [3.3 | Nov 2019]
+NAME  Histone3
+ACC   RF00032
+DESC  Histone 3' UTR stem-loop
+LENG  46
+MAXL  102
+ALPH  RNA
+RF    no
+MM    no
+CONS  yes
+CS    yes
+MAP   yes
+DATE  Fri Apr  4 13:03:46 2014
+COM   [1] /nfs/production/xfam/rfam/software/bin/cmbuild -F CM SEED
+NSEQ  46
+EFFN  42.133911
+CKSUM 471917655
+STATS LOCAL MSV       -8.1088  0.74543
+STATS LOCAL VITERBI   -8.5088  0.74543
+STATS LOCAL FORWARD   -3.2029  0.74543
+HMM          A        C        G        U   
+            m->m     m->i     m->d     i->m     i->i     d->m     d->d
+  COMPO   1.16847  1.39084  1.71368  1.34673
+          1.38629  1.38629  1.38629  1.38629
+          0.00416  6.17794  6.17794  1.46634  0.26236  0.00000        *
+      1   1.19718  0.92283  2.53752  1.50734      1 c - - :
+          1.38629  1.38629  1.38629  1.38629
+          0.00416  6.17794  6.17794  1.46634  0.26236  1.09861  0.40547
+      2   0.99976  0.91709  2.73454  1.78721      2 c - - :
+          1.38629  1.38629  1.38629  1.38629
+          0.00416  6.17794  6.17794  1.46634  0.26236  1.09861  0.40547
+      3   0.28707  2.15200  4.53977  2.09870      3 A - - :
+          1.38629  1.38629  1.38629  1.38629
+          0.00416  6.17794  6.17794  1.46634  0.26236  1.09861  0.40547
+      4   0.67303  1.40667  2.67938  1.73570      4 A - - :
+          1.38629  1.38629  1.38629  1.38629
+          0.00416  6.17794  6.17794  1.46634  0.26236  1.09861  0.40547
+      5   0.71631  0.93175  4.42267  2.24827      5 a - - :
+          1.38629  1.38629  1.38629  1.38629
+          0.00416  6.17794  6.17794  1.46634  0.26236  1.09861  0.40547
+      6   4.96323  6.10024  0.01150  6.11805      6 G - - <
+          1.38629  1.38629  1.38629  1.38629
+          0.00416  6.17794  6.17794  1.46634  0.26236  1.09861  0.40547
+      7   4.97477  6.07793  0.01151  6.10217      7 G - - <
+          1.38629  1.38629  1.38629  1.38629
+          0.00416  6.17794  6.17794  1.46634  0.26236  1.09861  0.40547
+      8   2.42219  0.35197  5.16373  1.59825      8 C - - <
+          1.38629  1.38629  1.38629  1.38629
+          0.00416  6.17794  6.17794  1.46634  0.26236  1.09861  0.40547
+      9   4.96709  1.22589  1.84282  0.61402      9 U - - <
+          1.38629  1.38629  1.38629  1.38629
+          0.00416  6.17794  6.17794  1.46634  0.26236  1.09861  0.40547
+     10   5.14332  0.56593  2.72176  1.02007     10 C - - <
+          1.38629  1.38629  1.38629  1.38629
+          0.00416  6.17794  6.17794  1.46634  0.26236  1.09861  0.40547
+     11   5.65512  1.39382  5.58556  0.29488     11 U - - <
+          1.38629  1.38629  1.38629  1.38629
+          0.00416  6.17794  6.17794  1.46634  0.26236  1.09861  0.40547
+     12   1.31706  2.34288  4.27893  0.47454     12 U - - _
+          1.38629  1.38629  1.38629  1.38629
+          0.00416  6.17794  6.17794  1.46634  0.26236  1.09861  0.40547
+     13   3.10136  1.06700  4.79001  0.50640     13 U - - _
+          1.38629  1.38629  1.38629  1.38629
+          0.00416  6.17794  6.17794  1.46634  0.26236  1.09861  0.40547
+     14   6.52235  6.01860  7.19543  0.00466     14 U - - _
+          1.38629  1.38629  1.38629  1.38629
+          0.00416  6.17794  6.17794  1.46634  0.26236  1.09861  0.40547
+     15   0.87615  1.05939  2.96086  1.68645     15 a - - _
+          1.38629  1.38629  1.38629  1.38629
