Mercurial > repos > rnateam > viennarna_rna2dfold

diff test-data/rnafold_result3.txt @ 5:da813b17038c draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/rna_tools/vienna_rna commit d9f13fd859165e4280412ec73f8f3f8b258d351d-dirty
author rnateam
date Thu, 28 Sep 2017 16:26:52 -0400
parents 0373277da3ec
children 17b6ff52efc3
line wrap: on
line diff
--- a/test-data/rnafold_result3.txt	Tue Jul 18 01:51:09 2017 -0400
+++ b/test-data/rnafold_result3.txt	Thu Sep 28 16:26:52 2017 -0400
@@ -1,3 +1,7 @@
 >Sequence
 UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA
 .((((((..((((........)))).(((((.......))))).....(((((.......))))))))))).. (-22.00)
+,((((((..((((........)))).(((((.......))))).....(((((.......))))))))),)), [-23.20]
+.((((((..((((........)))).(((((.......))))).....(((((.......))))))))).)). {-21.90 d=9.72}
+.((((((..((((........)))).(((((.......))))).....(((((.......))))))))).)). {-21.90 MEA=58.88}
+ frequency of mfe structure in ensemble 0.142309; ensemble diversity 14.51