changeset 0:4286146cb3aa draft

planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/rna_tools/vienna_rna commit 0065dafe7bbd382bb995b28cc4089c9e4f4eeeb9
author rnateam
date Tue, 06 Dec 2016 12:35:35 -0500
parents
children c95456522e04
files macros.xml rnadistance.xml test-data/kinfold_input.txt test-data/rna2dfold_input1.txt test-data/rna2dfold_result1.txt test-data/rnaaliduplex_input1.clustal test-data/rnaaliduplex_result1.txt test-data/rnaalifold_input1.clustal test-data/rnaalifold_result1.txt test-data/rnacofold_input1.fas test-data/rnacofold_result1.txt test-data/rnadistance_input1.dbn test-data/rnadistance_result1.txt test-data/rnaduplex_input1.fa test-data/rnaduplex_result1.txt test-data/rnaeval_input1.dbn test-data/rnaeval_result1.txt test-data/rnafold_input1.fa test-data/rnafold_input2.fa test-data/rnafold_result1.txt test-data/rnafold_result2.txt test-data/rnafold_result3.txt test-data/rnaheat_input1.fa test-data/rnaheat_result1.txt test-data/rnainverse_input1.clu test-data/rnalalifold_input1.clustal test-data/rnalalifold_result1.txt test-data/rnalfold_input1.fa test-data/rnalfold_result1.txt test-data/rnapaln_input1.fa test-data/rnapaln_input1.fas test-data/rnapaln_result1.txt test-data/rnapdist_input1.fa test-data/rnapdist_result1.txt test-data/rnapkplex_input1.fa test-data/rnapkplex_result1.txt test-data/rnaplex_input1.fa test-data/rnaplex_result1.txt test-data/rnaplfold_input1.fa test-data/rnaplfold_result1.ps test-data/rnaplfold_result2.ps test-data/rnaplot_input1.dbn test-data/rnaplot_input1.fa test-data/rnasnoop_input1a.fa test-data/rnasnoop_input1b.fa test-data/rnasnoop_result1.txt test-data/rnasubopt_input1.fa test-data/rnasubopt_result1.txt test-data/rnaup_input1.fa test-data/rnaup_result1.txt vienna_rna.tar.gz
diffstat 51 files changed, 863 insertions(+), 0 deletions(-) [+]
line wrap: on
line diff
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/macros.xml	Tue Dec 06 12:35:35 2016 -0500
@@ -0,0 +1,26 @@
+<macros>
+    <xml name="requirements">
+        <requirements>
+            <requirement version="2.2.10">viennarna</requirement>
+        </requirements>
+    </xml>
+    <token name="@VERSION@">2.2.10</token>
+    <xml name="version_command">
+        <version_command>@EXECUTABLE@ --version</version_command>
+    </xml>
+
+    <xml name="stdio">
+        <stdio>
+            <exit_code range="1:" />
+            <exit_code range=":-1" />
+            <regex match="Error:" />
+            <regex match="Exception:" />
+        </stdio>
+    </xml>
+
+    <xml name="citations">
+        <citations>
+            <citation type="doi">10.1186/1748-7188-6-26</citation>
+        </citations>
+    </xml>
+</macros>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/rnadistance.xml	Tue Dec 06 12:35:35 2016 -0500
@@ -0,0 +1,85 @@
+<tool id="viennarna_rnadistance" name="@EXECUTABLE@" version="@VERSION@.0">
+    <description>Calculate distance between secondary structures of two RNAs</description>
+    <macros>
+        <token name="@EXECUTABLE@">RNAdistance</token>
+        <import>macros.xml</import>
+    </macros>
+    <expand macro="requirements" />
+    <expand macro="stdio" />
+    <expand macro="version_command" />
+    <command>
+<![CDATA[
+        RNAdistance < '$input' > '$outfile'
+        --distance=#echo ''.join(str($distance).split(','))#
+        --compare=$compare