+          0.00416  6.17794  6.17794  1.46634  0.26236  1.09861  0.40547
+     16   0.43199  5.71946  1.06961  5.43487     16 A - - >
+          1.38629  1.38629  1.38629  1.38629
+          0.00416  6.17794  6.17794  1.46634  0.26236  1.09861  0.40547
+     17   1.03329  2.73783  0.55849  4.90865     17 G - - >
+          1.38629  1.38629  1.38629  1.38629
+          0.00416  6.17794  6.17794  1.46634  0.26236  1.09861  0.40547
+     18   0.62348  1.85123  1.21052  4.72873     18 A - - >
+          1.38629  1.38629  1.38629  1.38629
+          0.00416  6.17794  6.17794  1.46634  0.26236  1.09861  0.40547
+     19   1.62037  5.32794  0.34630  2.40773     19 G - - >
+          1.38629  1.38629  1.38629  1.38629
+          0.00416  6.17794  6.17794  1.46634  0.26236  1.09861  0.40547
+     20   6.16935  0.01425  6.02393  4.64210     20 C - - >
+          1.38629  1.38629  1.38629  1.38629
+          0.00416  6.17794  6.17794  1.46634  0.26236  1.09861  0.40547
+     21   6.22221  0.03904  6.06094  3.38213     21 C - - >
+          1.38629  1.38629  1.38629  1.38629
+          0.00416  6.17794  6.17794  1.46634  0.26236  1.09861  0.40547
+     22   0.03027  3.82336  5.58493  5.47058     22 A - - :
+          1.38629  1.38629  1.38629  1.38629
+          0.00416  6.17794  6.17794  1.46634  0.26236  1.09861  0.40547
+     23   3.26053  0.29487  4.86483  1.56402     23 C - - :
+          1.38629  1.38629  1.38629  1.38629
+          0.00416  6.17794  6.17794  1.46634  0.26236  1.09861  0.40547
+     24   1.15929  0.76514  3.19669  1.71411     24 c - - :
+          1.38629  1.38629  1.38629  1.38629
+          0.47612  0.97621  6.17794  0.01098  4.51736  1.09861  0.40547
+     25   0.90589  0.99871  2.78941  1.79574     26 a - - :
+          1.38629  1.38629  1.38629  1.38629
+          0.00416  6.17794  6.17794  1.46634  0.26236  1.09861  0.40547
+     26   0.37936  2.45545  2.76975  1.78857     27 A - - :
+          1.38629  1.38629  1.38629  1.38629
+          0.03553  6.17794  3.41622  1.46634  0.26236  1.09861  0.40547
+     27   2.00288  0.98595  2.07379  1.00440     28 c - - :
+          1.38629  1.38629  1.38629  1.38629
+          0.00429  6.14670  6.14670  1.46634  0.26236  0.11900  2.18757
+     28   0.58277  2.57844  2.26067  1.34141     29 A - - :
+          1.38629  1.38629  1.38629  1.38629
+          0.00416  6.17794  6.17794  1.46634  0.26236  1.09861  0.40547
+     29   2.04103  1.64155  1.24300  0.94698     30 u - - :
+          1.38629  1.38629  1.38629  1.38629
+          0.04224  6.17794  3.23682  1.46634  0.26236  1.09861  0.40547
+     30   0.90025  2.40010  2.48509  0.86868     31 u - - :
+          1.38629  1.38629  1.38629  1.38629
+          0.00432  6.14002  6.14002  1.46634  0.26236  0.10040  2.34838
+     31   1.14658  1.52988  1.97258  1.11897     32 u - - :
+          1.38629  1.38629  1.38629  1.38629
+          0.00416  6.17794  6.17794  1.46634  0.26236  1.09861  0.40547
+     32   0.99477  1.56394  2.34075  1.12508     33 a - - :
+          1.38629  1.38629  1.38629  1.38629
+          0.00416  6.17794  6.17794  1.46634  0.26236  1.09861  0.40547
+     33   1.30260  0.91111  1.74486  1.88763     34 c - - :
+          1.38629  1.38629  1.38629  1.38629
+          0.00416  6.17794  6.17794  1.46634  0.26236  1.09861  0.40547
+     34   0.81644  1.95418  2.55798  1.08218     35 a - - :
