comparison test-data/Anolis_caro_chrUn_GL343590.trna2_AlaAGC_dp.ps @ 6:17b6ff52efc3 draft default tip

planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/rna_tools/vienna_rna commit 36681a08c6e44c663169caaefd964781c43d0d29
author rnateam
date Wed, 20 Dec 2017 08:37:33 -0500
parents
children
comparison
equal deleted inserted replaced
5:da813b17038c 6:17b6ff52efc3
1 %!PS-Adobe-3.0 EPSF-3.0
2 %%Title: RNA Dot Plot
3 %%Creator: ViennaRNA-2.2.10
4 %%CreationDate: Tue Dec 19 19:42:58 2017
5 %%BoundingBox: 66 211 518 662
6 %%DocumentFonts: Helvetica
7 %%Pages: 1
8 %%EndComments
9
10 %Options:
11 %
12 %This file contains the square roots of the base pair probabilities in the form
13 % i j sqrt(p(i,j)) ubox
14
15 %%BeginProlog
16 /DPdict 100 dict def
17 DPdict begin
18 /logscale false def
19 /lpmin 1e-05 log def
20
21 /box { %size x y box - draws box centered on x,y
22 2 index 0.5 mul sub % x -= 0.5
23 exch 2 index 0.5 mul sub exch % y -= 0.5
24 3 -1 roll dup rectfill
25 } bind def
26
27 /ubox {
28 logscale {
29 log dup add lpmin div 1 exch sub dup 0 lt { pop 0 } if
30 } if
31 3 1 roll
32 exch len exch sub 1 add box
33 } bind def
34
35 /lbox {
36 3 1 roll
37 len exch sub 1 add box
38 } bind def
39
40 /drawseq {
41 % print sequence along all 4 sides
42 [ [0.7 -0.3 0 ]
43 [0.7 0.7 len add 0]
44 [-0.3 len sub -0.4 -90]
45 [-0.3 len sub 0.7 len add -90]
46 ] {
47 gsave
48 aload pop rotate translate
49 0 1 len 1 sub {
50 dup 0 moveto
51 sequence exch 1 getinterval
52 show
53 } for
54 grestore
55 } forall
56 } bind def
57
58 /drawgrid{
59 0.01 setlinewidth
60 len log 0.9 sub cvi 10 exch exp % grid spacing
61 dup 1 gt {
62 dup dup 20 div dup 2 array astore exch 40 div setdash
63 } { [0.3 0.7] 0.1 setdash } ifelse
64 0 exch len {
65 dup dup
66 0 moveto
67 len lineto
68 dup
69 len exch sub 0 exch moveto
70 len exch len exch sub lineto
71 stroke
72 } for
73 [] 0 setdash
74 0.04 setlinewidth
75 currentdict /cutpoint known {
76 cutpoint 1 sub
77 dup dup -1 moveto len 1 add lineto
78 len exch sub dup
79 -1 exch moveto len 1 add exch lineto
80 stroke
81 } if
82 0.5 neg dup translate
83 } bind def
84
85 end
86 %%EndProlog
87 DPdict begin
88 %delete next line to get rid of title
89 270 665 moveto /Helvetica findfont 14 scalefont setfont (Anolis_caro_chrUn_GL343590.trna2_AlaAGC) show
90
91 /sequence { (\
92 UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA\
93 ) } def
94 /len { sequence length } bind def
95
96 72 216 translate
97 72 6 mul len 1 add div dup scale
98 /Helvetica findfont 0.95 scalefont setfont
99
100 drawseq
101 0.5 dup translate
102 % draw diagonal
103 0.04 setlinewidth
104 0 len moveto len 0 lineto stroke
105