+        $shapiro
+        $backtrack
+        #if $backtrack and str($compare)=="m"
+            && cat backtrack.file >> '$outfile'
+        #end if
+]]>
+    </command>
+    <inputs>
+        <param name="input" type="data" format="*" label="Primary and secondary stuctures file"/>
+        <param name="distance" type="select" multiple="true" display="checkboxes" label="Representation to calculate the distance / alignment option">
+                <option value="f" selected="true">full/tree</option>
+                <option value="F">full/string</option>
+                <option value="h">hit/tree</option>
+                <option value="H">hit/string</option>
+                <option value="w">weighted coarse/tree</option>
+                <option value="W">weighted coarse/string</option>
+                <option value="c">coarse/tree</option>
+                <option value="C">coarse/string</option>
+                <validator type="no_options" message="Please select at least one type."/>
+        </param>
+        <param name="compare" type="select" label="Comparison Option" help="-d">
+            <option value="p" selected="True">p: pairwise (1st with 2nd, 3rd with 4th, ...)</option>
+            <option value="m">m: matrix (each with each, output in matrix form)</option>
+            <option value="f" >f: first (1st with 2nd, 1st with 3rd, ...)</option>
+            <option value="c">c: continuous (1st with 2nd, 2nd with 3rd, ...)</option>
+        </param>
+        <param argument="--shapiro" type="boolean" checked="false" truevalue="--shapiro" falsevalue="" label="Use cost matrix by Bruce Shapiro" help="--shapiro"/>
+        <param argument="--backtrack" type="boolean" checked="false" truevalue="--backtrack" falsevalue="" label="Print an alignment" help="--backtrack"/>
+    </inputs>
+    <outputs>
+        <data format="txt" name="outfile"/>
+    </outputs>
+    <tests>
+        <test>
+            <param name="input" value="rnadistance_input1.dbn"/>
+            <output name="outfile" file="rnadistance_result1.txt"/>
+        </test>
+    </tests>
+    <help>
+<![CDATA[
+**RNAdistance**
+
+
+-----
+
+**Input format**
+
+RNAdistance requires one input file with the following structure:
+1st line: can be a comment line like in Fasta, begins with '>'
+2nd line: sequence
+3rd line: first secondary structure in dot-bracket notation
+4th line: second secondary structure in dot-bracket notation
+...
+nth line: another sequence
+...
+
+Several different RNA secondary structures can be specified. The input has a Fasta-like structure but with secondary structure information.
+
+
+------
+
+**Outputs**
+
+* distance of the structures
+* with the backtrack options it is possible to get alignment ouput
+
+
+]]>
+    </help>
+    <expand macro="citations" />
+</tool>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/kinfold_input.txt	Tue Dec 06 12:35:35 2016 -0500
@@ -0,0 +1,1 @@
+ACUGAUCGUAGUCAC
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rna2dfold_input1.txt	Tue Dec 06 12:35:35 2016 -0500
@@ -0,0 +1,4 @@
+>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872)  Ala (AGC) 73 bp  Sc: 49.55
+UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA
+.((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))..
+.((((((..(((..........))).(((((.......))))).....(((((.......)))))))))))..