+          1.38629  1.38629  1.38629  1.38629
+          0.00416  6.17794  6.17794  1.46634  0.26236  1.09861  0.40547
+     35   0.88707  2.68494  1.54697  1.18084     36 a - - :
+          1.38629  1.38629  1.38629  1.38629
+          0.02155  6.17794  3.95035  1.46634  0.26236  1.09861  0.40547
+     36   0.88692  1.97884  1.71659  1.30871     37 a - - :
+          1.38629  1.38629  1.38629  1.38629
+          0.00423  6.16062  6.16062  1.46634  0.26236  0.19522  1.72966
+     37   0.78649  1.68131  1.71782  1.72051     38 a - - :
+          1.38629  1.38629  1.38629  1.38629
+          0.00416  6.17794  6.17794  1.46634  0.26236  1.09861  0.40547
+     38   0.59588  2.08432  1.60986  2.08251     39 A - - :
+          1.38629  1.38629  1.38629  1.38629
+          0.00416  6.17794  6.17794  1.46634  0.26236  1.09861  0.40547
+     39   0.76886  1.58017  1.51684  2.19720     40 a - - :
+          1.38629  1.38629  1.38629  1.38629
+          0.02859  6.17794  3.64554  1.46634  0.26236  1.09861  0.40547
+     40   0.91147  2.90974  1.18115  1.44117     41 a - - :
+          1.38629  1.38629  1.38629  1.38629
+          0.00426  6.15362  6.15362  1.46634  0.26236  0.14750  1.98676
+     41   1.19023  1.82584  1.84655  0.97555     42 u - - :
+          1.38629  1.38629  1.38629  1.38629
+          0.00416  6.17794  6.17794  1.46634  0.26236  1.09861  0.40547
+     42   1.35396  2.21010  1.23260  1.07716     43 u - - :
+          1.38629  1.38629  1.38629  1.38629
+          0.00416  6.17794  6.17794  1.46634  0.26236  1.09861  0.40547
+     43   1.25472  1.71330  1.50591  1.16232     44 u - - :
+          1.38629  1.38629  1.38629  1.38629
+          0.00416  6.17794  6.17794  1.46634  0.26236  1.09861  0.40547
+     44   1.37043  1.66018  2.98397  0.68259     45 U - - :
+          1.38629  1.38629  1.38629  1.38629
+          0.00416  6.17794  6.17794  1.46634  0.26236  1.09861  0.40547
+     45   1.15612  1.70216  1.15511  1.67140     46 g - - :
+          1.38629  1.38629  1.38629  1.38629
+          0.47997  6.17794  0.96989  1.46634  0.26236  1.09861  0.40547
+     46   2.25321  3.55314  1.66807  0.38906     47 U - - :
+          1.38629  1.38629  1.38629  1.38629
+          0.00335  5.70132        *  1.46634  0.26236  0.00000        *
+//
diff -r 000000000000 -r 7dd2835ce566 test-data/test_search.gtf
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/test_search.gtf	Sun Dec 03 12:51:54 2023 +0000
@@ -0,0 +1,11 @@
+chr1	HAVANA	gene	21	60	.	+	.	gene_id "g1"; gene_type "protein_coding"; gene_name "GENE1";
+chr1	HAVANA	transcript	21	60	.	+	.	gene_id "g1"; transcript_id "g1_t1"; transcript_type "protein_coding"; gene_type "protein_coding"; transcript_name "g1_t1"; level 1; transcript_support_level "2"; tag "basic"; tag "Ensembl_canonical";
+chr1	HAVANA	exon	21	60	.	+	.	gene_id "g1"; transcript_id "g1_t1"; gene_type "protein_coding"; gene_name "GENE1"; transcript_type "protein_coding"; transcript_name "g1_t1-202"; exon_number 1; exon_id "g1_t1_e1"; level 1; transcript_support_level "1"; tag "basic"; tag "Ensembl_canonical";
+chr1	HAVANA	CDS	31	44	.	+	.	gene_id "g1"; transcript_id "g1_t1"; gene_type "protein_coding"; gene_name "GENE1"; transcript_type "protein_coding"; transcript_name "g1_t1-202"; exon_number 1; exon_id "g1_t1_e1"; level 1; transcript_support_level "1"; tag "basic"; tag "Ensembl_canonical";