106 /min { 2 copy gt { exch } if pop } bind def
107
108 /utri{ % i j prob utri
109 gsave
110 1 min 2 div
111 0.85 mul 0.15 add 0.95 0.33
112 3 1 roll % prepare hsb color
113 sethsbcolor
114 % now produce the coordinates for lines
115 exch 1 sub dup len exch sub dup 4 -1 roll dup 3 1 roll dup len exch sub
116 moveto lineto lineto closepath fill
117 grestore
118 } bind def
119 /uHmotif{ % i j uHmotif
120 gsave
121 1 min 2 div
122 0.85 mul 0.15 add 0.95 0.99
123 3 1 roll % prepare hsb color
124 sethsbcolor
125 % now produce the coordinates for lines
126 exch 1 sub dup len exch sub dup 4 -1 roll dup 3 1 roll dup len exch sub
127 moveto lineto lineto closepath fill
128 grestore
129 } bind def
130 /lHmotif{ % i j lHmotif
131 gsave
132 1 min 2 div
133 0.85 mul 0.15 add 0.95 0.99
134 3 1 roll % prepare hsb color
135 sethsbcolor
136 % now produce the coordinates for lines
137 dup len exch sub dup 4 -1 roll 1 sub dup 3 1 roll dup len exch sub
138 moveto lineto lineto closepath fill
139 grestore
140 } bind def
141 /uImotif{ % i j k l uImotif
142 gsave
143 1 min 2 div
144 0.85 mul 0.15 add 0.95 0.99
145 3 1 roll % prepare hsb color
146 sethsbcolor
147 % now produce the coordinates for lines
148 1 sub dup 5 1 roll exch len exch sub dup 5 1 roll 3 -1 roll dup
149 5 1 roll exch 4 1 roll 3 1 roll exch 1 sub len exch sub dup 3 1 roll
150 moveto lineto lineto lineto closepath fill
151 grestore
152 } bind def
153 /lImotif{ % i j k l lImotif
154 gsave
155 1 min 2 div
156 0.85 mul 0.15 add 0.95 0.99
157 3 1 roll % prepare hsb color
158 sethsbcolor
159 % now produce the coordinates for lines
160 4 -1 roll 1 sub dup 5 1 roll exch 1 sub len exch sub dup 3 -1 roll exch
161 5 -1 roll len exch sub dup 6 -1 roll dup 3 1 roll 7 4 roll
162 moveto lineto lineto lineto closepath fill
163 grestore
164 } bind def
165
166 %data starts here
167
168 %start of quadruplex data
169
170 %start of Hmotif data
171
172 %start of Imotif data
173
174 %draw the grid
175 drawgrid
176
177 %start of base pair probability data
178 1 6 0.004632238 ubox
179 1 9 0.006654223 ubox
180 1 14 0.116131258 ubox
181 1 15 0.005506901 ubox
182 1 30 0.009716645 ubox
183 1 34 0.073740324 ubox
184 1 37 0.006701873 ubox
185 1 64 0.004871484 ubox
186 1 73 0.570925214 ubox
187 2 8 0.007083382 ubox
188 2 11 0.008406236 ubox
189 2 12 0.007044803 ubox
190 2 13 0.129102832 ubox
191 2 27 0.003166551 ubox
192 2 29 0.016103198 ubox
193 2 31 0.059809132 ubox
194 2 32 0.018860727 ubox
195 2 33 0.080458349 ubox
196 2 36 0.007548805 ubox
197 2 63 0.005718318 ubox
198 2 69 0.007556179 ubox
199 2 70 0.028650384 ubox
200 2 71 0.546628270 ubox
201 2 72 0.773685839 ubox
202 3 7 0.004749417 ubox
203 3 11 0.010358730 ubox