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rna2dfold_result1.txt	Tue Dec 06 12:35:35 2016 -0500
@@ -0,0 +1,6 @@
+>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC
+UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA
+.((((((..((((........)))).(((((.......))))).....(((((.......))))))))))).. (-22.00)
+.((((((..((((........)))).(((((.......))))).....(((((.......))))))))))).. (-22.00) <ref 1>
+.((((((..(((..........))).(((((.......))))).....(((((.......))))))))))).. (-17.30) <ref 2>
+k	l	en	structure
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnaaliduplex_input1.clustal	Tue Dec 06 12:35:35 2016 -0500
@@ -0,0 +1,7 @@
+CLUSTAL 2.1 multiple sequence alignment
+
+
+Anolis_carolinensis_chrUn_GL34      TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA
+Anolis_carolinensis_chrUn_GL35      GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA
+                                     ************************************** ************** ******* ********* 
+
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnaaliduplex_result1.txt	Tue Dec 06 12:35:35 2016 -0500
@@ -0,0 +1,1 @@
+(((((((..(.......((((..(..((((((..((((((.......((((((..(..(((((..(((((((.&)))))))..).......))))..)..))))))..)))))).......))))))..)..)))))..))))))).   1,73  :   1,73  (-40.30)
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnaalifold_input1.clustal	Tue Dec 06 12:35:35 2016 -0500
@@ -0,0 +1,7 @@
+CLUSTAL 2.1 multiple sequence alignment
+
+
+Anolis_carolinensis_chrUn_GL34      TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA
+Anolis_carolinensis_chrUn_GL35      GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA
+                                     ************************************** ************** ******* ********* 
+
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnaalifold_result1.txt	Tue Dec 06 12:35:35 2016 -0500
@@ -0,0 +1,2 @@
+GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUCGAUGCCCACAUUCUCCA
+(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))). (-26.45 = -26.20 +  -0.25)
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnacofold_input1.fas	Tue Dec 06 12:35:35 2016 -0500
@@ -0,0 +1,2 @@
+>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872)  Ala (AGC) 73 bp  Sc: 49.55
+UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA&UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnacofold_result1.txt	Tue Dec 06 12:35:35 2016 -0500
@@ -0,0 +1,3 @@
+>Anolis_carolinensis_chrUn_GL343590.trna2-A
+UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA&UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA
+.((((((..((((........)))).(((((.......))))).....(((((((((((.(((((((((((..&.))))))..((((........)))).(((((.......))))).....))))))))))).))))))))))).. (-55.90)
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnadistance_input1.dbn	Tue Dec 06 12:35:35 2016 -0500
@@ -0,0 +1,2 @@
+.((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))..
+(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))).
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnadistance_result1.txt	Tue Dec 06 12:35:35 2016 -0500
@@ -0,0 +1,1 @@
+f: 4  
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnaduplex_input1.fa	Tue Dec 06 12:35:35 2016 -0500
@@ -0,0 +1,4 @@
+>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872)  Ala (AGC) 73 bp  Sc: 49.55
+TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA
+>Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC (1513626-1513698)  Ala (AGC) 73 bp  Sc: 56.15
+GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnaduplex_result1.txt	Tue Dec 06 12:35:35 2016 -0500
@@ -0,0 +1,3 @@
+>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC
+>Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC
+.((((((..((......((((...((((..(((.((((((.......((((((..(..((((...(((((((.&)))))))..........))))..)..))))))..))))))..)))..)))).......)))).)))))))).   1,73  :   1,72  (-40.70)
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnaeval_input1.dbn	Tue Dec 06 12:35:35 2016 -0500
@@ -0,0 +1,3 @@
+>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872)  Ala (AGC) 73 bp  Sc: 49.55
+UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA
+.((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))..
