Mercurial > repos > rnateam > targetfinder
diff TargetFinder.xml @ 1:c9d56748fbde draft default tip
"planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/rna_tools/targetfinder/ commit fe9dd99a14770b6c5f26e24893599acb577e304f"
| author | rnateam |
|---|---|
| date | Thu, 25 Mar 2021 19:53:15 +0000 |
| parents | 773fdd1a02ea |
| children |
line wrap: on
line diff
--- a/TargetFinder.xml Wed Dec 21 17:31:28 2016 -0500 +++ b/TargetFinder.xml Thu Mar 25 19:53:15 2021 +0000 @@ -1,73 +1,224 @@ -<tool id="targetfinder" name="Plant small RNA target prediction tool" version="1.7.0"> - <requirements> - <requirement type="package" version="1.7">targetfinder</requirement> - </requirements> +<tool id='targetfinder' name='TargetFinder' version='1.7.0+galaxy1' profile='20.01'> + <description>plant small RNA target prediction tool</description> + <macros> + <import>macros.xml</import> + </macros> + <expand macro='edam' /> + <expand macro='requirements' /> <stdio> - <exit_code range="1:" /> + <exit_code range='1:' /> </stdio> <command><![CDATA[ targetfinder_threads.pl - -f $f - -d $d + -f '$f' + -d '$d' -c $c + -p $output_format -t "\${GALAXY_SLOTS:-12}" $r - -o $output1 + -o '$output_file' + ]]></command> <inputs> - <param label="Input small RNA sequences file" help="(-f) FASTA-format" name="f" type="data" format="fasta" /> - <param label="Target sequence database file" help="(-d) FASTA-format" name="d" type="data" format="fasta" /> - <param label="Prediction score cutoff value" help="(-c) DEFAULT = 4" name="c" type="float" value="4.0" /> - <param label="Search reverse strand for targets?" help="(-r) Use this option if the database is genomic DNA." name="r" type="boolean" falsevalue="" truevalue="-r" checked="false" /> + <param argument='-f' type='data' format='fasta' label='Input small RNA sequences file' help='FASTA-format' /> + <param argument='-d' type='data' format='fasta' label='Target sequence database file' help='FASTA-format' /> + <param argument='-c' type='float' value='4.0' label='Prediction score cutoff value' help='Predicted targets are printed out if they are equal to or lower than the cutoff score specified. DEFAULT = 4' /> + <param argument='-c' type='float' value='4.0' label='Prediction score cutoff value' help='Predicted targets are printed out if they are equal to or lower than the cutoff score specified. DEFAULT = 4' /> + <param argument='-r' type='boolean' falsevalue='' truevalue='-r' checked='false' label='Search reverse strand for targets?' help='Use this option if the database is genomic DNA.' /> + <param name='output_format' argument='-p' type='select' label='Output format' help='Output format for small RNA-target pairs (Default = classic).' > + <option value='classic'>Original TargetFinder base-pair format</option> + <option value='gff'>GFF</option> + <option value='json'>JavaScript Object Notation (JSON)</option> + <option value='table'>Tab-delimited format</option> + </param> </inputs> <outputs> - <data name="output1" format="data"/> + <data name='output_file' format='txt'> + <change_format> + <when input="output_format" value="gff" format="gff" /> + <when input="output_format" value="json" format="json" /> + <when input="output_format" value="table" format="tabular" /> + </change_format> + </data> </outputs> <tests> <test> - <param name="f" value="ath_miRNAs_test.fa"/> - <param name="d" value="Antirrhinum_majus.mRNA.EST.fasta"/> - <param name="r" value=""/> - <param name="c" value="4.0"/> - <param name="t" value="1"/> - <output name="output1" file="ath_miRNAs_predicted_targets.txt" compare="contains"/> + <param name='f' value='arabidopsis_thaliana_miRNA.fasta'/> + <param name='d' value='arabidopsis_thaliana_mRNA.fasta'/> + <param name='r' value='false'/> + <param name='c' value='4.0'/> + <param name='output_format' value='classic'/> + <output name='output_file' file='targetfinder_test_01.txt' compare='contains'/> + </test> + <test> + <param