204 3 12 0.129015255 ubox
205 3 13 0.003933689 ubox
206 3 28 0.016108727 ubox
207 3 29 0.005358837 ubox
208 3 31 0.020535925 ubox
209 3 32 0.083122889 ubox
210 3 62 0.005713974 ubox
211 3 68 0.006646921 ubox
212 3 69 0.031485159 ubox
213 3 70 0.558919532 ubox
214 3 71 0.770984265 ubox
215 3 72 0.215962264 ubox
216 4 8 0.003846249 ubox
217 4 11 0.128681370 ubox
218 4 13 0.011210848 ubox
219 4 25 0.004019121 ubox
220 4 27 0.015919907 ubox
221 4 28 0.004907639 ubox
222 4 29 0.064014656 ubox
223 4 31 0.083429550 ubox
224 4 61 0.005688924 ubox
225 4 67 0.004381706 ubox
226 4 68 0.030984314 ubox
227 4 69 0.928667711 ubox
228 4 70 0.171363563 ubox
229 4 71 0.216620666 ubox
230 4 72 0.007349484 ubox
231 5 12 0.010780540 ubox
232 5 28 0.062660548 ubox
233 5 47 0.006856414 ubox
234 5 67 0.030480480 ubox
235 5 68 0.927409033 ubox
236 5 70 0.201662161 ubox
237 6 17 0.003163375 ubox
238 6 20 0.004307680 ubox
239 6 28 0.008183017 ubox
240 6 47 0.073508582 ubox
241 6 50 0.015670251 ubox
242 6 59 0.003724079 ubox
243 6 67 0.895370856 ubox
244 6 68 0.033940401 ubox
245 6 70 0.008321205 ubox
246 7 16 0.003361849 ubox
247 7 19 0.004518445 ubox
248 7 22 0.015784771 ubox
249 7 23 0.006061468 ubox
250 7 26 0.014487017 ubox
251 7 44 0.005844573 ubox
252 7 45 0.012806982 ubox
253 7 46 0.076342752 ubox
254 7 48 0.020848970 ubox
255 7 49 0.018126701 ubox
256 7 58 0.004549362 ubox
257 7 66 0.827624872 ubox
258 8 15 0.003431379 ubox
259 8 18 0.005204581 ubox
260 8 21 0.036410380 ubox
261 8 22 0.007907851 ubox
262 8 26 0.044491013 ubox
263 8 44 0.019732249 ubox
264 8 45 0.085065889 ubox
265 8 46 0.073831467 ubox
266 8 48 0.244628685 ubox
267 8 57 0.004318992 ubox
268 8 64 0.004391699 ubox
269 8 66 0.049191061 ubox
270 9 17 0.005251011 ubox
271 9 20 0.037521120 ubox
272 9 47 0.253722300 ubox
273 9 67 0.010690853 ubox
274 9 68 0.010096246 ubox
275 9 70 0.004399209 ubox
276 10 20 0.026215970 ubox
277 10 25 0.829289356 ubox
278 10 36 0.006465083 ubox
279 10 47 0.027737796 ubox
280 10 63 0.004597663 ubox
281 10 65 0.005017003 ubox
282 10 67 0.005447271 ubox
283 10 69 0.005544437 ubox
284 11 18 0.038327522 ubox
285 11 19 0.026908727 ubox
286 11 22 0.008733209 ubox
287 11 24 0.831795780 ubox
288 11 35 0.006471634 ubox
289 11 43 0.468132693 ubox
290 11 45 0.252989051 ubox
291 11 46 0.024187195 ubox
292 12 18 0.023602891 ubox
293 12 19 0.006232645 ubox
294 12 21 0.008604981 ubox
295 12 23 0.831740817 ubox
296 12 34 0.006375561 ubox
297 12 42 0.472749007 ubox
298 12 44 0.251590986 ubox
299 12 45 0.014945041 ubox
300 13 18 0.013723928 ubox
301 13 19 0.007497427 ubox
302 13 22 0.831631273 ubox
303 13 39 0.003427828 ubox
304 13 41 0.473909293 ubox
305 13 43 0.250370719 ubox