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnaeval_result1.txt	Tue Dec 06 12:35:35 2016 -0500
@@ -0,0 +1,3 @@
+>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872)  Ala (AGC) 73 bp  Sc: 49.55
+UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA
+.((((((..((((........)))).(((((.......))))).....(((((.......))))))))))).. (-22.00)
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnafold_input1.fa	Tue Dec 06 12:35:35 2016 -0500
@@ -0,0 +1,4 @@
+>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872)  Ala (AGC) 73 bp  Sc: 49.55
+TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA
+>Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC (1513626-1513698)  Ala (AGC) 73 bp  Sc: 56.15
+GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnafold_input2.fa	Tue Dec 06 12:35:35 2016 -0500
@@ -0,0 +1,4 @@
+>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872)  Ala (AGC) 73 bp  Sc: 49.55
+TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA
+>Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC (1513626-1513698)  Ala (AGC) 73 bp  Sc: 56.15
+GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnafold_result1.txt	Tue Dec 06 12:35:35 2016 -0500
@@ -0,0 +1,6 @@
+>Anolis_carolinensis_chrUn_GL343590.trna2-A
+UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA
+.((((((..((((........)))).(((((.......))))).....(((((.......))))))))))).. (-22.00)
+>Anolis_carolinensis_chrUn_GL343207.trna3-A
+GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUUGAUGCCCGCAUUCUCCA
+(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))). (-29.60)
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnafold_result2.txt	Tue Dec 06 12:35:35 2016 -0500
@@ -0,0 +1,6 @@
+>Anolis_carolinensis_chrUn_GL343590.trna2-A
+UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA
+..(((.....((((....((..(((....)))..))...)))).....(((((.......)))))....))). ( -3.37)
+>Anolis_carolinensis_chrUn_GL343207.trna3-A
+GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUUGAUGCCCGCAUUCUCCA
+(((((..((.(((.....((..(((....)))..))......))).))(((((.......)))))..))))). ( -5.02)
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnafold_result3.txt	Tue Dec 06 12:35:35 2016 -0500
@@ -0,0 +1,3 @@
+>Sequence
+UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA
+.((((((..((((........)))).(((((.......))))).....(((((.......))))))))))).. (-22.00)
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnaheat_input1.fa	Tue Dec 06 12:35:35 2016 -0500
@@ -0,0 +1,2 @@
+> comment 1
+UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnaheat_result1.txt	Tue Dec 06 12:35:35 2016 -0500
@@ -0,0 +1,102 @@
+> comment 1
+0   0.0407267
+1   0.0435052
+2   0.0470227
+3   0.0505646
+4   0.0553391
+5   0.0603894
+6   0.0662047
+7   0.0718158
+8   0.0782007
+9   0.0863514
+10   0.0950516
+11   0.10505
+12   0.115613
+13   0.128245
+14   0.141712
+15   0.157281
+16   0.17497
+17   0.195056
+18   0.216799
+19   0.241743
+20   0.270432
+21   0.302132
+22   0.337644
+23   0.377263
+24   0.421546
+25   0.470799
+26   0.525589
+27   0.587016
+28   0.653829
+29   0.726606
+30   0.806458
+31   0.892656
+32   0.984857
+33   1.08272
+34   1.18601
+35   1.29332
+36   1.40305
+37   1.51467
+38   1.62618
+39   1.73524
+40   1.84032
+41   1.9407
+42   2.03385
+43   2.11859
+44   2.19443
+45   2.26182
+46   2.31999
+47   2.36969
+48   2.41182
+49   2.44826
+50   2.47967
+51   2.50769
+52   2.534
+53   2.55942
+54   2.5851
+55   2.61217
+56   2.64151
+57   2.67329
+58   2.70759
+59   2.74465
+60   2.78458
+61   2.8279
+62   2.8742
+63   2.92425
+64   2.97698
+65   3.03283
+66   3.09163
+67   3.15591
+68   3.23033
+69   3.3067
+70   3.38122
+71   3.45791
+72   3.54606
+73   3.63843
+74   3.73392
+75   3.83847
+76   3.94646
+77   4.05462
+78   4.16571
+79   4.28366
+80   4.39944
+81   4.50863
+82   4.61035
+83   4.70186
+84   4.78345
+85   4.85204
+86   4.90509
+87   4.9392
+88   4.95425
+89   4.95214
+90   4.93688
+91   4.91166
+92   4.87691
+93   4.8314
+94   4.78561
+95   4.75271
+96   4.71866
+97   4.66056
+98   4.57671
+99   4.48395
+100   4.39006
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnainverse_input1.clu	Tue Dec 06 12:35:35 2016 -0500
@@ -0,0 +1,2 @@
+(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))).
