Mercurial > repos > rnateam > viennarna_rna2dfold
changeset 5:da813b17038c draft
planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/rna_tools/vienna_rna commit d9f13fd859165e4280412ec73f8f3f8b258d351d-dirty
| author | rnateam |
|---|---|
| date | Thu, 28 Sep 2017 16:26:52 -0400 |
| parents | 65106d428453 |
| children | 17b6ff52efc3 |
| files | test-data/rnafold_result1.txt test-data/rnafold_result2.txt test-data/rnafold_result3.txt test-data/sample_3_result.txt |
| diffstat | 4 files changed, 32 insertions(+), 0 deletions(-) [+] |
line wrap: on
line diff
--- a/test-data/rnafold_result1.txt Tue Jul 18 01:51:09 2017 -0400 +++ b/test-data/rnafold_result1.txt Thu Sep 28 16:26:52 2017 -0400 @@ -1,6 +1,14 @@ >Anolis_carolinensis_chrUn_GL343590.trna2-A UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA .((((((..((((........)))).(((((.......))))).....(((((.......))))))))))).. (-22.00) +,((((((..((((........)))).(((((.......))))).....(((((.......))))))))),)), [-23.20] +.((((((..((((........)))).(((((.......))))).....(((((.......))))))))).)). {-21.90 d=9.72} +.((((((..((((........)))).(((((.......))))).....(((((.......))))))))).)). {-21.90 MEA=58.88} + frequency of mfe structure in ensemble 0.142309; ensemble diversity 14.51 >Anolis_carolinensis_chrUn_GL343207.trna3-A GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUUGAUGCCCGCAUUCUCCA (((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))). (-29.60) +(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))). [-29.88] +(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))). {-29.60 d=0.64} +(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))). {-29.60 MEA=71.81} + frequency of mfe structure in ensemble 0.63265; ensemble diversity 1.15
--- a/test-data/rnafold_result2.txt Tue Jul 18 01:51:09 2017 -0400 +++ b/test-data/rnafold_result2.txt Thu Sep 28 16:26:52 2017 -0400 @@ -1,6 +1,14 @@ >Anolis_carolinensis_chrUn_GL343590.trna2-A UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA ..(((.....((((....((..(((....)))..))...)))).....(((((.......)))))....))). ( -3.37) +.{((,..,..{(({.,{,.{,.(((....)))},.}},.}}}},,..,(((((.......)))))..,,})). [ -7.81] +...........((...(.....(((....)))....)...))......(((((.......)))))........ { 2.85 d=11.83} +.((........(((..(.....(((....)))....)..)))......(((((.......))))).....)). { 1.96 MEA=51.92} + frequency of mfe structure in ensemble 0.00162209; ensemble diversity 17.27 >Anolis_carolinensis_chrUn_GL343207.trna3-A GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUUGAUGCCCGCAUUCUCCA (((((..((.(((.....((..(((....)))..))......))).))(((((.......)))))..))))). ( -5.02) +(((((..,..{({...{,.{.,{((....))),..},,..,.}},.,,(((((.......))))).,))))). [ -9.30] +(((((.................(((....)))................(((((.......)))))..))))). { -4.42 d=10.17} +(((((......((.........(((....)))..........))....(((((.......)))))..))))). { -2.50 MEA=54.73} + frequency of mfe structure in ensemble 0.00205781; ensemble diversity 15.91
