Mercurial > repos > rnateam > viennarna_rnaalifold

diff test-data/rnafold_result3.txt @ 6:9cc1f04c696b draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/rna_tools/vienna_rna commit d9f13fd859165e4280412ec73f8f3f8b258d351d-dirty
author rnateam
date Thu, 28 Sep 2017 16:20:30 -0400
parents c8fff1159bbb
children b63684e40386
line wrap: on
line diff
--- a/test-data/rnafold_result3.txt	Fri Sep 22 09:47:01 2017 -0400
+++ b/test-data/rnafold_result3.txt	Thu Sep 28 16:20:30 2017 -0400
@@ -1,3 +1,7 @@
 >Sequence
 UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA
 .((((((..((((........)))).(((((.......))))).....(((((.......))))))))))).. (-22.00)
+,((((((..((((........)))).(((((.......))))).....(((((.......))))))))),)), [-23.20]
+.((((((..((((........)))).(((((.......))))).....(((((.......))))))))).)). {-21.90 d=9.72}
+.((((((..((((........)))).(((((.......))))).....(((((.......))))))))).)). {-21.90 MEA=58.88}
+ frequency of mfe structure in ensemble 0.142309; ensemble diversity 14.51