+chr1	HAVANA	transcript	21	60	.	+	.	gene_id "g1"; transcript_id "g1_t2"; transcript_type "protein_coding"; gene_type "protein_coding"; transcript_name "g1_t2"; level 1; transcript_support_level "1"; tag "basic"; tag "Ensembl_canonical";
+chr1	HAVANA	exon	21	60	.	+	.	gene_id "g1"; transcript_id "g1_t2"; gene_type "protein_coding"; gene_name "GENE1"; transcript_type "protein_coding"; transcript_name "g1_t2-202"; exon_number 1; exon_id "g1_t2_e1"; level 1; transcript_support_level "1"; tag "basic"; tag "Ensembl_canonical";
+chr1	HAVANA	CDS	31	44	.	+	.	gene_id "g1"; transcript_id "g1_t2"; gene_type "protein_coding"; gene_name "GENE1"; transcript_type "protein_coding"; transcript_name "g1_t2-202"; exon_number 1; exon_id "g1_t2_e1"; level 1; transcript_support_level "1"; tag "basic"; tag "Ensembl_canonical";
+chr1	HAVANA	gene	21	60	.	-	.	gene_id "g2"; gene_type "lncRNA"; gene_name "GENE2";
+chr1	HAVANA	transcript	20	60	.	-	.	gene_id "g2"; transcript_id "g2_t1"; transcript_type "lncRNA"; gene_type "lncRNA"; transcript_name "g2_t1"; level 1; transcript_support_level "1"; tag "basic"; tag "Ensembl_canonical";
+chr1	HAVANA	exon	51	60	.	-	.	gene_id "g2"; transcript_id "g2_t1"; gene_type "lncRNA"; gene_name "GENE1"; transcript_type "lncRNA"; transcript_name "g2_t1-202"; exon_number 1; exon_id "g2_t1_e1"; level 1; transcript_support_level "1"; tag "basic"; tag "Ensembl_canonical";
+chr1	HAVANA	exon	21	40	.	-	.	gene_id "g2"; transcript_id "g2_t1"; gene_type "lncRNA"; gene_name "GENE1"; transcript_type "lncRNA"; transcript_name "g2_t1-202"; exon_number 2; exon_id "g2_t1_e1"; level 1; transcript_support_level "1"; tag "basic"; tag "Ensembl_canonical";
diff -r 000000000000 -r 7dd2835ce566 test-data/test_search_gtf.region_annotations.tsv
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/test_search_gtf.region_annotations.tsv	Sun Dec 03 12:51:54 2023 +0000
@@ -0,0 +1,2 @@
+region_id	gene_id	gene_name	transcript_id	region_annotation	transcript_biotype
+chr1:10-80(+)	g1	GENE1	g1_t2	3'UTR	protein_coding
diff -r 000000000000 -r 7dd2835ce566 test-data/test_table.txt
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/test_table.txt	Sun Dec 03 12:51:54 2023 +0000
@@ -0,0 +1,2 @@
+PUM1	mid1	did1	test1.bed
+PUM2	mid2	did2	test2.bed
diff -r 000000000000 -r 7dd2835ce566 tool-data/fasta_indexes.loc.sample
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/tool-data/fasta_indexes.loc.sample	Sun Dec 03 12:51:54 2023 +0000
@@ -0,0 +1,29 @@
+#This is a sample file distributed with Galaxy that enables tools
+#to use a directory of Samtools indexed sequences data files.  You will need
+#to create these data files and then create a fasta_indexes.loc file
+#similar to this one (store it in this directory) that points to
+#the directories in which those files are stored. The fasta_indexes.loc
+#file has this format (white space characters are TAB characters):
+#
+# <unique_build_id>     <dbkey> <display_name>  <file_base_path>
+#
+#So, for example, if you had hg19 Canonical indexed stored in
+#
+# /depot/data2/galaxy/hg19/sam/,
+#
+#then the fasta_indexes.loc entry would look like this:
+#
+#hg19canon      hg19    Human (Homo sapiens): hg19 Canonical    /depot/data2/galaxy/hg19/sam/hg19canon.fa
+#
+#and your /depot/data2/galaxy/hg19/sam/ directory
+#would contain hg19canon.fa and hg19canon.fa.fai files.