--- a/test-data/rnafold_result3.txt Tue Jul 18 01:51:09 2017 -0400 +++ b/test-data/rnafold_result3.txt Thu Sep 28 16:26:52 2017 -0400 @@ -1,3 +1,7 @@ >Sequence UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA .((((((..((((........)))).(((((.......))))).....(((((.......))))))))))).. (-22.00) +,((((((..((((........)))).(((((.......))))).....(((((.......))))))))),)), [-23.20] +.((((((..((((........)))).(((((.......))))).....(((((.......))))))))).)). {-21.90 d=9.72} +.((((((..((((........)))).(((((.......))))).....(((((.......))))))))).)). {-21.90 MEA=58.88} + frequency of mfe structure in ensemble 0.142309; ensemble diversity 14.51
--- a/test-data/sample_3_result.txt Tue Jul 18 01:51:09 2017 -0400 +++ b/test-data/sample_3_result.txt Thu Sep 28 16:26:52 2017 -0400 @@ -1,9 +1,21 @@ >SECIS_1 AUUUUAUCCAUGAAAGUGUUUCCUCUAAACCUAUGUGGAGGAACACCUGAUGUCCAGGAAAAU .((((...(((.(..(((.((((((((........))))))))))).).))).....)))).. (-27.97) +.((((...(((.{..(((.((((((((........))))))))))).}.))).....)))}.. [-29.13] +..(((...(((....(((.((((((((........)))))))))))...))).....)))... {-26.59 d=5.82} +.((((...(((.(..(((.((((((((........))))))))))).).))).....)))).. {-27.97 MEA=54.87} + frequency of mfe structure in ensemble 0.151171; ensemble diversity 8.50 >6S_1 GAAACCCUAAUGUAUUCGAUAUAGUUCCUGAUAUUUUUGAACCGAACAAUUUUUUAUACCUAGGGAGCUUGGAGUUCCGGCGCGGCGCACAUGCCUUCACACGAGGAAGUGCAAACCGUUAGACAGAGCACCCACCUGCUUUAAUUGAGAGCGGGUUCAAAGGAAGGGAAUCCUAAACGGUACGAUUGGGGUUUCU (((((((...(((((.((.....((((((....((((((((((...................(((.((((.....((.((((.(..((((.(.((((.....))))).))))...))))).))..)))).)))....(((((.....))))).))))))))))..))))))......)))))))....))))))). (-110.38) +(((((((,,{(((((,((.....{(((((....(((((((((({{{....,},.........(((.((((.....((.((((.(..((((.{.((((.....)))),.))))...))))).))}.)))).)))....(((((.....))))).))))))))))..))))),......))))))).}.,))))))). [-115.12] +(((((((..((((((.((......(((((....((((((((((...................(((.((((.....((.((((.(..((((...((((.....))))..))))...))))).))..)))).)))....(((((.....))))).))))))))))..))))).......))))))).)..))))))). {-109.37 d=10.73} +(((((((..((((((.((......(((((....((((((((((...................(((.((((.....((.((((.(..((((...((((.....))))..))))...))))).))..)))).)))....(((((.....))))).))))))))))..))))).......))))))).)..))))))). {-109.37 MEA=177.59} + frequency of mfe structure in ensemble 0.000456946; ensemble diversity 17.02 >6S_2 UUGUCCCUGCCGUGCUCGUGACUUGGCCAUACAUUCUCUGAACCUAUGUCUUACGGCAUAUGGGUUGCGGGAGUGUAGAGCUGGAGUGAUCGUCUACUCGUAGACGAACCCGAUGCUCUUCGGAUCGCGACCACCUUGAACCUCAGGGUUCGAGAUGCCGGCCUUGACGGCACAGGCGGGGCAUC .((.(((((((((((.(((.(...((((...((.((((.((((((..(((....))).....((((((((...((.(((((.((.((..((((((......))))))))))...))))).))..)))))))).............))))))))))))..)))).).))))))).))))))))).. (-129.27) +.((,(((((((((((.(((.{...((((...,,.((((.((((((..(((....))).....((((((((...{(.(((((.((.((..((((((,....,))))))))))...))))).)}..)))))))).....,,...,,.)))))))))),}..)))).}.))))))).))))))))).. [-132.48] +.((.(((((((((((.(((.(...((((......((((.((((((..(((....))).....((((((((...((.(((((.((.((..((((((......))))))))))...))))).))..)))))))).............))))))))))....)))).).))))))).))))))))).. {-129.23 d=10.34} +.((.(((((((((((.(((.(...((((...(..((((.((((((..(((....))).....((((((((...((.(((((.((.((..((((((......))))))))))...))))).))..)))))))).............)))))))))).)..)))).).))))))).))))))))).. {-128.23 MEA=168.16} + frequency of mfe structure in ensemble 0.00547171; ensemble diversity 14.91