+gggccccnnaauunnnnnnnnaauunGGGGcnnnnnnnAAAAAnnnnnuuuuannnnnnnuaaaaggggcccn
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnalalifold_input1.clustal	Tue Dec 06 12:35:35 2016 -0500
@@ -0,0 +1,7 @@
+CLUSTAL 2.1 multiple sequence alignment
+
+
+Anolis_carolinensis_chrUn_GL34      TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA
+Anolis_carolinensis_chrUn_GL35      GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA
+                                     ************************************** ************** ******* ********* 
+
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnalalifold_result1.txt	Tue Dec 06 12:35:35 2016 -0500
@@ -0,0 +1,4 @@
+(((.(((((.(((((.......)))))..)).(((((.......)))))..)))))) (-19.05)   17 -   73
+((((........)))). ( -5.10)   10 -   26
+GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUCGAUGCCCACAUUCUCCA
+
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnalfold_input1.fa	Tue Dec 06 12:35:35 2016 -0500
@@ -0,0 +1,4 @@
+>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872)  Ala (AGC) 73 bp  Sc: 49.55
+TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA
+>Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC (1513626-1513698)  Ala (AGC) 73 bp  Sc: 56.15
+GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnalfold_result1.txt	Tue Dec 06 12:35:35 2016 -0500
@@ -0,0 +1,28 @@
+>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872)  Ala (AGC) 73 bp  Sc: 49.55
+.((((....)))).	( -0.10)	56
+.(((..((((....)))).))).	( -3.40)	51
+.(((((.......))))).	( -7.70)	48
+.((((..(((((.......)))))..)))).	(-10.30)	42
+.(((((...(((((.......))))).))))).	(-11.50)	40
+.((.(((((...(((((.......))))).)))))))	(-12.10)	37
+.(((((.......))))).	( -5.80)	26
+.((.(((((.......)))))..)).	( -6.70)	23
+.((((....)))).	( -3.20)	21
+.((.((((....)))).)).	( -4.70)	18
+.((((........)))).	( -5.30)	9
+.((((((..((((........)))).(((((.......))))).....(((((.......))))))))))).	(-22.00)	1
+UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA
+ (-22.00)
+>Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC (1513626-1513698)  Ala (AGC) 73 bp  Sc: 56.15
+.(((..((((....)))).))).	( -3.40)	51
+.(((((.......))))).	( -9.20)	48
+.((((..(((((.......)))))..)))).	(-11.80)	42
+.(((((...(((((.......))))).))))).	(-13.30)	40
+.((.(((((...(((((.......))))).)))))))	(-13.60)	37
+.(((((.......))))).	( -7.70)	26
+.((.(((((.......)))))..)).	( -8.60)	23
+.(((.(((((.(((((.......)))))..)).(((((.......)))))..))))))	(-20.00)	16
+.((((........)))).	( -5.30)	9
+(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))).	(-29.60)	1
+GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUUGAUGCCCGCAUUCUCCA
+ (-29.60)
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnapaln_input1.fa	Tue Dec 06 12:35:35 2016 -0500
@@ -0,0 +1,4 @@
+>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872)  Ala (AGC) 73 bp  Sc: 49.55
+TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA
+>Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC (1513626-1513698)  Ala (AGC) 73 bp  Sc: 56.15
+GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnapaln_input1.fas	Tue Dec 06 12:35:35 2016 -0500
@@ -0,0 +1,1 @@
+UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA&UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnapaln_result1.txt	Tue Dec 06 12:35:35 2016 -0500
@@ -0,0 +1,7 @@
+>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872)  Ala (AGC) 73 bp  Sc: 49.55
+>Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC (1513626-1513698)  Ala (AGC) 73 bp  Sc: 56.15
+68.8844
+UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA
+,((((((..((((........)))).(((((.......))))).....(((((.......))))))))),)),
+GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUUGAUGCCCGCAUUCUCCA
+(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))).