name='f' value='arabidopsis_thaliana_miRNA.fasta'/> + <param name='d' value='arabidopsis_thaliana_mRNA.fasta'/> + <param name='r' value='true'/> + <param name='c' value='4.0'/> + <param name='output_format' value='classic'/> + <output name='output_file' file='targetfinder_test_02.txt' compare='contains'/> + </test> + <test> + <param name='f' value='arabidopsis_thaliana_miRNA.fasta'/> + <param name='d' value='arabidopsis_thaliana_mRNA.fasta'/> + <param name='r' value='false'/> + <param name='c' value='6.0'/> + <param name='output_format' value='classic'/> + <output name='output_file' file='targetfinder_test_03.txt' compare='contains'/> + </test> + <test> + <param name='f' value='arabidopsis_thaliana_miRNA.fasta'/> + <param name='d' value='arabidopsis_thaliana_mRNA.fasta'/> + <param name='r' value='false'/> + <param name='c' value='4.0'/> + <param name='output_format' value='classic'/> + <output name='output_file' file='targetfinder_test_04.txt' compare='contains'/> + </test> + <test> + <param name='f' value='arabidopsis_thaliana_miRNA.fasta'/> + <param name='d' value='arabidopsis_thaliana_mRNA.fasta'/> + <param name='r' value='false'/> + <param name='c' value='4.0'/> + <param name='output_format' value='gff'/> + <output name='output_file' file='targetfinder_test_05.gff' compare='contains'/> + </test> + <test> + <param name='f' value='arabidopsis_thaliana_miRNA.fasta'/> + <param name='d' value='arabidopsis_thaliana_mRNA.fasta'/> + <param name='r' value='false'/> + <param name='c' value='4.0'/> + <param name='output_format' value='table'/> + <output name='output_file' file='targetfinder_test_06.tab' compare='contains'/> + </test> + <test> + <param name='f' value='arabidopsis_thaliana_miRNA.fasta'/> + <param name='d' value='arabidopsis_thaliana_mRNA.fasta'/> + <param name='r' value='false'/> + <param name='c' value='4.0'/> + <param name='output_format' value='json'/> + <output name='output_file' file='targetfinder_test_07.json' compare='contains' lines_diff='1'/> + </test> + <test> + <param name='f' value='arabidopsis_thaliana_miRNA.fasta'/> + <param name='d' value='arabidopsis_thaliana_mRNA.fasta'/> + <param name='r' value='true'/> + <param name='c' value='6.5'/> + <param name='output_format' value='table'/> + <output name='output_file' file='targetfinder_test_08.tab' compare='contains'/> </test> </tests> <help><![CDATA[ +.. class:: infomark + **What it does** TargetFinder will computationally predict small RNA binding sites on target transcripts from a sequence database. -This is done by aligning the input small RNA sequence against all transcripts, -followed by site scoring using a position-weighted scoring matrix. +This is done by aligning the input small RNA sequence against all transcripts, followed by site scoring using a position-weighted scoring matrix. + +---- + +.. class:: infomark **Input** --f Input small RNA sequences file (FASTA-format). +This tool requires two fasta files: --d Target sequence database file (FASTA-format) + :: + + -f Input small RNA sequences file (FASTA-format). + -d Target sequence database file (FASTA-format) -**Output** +---- + +.. class:: infomark -Each predicted target site is printed out separately. -The output consists of two parts. +**Original TargetFinder Output** + + +Each predicted target site is printed out separately. -The first is a description line and the second is a base-pairing diagram of the target and small RNA (query) sequence. +The output consists of two parts. The first is a description line and the second is a base-pairing diagram of the target and small RNA (query) sequence. The description line contains the query name, the description line from the target sequence database, and the target prediction score. -The description line contains the query name, the description line from the target sequence database, and the target prediction score. + :: + + query=miR399a, target=AT2G33770.1 | Symbol: None | ubiquitin-conjugating enzyme family protein, low similarity to u, score=1.5 + -The base-pairing diagram has the target site sequence on top in 5'-3' orientation and the query sequence on the bottom in 3'-5' orientation. +The base-pairing diagram has the target site sequence on top in 5'-3' orientation and the query sequence on the bottom in 3'-5' orientation. Between the target site sequece and the query sequence are base pair symbols. A ':' (colon) symbol represents an ordinary Watson-Crick base pair, a '.' (period) represents a G:U base pair, and a ' ' (space) represents a mismatch. -Between the target site sequece and the query sequence are base pair symbols. + :: + + target 5' UAGGGCAAAUCUUCUUUGGCA 3' + .:::::::::::.:::::::: + query 3' GUCCCGUUUAGAGGAAACCGU 5' -A ":" (colon) symbol represents an ordinary Watson-Crick base pair, a "." (period) represents a G:U base pair, and a " " (space) represents a mismatch. If a small RNA is predicted to target a sequence more than once, each target site will be output as separate output. + + +---- + +.. class:: infomark + +**Additional output formats** + +In addition to the output described above ('classic' output), three new output format options were added to TargetFinder. + +Generic Feature Format (GFF3): + + :: + + AT2G33770.1 | Symbols: UBC24 | phosphate 2 | chr2:14277558-14283040 REVERSE LEN targetfinder rna_target 607 627 1.5 + . smallRNA=miR399a;target_seq=UAGGGCAAAUCUUCUUUGGCA;base_pairs=.:::::::::::.::::::::;miR_seq=GUCCCGUUUAGAGGAAACCGU + AT2G33770.1 | Symbols: UBC24 | phosphate 2 | chr2:14277558-14283040 REVERSE LEN targetfinder rna_target 740 760 1.5 + . smallRNA=miR399a;target_seq=UAGGGCAUAUCUCCUUUGGCA;base_pairs=.:::::: :::::::::::::;miR_seq=GUCCCGUUUAGAGGAAACCGU + AT2G33770.1 | Symbols: UBC24 | phosphate 2 | chr2:14277558-14283040 REVERSE LEN targetfinder rna_target 829 849 1.5 + . smallRNA=miR399a;target_seq=UUGGGCAAAUCUCCUUUGGCA;base_pairs=. :::::::::::::::::::;miR_seq=GUCCCGUUUAGAGGAAACCGU + + +Tab-deliminated Format: + + :: + + miR399a AT2G33770.1 | Symbols: UBC24 | phosphate 2 | chr2:14277558-14283040 REVERSE LEN 607 627 + 1.5 UAGGGCAAAUCUUCUUUGGCA .:::::::::::.:::::::: GUCCCGUUUAGAGGAAACCGU + miR399a AT2G33770.1 | Symbols: UBC24 | phosphate 2 | chr2:14277558-14283040 REVERSE LEN 740 760 + 1.5 UAGGGCAUAUCUCCUUUGGCA .:::::: ::::::::::::: GUCCCGUUUAGAGGAAACCGU + miR399a AT2G33770.1 | Symbols: UBC24 | phosphate 2 | chr2:14277558-14283040 REVERSE LEN 829 849 + 1.5 UUGGGCAAAUCUCCUUUGGCA . ::::::::::::::::::: GUCCCGUUUAGAGGAAACCGU + +JavaScript Object Notation Format (JSON): + + :: + + { + 'miR399a': { + 'hits' : [ + { + 'Target accession': 'AT2G33770.1 | Symbols: UBC24, ATUBC24, PHO2 | phosphate 2 | chr2:14277558-14283040 REVERSE LEN', + 'Score': '1.5', + 'Coordinates': '607-627', + 'Strand': '+', + 'Target sequence': 'UAGGGCAAAUCUUCUUUGGCA', + 'Base pairing': '.:::::::::::.::::::::', + 'amiRNA sequence': 'GUCCCGUUUAGAGGAAACCGU' + } + ] + } + } + + +---- + +.. class:: infomark + +**Method** + +TargetFinder searches for potential miRNA target sites in a FASTA-formated sequence database using three main steps. + + + 1. The small RNA query sequence is aligned to every sequence in the FASTA-formated sequence database using `Smith-Waterman (SW) alignments <https://en.wikipedia.org/wiki/Smith%E2%80%93Waterman_algorithm>`_ implemented in the FASTA package (ssearch35_t). + 2. The SW alignments are converted into RNA duplexes. + 3. Each duplex is scored using a position-dependent scoring matrix. + +SW alignments are used to identify the best complementary regions between the small RNA query sequence and every sequence in the FASTA-formated sequence database. + ]]></help> - <citations> - <citation type="doi">10.1016/j.cell.2005.04.004</citation> - <citation type="doi">10.1371/journal.pone.0000219</citation> - <citation type="doi">10.1007/978-1-60327-005-2_4</citation> - </citations> + <expand macro='citations' /> </tool>