306 14 20 0.066488520 ubox
307 14 38 0.003182944 ubox
308 14 40 0.457844605 ubox
309 15 20 0.108308493 ubox
310 15 38 0.011419523 ubox
311 15 40 0.051301522 ubox
312 16 20 0.015471478 ubox
313 16 38 0.470000855 ubox
314 16 40 0.178550335 ubox
315 17 21 0.008767749 ubox
316 17 26 0.003387803 ubox
317 17 37 0.496886199 ubox
318 17 39 0.177094176 ubox
319 17 73 0.045173900 ubox
320 18 25 0.004902375 ubox
321 18 36 0.492816130 ubox
322 18 38 0.121851863 ubox
323 18 72 0.055748796 ubox
324 19 25 0.003883170 ubox
325 19 36 0.239923237 ubox
326 19 38 0.005417278 ubox
327 19 71 0.055691551 ubox
328 20 24 0.003644610 ubox
329 20 34 0.470810526 ubox
330 20 35 0.247657199 ubox
331 20 37 0.005831255 ubox
332 21 32 0.009783764 ubox
333 21 33 0.358241990 ubox
334 21 70 0.054635624 ubox
335 22 29 0.006362768 ubox
336 22 31 0.013177914 ubox
337 22 32 0.219551670 ubox
338 22 33 0.403084545 ubox
339 22 68 0.003789411 ubox
340 22 69 0.055392027 ubox
341 23 28 0.006024870 ubox
342 23 32 0.500859862 ubox
343 23 33 0.004324443 ubox
344 23 47 0.031904991 ubox
345 23 67 0.003787974 ubox
346 23 68 0.052636256 ubox
347 24 29 0.008474011 ubox
348 24 31 0.549100761 ubox
349 24 47 0.049197557 ubox
350 24 67 0.030536001 ubox
351 25 30 0.548338702 ubox
352 25 41 0.004144135 ubox
353 25 45 0.067140277 ubox
354 25 46 0.053750180 ubox
355 26 36 0.057394616 ubox
356 26 40 0.012772171 ubox
357 26 47 0.064315077 ubox
358 26 50 0.004714852 ubox
359 27 35 0.057448226 ubox
360 27 39 0.013170691 ubox
361 27 43 0.815569764 ubox
362 27 45 0.049009957 ubox
363 27 46 0.063413875 ubox
364 27 49 0.005262423 ubox
365 27 53 0.004564973 ubox
366 28 34 0.054697757 ubox
367 28 42 0.820379890 ubox
368 28 44 0.048191892 ubox
369 28 45 0.035895579 ubox
370 28 46 0.029285776 ubox
371 28 48 0.006599916 ubox
372 28 52 0.004579520 ubox
373 29 41 0.821245880 ubox
374 29 43 0.046763735 ubox
375 29 45 0.057920583 ubox
376 29 46 0.006457134 ubox
377 29 51 0.004606001 ubox
378 30 36 0.024024302 ubox
379 30 40 0.821070294 ubox
380 30 47 0.027558338 ubox
381 30 50 0.004615290 ubox
382 31 35 0.023900118 ubox
383 31 39 0.821259198 ubox
384 31 41 0.031662456 ubox
385 31 43 0.068739658 ubox
386 31 45 0.005088084 ubox
387 31 46 0.028387067 ubox
388 31 49 0.004618779 ubox
389 32 37 0.056070394 ubox
390 32 39 0.007808716 ubox
391 32 41 0.004679327 ubox
392 32 42 0.069668252 ubox
393 32 44 0.005113833 ubox
394 32 45 0.028339924 ubox
395 32 48 0.003694275 ubox
396 33 37 0.084188349 ubox
397 33 39 0.012554387 ubox
398 33 41 0.069738589 ubox
399 33 43 0.004988753 ubox
400 33 44 0.028077519 ubox
401 33 48 0.005052659 ubox
402 34 38 0.015647295 ubox
403 34 40 0.068716940 ubox
404 34 47 0.005883003 ubox