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnapdist_input1.fa	Tue Dec 06 12:35:35 2016 -0500
@@ -0,0 +1,4 @@
+>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872)  Ala (AGC) 73 bp  Sc: 49.55
+TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA
+>Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC (1513626-1513698)  Ala (AGC) 73 bp  Sc: 56.15
+GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnapdist_result1.txt	Tue Dec 06 12:35:35 2016 -0500
@@ -0,0 +1,3 @@
+>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872)  Ala (AGC) 73 bp  Sc: 49.55
+>Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC (1513626-1513698)  Ala (AGC) 73 bp  Sc: 56.15
+8.66253
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnapkplex_input1.fa	Tue Dec 06 12:35:35 2016 -0500
@@ -0,0 +1,4 @@
+>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872)  Ala (AGC) 73 bp  Sc: 49.55
+TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA
+>Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC (1513626-1513698)  Ala (AGC) 73 bp  Sc: 56.15
+GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnapkplex_result1.txt	Tue Dec 06 12:35:35 2016 -0500
@@ -0,0 +1,6 @@
+>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872)  Ala (AGC) 73 bp  Sc: 49.55
+UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA
+.((((((..((((........)))).(((((.......))))).[[[.(((((]]]....))))))))))).. (-31.90)
+>Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC (1513626-1513698)  Ala (AGC) 73 bp  Sc: 56.15
+GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUUGAUGCCCGCAUUCUCCA
+(((((((..((((..[[[.[[)))).(((((.]].]]]))))).....(((((.......)))))))))))). (-38.54)
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnaplex_input1.fa	Tue Dec 06 12:35:35 2016 -0500
@@ -0,0 +1,4 @@
+>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872)  Ala (AGC) 73 bp  Sc: 49.55
+TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA
+>Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC (1513626-1513698)  Ala (AGC) 73 bp  Sc: 56.15
+GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnaplex_result1.txt	Tue Dec 06 12:35:35 2016 -0500
@@ -0,0 +1,4 @@
+>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872)  Ala (AGC) 73 bp  Sc: 49.55
+>Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC (1513626-1513698)  Ala (AGC) 73 bp  Sc: 56.15
+.((((((..((......((((...((((..(((.((((((.......((((((..(..((((...(((((((.&)))))))..........))))..)..))))))..))))))..)))..)))).......)))).)))))))).   1,73  :   1,72  (-40.70) i:72,j:1 <-41.26>
+
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnaplfold_input1.fa	Tue Dec 06 12:35:35 2016 -0500
@@ -0,0 +1,4 @@
+>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872)  Ala (AGC) 73 bp  Sc: 49.55
+TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA
+>Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC (1513626-1513698)  Ala (AGC) 73 bp  Sc: 56.15
+GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnaplfold_result1.ps	Tue Dec 06 12:35:35 2016 -0500
@@ -0,0 +1,242 @@
+%!PS-Adobe-3.0 EPSF-3.0
+%%Title: RNA Dot Plot
+%%Creator: ViennaRNA-2.2.10
+%%CreationDate: Tue Oct  4 14:45:55 2016
+%%BoundingBox: 66 530 520 650
+%%DocumentFonts: Helvetica
+%%Pages: 1
+%%EndComments
+
+%Options: 