+#
+#Your fasta_indexes.loc file should include an entry per line for
+#each index set you have stored.  The file in the path does actually
+#exist, but it should never be directly used. Instead, the name serves
+#as a prefix for the index file.  For example:
+#
+#hg18canon      hg18    Human (Homo sapiens): hg18 Canonical    /depot/data2/galaxy/hg18/sam/hg18canon.fa
+#hg18full       hg18    Human (Homo sapiens): hg18 Full /depot/data2/galaxy/hg18/sam/hg18full.fa
+#hg19canon      hg19    Human (Homo sapiens): hg19 Canonical    /depot/data2/galaxy/hg19/sam/hg19canon.fa
+#hg19full       hg19    Human (Homo sapiens): hg19 Full /depot/data2/galaxy/hg19/sam/hg19full.fa
diff -r 000000000000 -r 7dd2835ce566 tool-data/rbp_ids.catrapid.omics.v2.1.human.6plus.txt
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/tool-data/rbp_ids.catrapid.omics.v2.1.human.6plus.txt	Sun Dec 03 12:51:54 2023 +0000
@@ -0,0 +1,259 @@
+A1CF
+ACIN1
+ACO1
+ADAR
+AGGF1
+AGO1
+AGO2
+AKAP1
+AKAP8
+ANKHD1
+AUH
+BCCIP
+BOLL
+BUD13
+CAPRIN1
+CBX7
+CDC40
+CELF1
+CELF2
+CELF4
+CELF5
+CELF6
+CNBP
+CNOT4
+CPEB1
+CPEB2
+CPEB4
+CPSF6
+CPSF7
+CSTF2
+CSTF2T
+DAZ3
+DAZAP1
+DDX3X
+DDX6
+DDX19B
+DDX24
+DDX54
+DDX55
+DDX58
+DDX59
+DGCR8
+DKC1
+EFTUD2
+EIF3D
+EIF4A3
+EIF4B
+EIF4G2
+ELAVL1
+ELAVL2
+ELAVL3
+ELAVL4
+ENOX1
+ERI1
+ESRP1
+ESRP2
+EWSR1
+FAM120A
+FASTKD2
+FBL
+FIP1L1
+FMR1
+FTO
+FUBP1
+FUBP3
+FUS
+FXR1
+FXR2
+G3BP1
+G3BP2
+GNL3
+GPKOW
+GRSF1
+GRWD1
+GTF2F1
+HLTF
+HNRNPA0
+HNRNPA1
+HNRNPA1L2
+HNRNPA2B1
+HNRNPA3
+HNRNPAB
+HNRNPC
+HNRNPCL1
+HNRNPD
+HNRNPDL
+HNRNPF
+HNRNPH1
+HNRNPH2
+HNRNPK
+HNRNPL
+HNRNPLL
+HNRNPM
+HNRNPU
+HNRNPUL1
+IFIH1
+IGF2BP1
+IGF2BP2
+IGF2BP3
+IGHMBP2
+ILF2
+ILF3
+KHDRBS1
+KHDRBS2
+KHDRBS3
+KHSRP
+LARP4
+LARP4B
+LIN28A
+LIN28B
+LSM11
+MATR3
+MBNL1
+METAP2
+MSI1
+MSI2
+MTPAP
+NCBP2
+NELFE
+NKRF
+NOL12
+NONO
+NOP56
+NOP58
+NOVA1
+NOVA2
+NPM1
+NSUN2
+NUMA1
+NUP42
+NXF1
+OAS1
+OBI1
+PABPC1
+PABPC3
+PABPC4
+PABPC5
+PABPN1
+PABPN1L
+PARP1
+PCBP1
+PCBP2
+PCBP4
+PPIE
+PPIG
+PPIL4
+PPRC1
+PRPF8
+PRR3
+PTBP1
+PTBP2
+PTBP3
+PUF60
+PUM1
+PUM2
+QKI
+RALY
+RALYL
+RANGAP1
+RBFOX1