405 35 72 0.003223293 ubox
406 36 41 0.028025736 ubox
407 36 45 0.006071525 ubox
408 37 47 0.004492398 ubox
409 37 67 0.004929165 ubox
410 38 46 0.004623641 ubox
411 38 66 0.005612639 ubox
412 38 73 0.096471321 ubox
413 39 65 0.006372388 ubox
414 39 72 0.134387529 ubox
415 40 64 0.006366003 ubox
416 40 73 0.044296160 ubox
417 41 63 0.006315212 ubox
418 41 71 0.157425382 ubox
419 41 72 0.055795571 ubox
420 42 47 0.003279277 ubox
421 42 70 0.158258676 ubox
422 43 63 0.003504831 ubox
423 43 69 0.159460464 ubox
424 43 71 0.083592343 ubox
425 43 72 0.004963441 ubox
426 44 67 0.003632562 ubox
427 44 68 0.157762054 ubox
428 44 70 0.122775573 ubox
429 45 56 0.003216980 ubox
430 45 62 0.033079448 ubox
431 45 63 0.006333865 ubox
432 45 65 0.005683413 ubox
433 45 67 0.142807045 ubox
434 45 68 0.102004762 ubox
435 45 69 0.139542279 ubox
436 45 70 0.038496405 ubox
437 45 71 0.007227554 ubox
438 45 72 0.051023600 ubox
439 46 55 0.003223253 ubox
440 46 61 0.033233869 ubox
441 46 62 0.005934201 ubox
442 46 65 0.014068389 ubox
443 46 67 0.151344698 ubox
444 46 68 0.117431569 ubox
445 46 69 0.048110592 ubox
446 46 70 0.005932615 ubox
447 46 71 0.051023157 ubox
448 47 60 0.033207628 ubox
449 47 64 0.011567823 ubox
450 47 66 0.169443202 ubox
451 48 59 0.032419774 ubox
452 48 67 0.054982355 ubox
453 48 68 0.015912705 ubox
454 48 70 0.010752649 ubox
455 49 56 0.003800040 ubox
456 49 59 0.006023614 ubox
457 49 63 0.008508712 ubox
458 49 65 0.996813137 ubox
459 49 67 0.013145831 ubox
460 49 69 0.007555919 ubox
461 50 57 0.025044897 ubox
462 50 58 0.008142900 ubox
463 50 64 0.998396751 ubox
464 50 66 0.013239028 ubox
465 51 56 0.028984258 ubox
466 51 62 0.014992485 ubox
467 51 63 0.999154389 ubox
468 51 65 0.013340412 ubox
469 52 56 0.007696861 ubox
470 52 61 0.018442907 ubox
471 52 62 0.999085217 ubox
472 52 63 0.014927477 ubox
473 52 72 0.003975401 ubox
474 53 61 0.997430929 ubox
475 53 62 0.015882748 ubox
476 53 71 0.003986825 ubox
477 54 59 0.163009340 ubox
478 54 70 0.003908232 ubox
479 55 60 0.162646810 ubox
480 56 60 0.056948332 ubox
481 57 68 0.004617988 ubox
482 58 67 0.004981508 ubox
483 59 66 0.005078979 ubox
484 60 65 0.005070973 ubox
485 2 71 0.9500000 lbox
486 3 70 0.9500000 lbox
487 4 69 0.9500000 lbox
488 5 68 0.9500000 lbox
489 6 67 0.9500000 lbox
490 7 66 0.9500000 lbox
491 10 25 0.9500000 lbox
492 11 24 0.9500000 lbox
493 12 23 0.9500000 lbox
494 13 22 0.9500000 lbox
495 27 43 0.9500000 lbox
496 28 42 0.9500000 lbox
497 29 41 0.9500000 lbox
498 30 40 0.9500000 lbox
499 31 39 0.9500000 lbox
500 49 65 0.9500000 lbox
501 50 64 0.9500000 lbox
502 51 63 0.9500000 lbox
503 52 62 0.9500000 lbox
504 53 61 0.9500000 lbox
505 showpage
506 end
507 %%EOF