+%This file contains the square roots of the base pair probabilities in the form
+% i  j  sqrt(p(i,j)) ubox
+
+%%BeginProlog
+/DPdict 100 dict def
+DPdict begin
+/logscale false def
+/lpmin 1e-05 log def
+
+/box { %size x y box - draws box centered on x,y
+   2 index 0.5 mul sub            % x -= 0.5
+   exch 2 index 0.5 mul sub exch  % y -= 0.5
+   3 -1 roll dup rectfill
+} bind def
+
+/ubox {
+   logscale {
+      log dup add lpmin div 1 exch sub dup 0 lt { pop 0 } if
+   } if
+   3 1 roll
+   exch len exch sub 1 add box
+} bind def
+
+/lbox {
+   3 1 roll
+   len exch sub 1 add box
+} bind def
+
+/drawseq {
+% print sequence along all 4 sides
+[ [0.7 -0.3 0 ]
+  [0.7 0.7 len add 0]
+  [-0.3 len sub -0.4 -90]
+  [-0.3 len sub 0.7 len add -90]
+] {
+   gsave
+    aload pop rotate translate
+    0 1 len 1 sub {
+     dup 0 moveto
+     sequence exch 1 getinterval
+     show
+    } for
+   grestore
+  } forall
+} bind def
+
+/drawgrid{
+  0.01 setlinewidth
+  len log 0.9 sub cvi 10 exch exp  % grid spacing
+  dup 1 gt {
+     dup dup 20 div dup 2 array astore exch 40 div setdash
+  } { [0.3 0.7] 0.1 setdash } ifelse
+  0 exch len {
+     dup dup
+     0 moveto
+     len lineto
+     dup
+     len exch sub 0 exch moveto
+     len exch len exch sub lineto
+     stroke
+  } for
+  [] 0 setdash
+  0.04 setlinewidth
+  currentdict /cutpoint known {
+    cutpoint 1 sub
+    dup dup -1 moveto len 1 add lineto
+    len exch sub dup
+    -1 exch moveto len 1 add exch lineto
+    stroke
+  } if
+  0.5 neg dup translate
+} bind def
+
+end
+%%EndProlog
+DPdict begin
+%delete next line to get rid of title
+270 665 moveto /Helvetica findfont 14 scalefont setfont (Anolis_carolinensis_chrUn_GL343590.trna2-A) show
+
+/sequence { (\
+UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA\
+) } def
+/winSize 70 def
+/len { sequence length } bind def
+
+292 416 translate
+72 6 mul len 1 add winSize add 2 sqrt mul div dup scale
+/Helvetica findfont 0.95 scalefont setfont
+
+/drawseq_turn {% print sequence at bottom
+   gsave
+   len 2 sqrt div dup neg 0.28 add exch 0.78 sub translate
+    0 1 len 1 sub {
+     dup dup 2 sqrt mul 0 moveto
+     sequence exch 1 getinterval
+     show
+    } for
+   grestore
+} bind def
+/drawgrid_turn{
+  0.01 setlinewidth
+  len log 0.9 sub cvi 10 exch exp  % grid spacing
+  dup 1 gt {
+     dup dup 20 div dup 2 array astore exch 40 div setdash
+  } { [0.3 0.7] 0.1 setdash } ifelse
+  0 exch len {    %for (0, gridspacing, len) 
+     dup dup      %duplicate what - gridspacing??
+     dup len exch sub moveto     %moveto diagonal?
+     dup winSize gt
+     {dup dup len exch sub winSize add lineto}
+     {dup len lineto}ifelse
+     dup len exch sub moveto  %moveto diagonal?
+     dup len winSize sub le
+     {dup dup len exch sub dup winSize exch sub len add exch lineto}
+     {dup dup len exch sub len exch lineto}ifelse     stroke pop pop
+  } for
+  len log 0.9 sub cvi 10 exch exp  % grid spacing
+      dup 1 gt {
+          dup dup 20 div dup 2 array astore exch 40 div setdash
+      } { [0.3 0.7] 0.1 setdash } ifelse
+      0 exch len {    %for (0, gridspacing, len) 
+     dup dup      %duplicate what - gridspacing??
+     dup len exch sub moveto     %moveto diagonal?