+RBFOX2
+RBFOX3
+RBM3
+RBM4
+RBM4B
+RBM5
+RBM6
+RBM8A
+RBM10
+RBM14
+RBM15
+RBM15B
+RBM22
+RBM23
+RBM24
+RBM25
+RBM28
+RBM39
+RBM41
+RBM42
+RBM45
+RBM46
+RBM47
+RBMS1
+RBMS2
+RBMS3
+RBMX
+RBMY1A1
+RC3H1
+TROVE2
+RPS5
+SAFB2
+SAMD4A
+SART3
+SF1
+SF3A3
+SF3B4
+SFPQ
+SLTM
+SMNDC1
+SND1
+SNRNP70
+SNRPA
+SNRPB2
+SOX2
+SRP14
+SRP68
+SRRM4
+SRSF1
+SRSF2
+SRSF3
+SRSF4
+SRSF5
+SRSF6
+SRSF7
+SRSF8
+SRSF9
+SRSF10
+SRSF11
+SSB
+SUB1
+SUGP2
+SUPV3L1
+SYNCRIP
+TAF15
+TARBP2
+TARDBP
+TBRG4
+TIA1
+TIAL1
+TNRC6A
+TRA2A
+TRA2B
+TRNAU1AP
+TUT1
+U2AF1
+U2AF2
+UCHL5
+UNK
+UPF1
+WDR33
+XPO5
+XRCC6
+XRN2
+YBX1
+YBX2
+YBX3
+YTHDC1
+YWHAG
+ZC3H10
+ZCRB1
+ZFP36
+ZFP36L2
+ZNF184
+ZNF326
+ZNF622
+ZNF638
+ZRANB2
+SLBP
diff -r 000000000000 -r 7dd2835ce566 tool_data_table_conf.xml.sample
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/tool_data_table_conf.xml.sample	Sun Dec 03 12:51:54 2023 +0000
@@ -0,0 +1,12 @@
+<tables>
+    <!-- Locations of built-in genome -->
+    <table name="fasta_indexes" comment_char="#">
+        <columns>value, dbkey, name, path</columns>
+        <file path="tool-data/fasta_indexes.loc" />
+    </table>
+    <!-- IDs table file -->
+    <table name="rbp_ids_table" comment_char="#">
+        <columns>value</columns>
+        <file path="${__HERE__}/tool-data/rbp_ids.catrapid.omics.v2.1.human.6plus.txt" />
+    </table>
+</tables>
\ No newline at end of file
diff -r 000000000000 -r 7dd2835ce566 tool_data_table_conf.xml.test
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/tool_data_table_conf.xml.test	Sun Dec 03 12:51:54 2023 +0000
@@ -0,0 +1,12 @@
+<tables>
+    <!-- Locations of built-in genome -->
+    <table name="fasta_indexes" comment_char="#">
+        <columns>value, dbkey, name, path</columns>
+        <file path="${__HERE__}/test-data/fasta_indexes.loc" />
+    </table>
+    <!-- IDs table file -->
+    <table name="rbp_ids_table" comment_char="#">
+        <columns>value</columns>
+        <file path="${__HERE__}/tool-data/rbp_ids.catrapid.omics.v2.1.human.6plus.txt" />
+    </table>
+</tables>
\ No newline at end of file