+     len exch sub 0.7 sub exch 0.7 sub exch lineto
+     stroke
+   }for
+ winSize len moveto  len winSize  lineto stroke
+  [] 0 setdash
+  0.04 setlinewidth 
+  currentdict /cutpoint known {
+    cutpoint 1 sub
+    dup dup -1 moveto len 1 add lineto
+    len exch sub dup
+    -1 exch moveto len 1 add exch lineto
+   stroke
+  } if
+  0.5 neg dup translate
+} bind def 
+
+0.5 dup translate
+drawseq_turn
+45 rotate
+
+
+%draw the grid
+drawgrid_turn
+
+%start of base pair probability data
+2 70 0.1568 ubox
+2 71 0.9619 ubox
+3 69 0.1395 ubox
+3 70 0.7414 ubox
+3 72 0.8060 ubox
+4 68 0.1157 ubox
+4 69 0.6748 ubox
+4 71 0.4682 ubox
+5 67 0.1065 ubox
+5 68 0.6724 ubox
+5 70 0.3765 ubox
+6 47 0.1250 ubox
+6 67 0.6497 ubox
+7 46 0.1273 ubox
+7 66 0.6008 ubox
+8 45 0.1294 ubox
+8 48 0.2252 ubox
+9 47 0.2335 ubox
+10 25 0.7863 ubox
+11 24 0.7884 ubox
+11 43 0.5215 ubox
+11 45 0.2330 ubox
+12 23 0.7883 ubox
+12 42 0.5493 ubox
+12 44 0.2317 ubox
+13 22 0.7882 ubox
+13 41 0.5528 ubox
+13 43 0.2306 ubox
+14 40 0.5338 ubox
+15 20 0.1027 ubox
+16 38 0.5325 ubox
+16 40 0.1646 ubox
+17 37 0.5639 ubox
+17 39 0.1633 ubox
+18 36 0.5591 ubox
+18 38 0.1125 ubox
+19 36 0.2406 ubox
+20 34 0.5341 ubox
+20 35 0.2514 ubox
+21 33 0.4064 ubox
+22 32 0.2491 ubox
+22 33 0.4413 ubox
+23 32 0.5541 ubox
+24 31 0.6100 ubox
+25 30 0.6092 ubox
+26 36 0.2144 ubox
+27 35 0.2146 ubox
+27 43 0.7269 ubox
+28 34 0.2043 ubox
+28 42 0.7445 ubox
+29 41 0.7467 ubox
+30 40 0.7468 ubox
+31 39 0.7470 ubox
+38 73 0.3242 ubox
+39 72 0.3055 ubox
+40 73 0.1211 ubox
+41 71 0.2953 ubox
+41 72 0.1146 ubox
+42 70 0.2588 ubox
+43 69 0.2613 ubox
+43 71 0.2848 ubox
+44 68 0.2587 ubox
+44 70 0.3418 ubox
+45 67 0.2339 ubox
+45 68 0.1772 ubox
+45 69 0.3617 ubox
+45 70 0.1014 ubox
+45 72 0.3111 ubox
+46 67 0.2550 ubox
+46 68 0.3039 ubox
+46 69 0.1150 ubox
+46 71 0.2540 ubox
+47 66 0.2925 ubox
+48 67 0.1378 ubox
+49 65 0.9938 ubox
+50 64 0.9971 ubox
+51 63 0.9980 ubox
+52 62 0.9980 ubox
+53 61 0.9963 ubox
+54 59 0.1628 ubox
+55 60 0.1625 ubox
+showpage
+end
+%%EOF
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnaplfold_result2.ps	Tue Dec 06 12:35:35 2016 -0500
@@ -0,0 +1,212 @@
+%!PS-Adobe-3.0 EPSF-3.0
+%%Title: RNA Dot Plot
+%%Creator: ViennaRNA-2.2.10
+%%CreationDate: Tue Oct  4 14:45:55 2016
+%%BoundingBox: 66 530 520 650
+%%DocumentFonts: Helvetica
+%%Pages: 1
+%%EndComments
+
+%Options: 
+%This file contains the square roots of the base pair probabilities in the form
+% i  j  sqrt(p(i,j)) ubox
+
+%%BeginProlog
+/DPdict 100 dict def
+DPdict begin
+/logscale false def
+/lpmin 1e-05 log def
+
+/box { %size x y box - draws box centered on x,y
+   2 index 0.5 mul sub            % x -= 0.5
+   exch 2 index 0.5 mul sub exch  % y -= 0.5
+   3 -1 roll dup rectfill
+} bind def
+
+/ubox {
+   logscale {
+      log dup add lpmin div 1 exch sub dup 0 lt { pop 0 } if
+   } if
+   3 1 roll
+   exch len exch sub 1 add box
+} bind def
+
+/lbox {
+   3 1 roll
+   len exch sub 1 add box
+} bind def
+
+/drawseq {
+% print sequence along all 4 sides
+[ [0.7 -0.3 0 ]
+  [0.7 0.7 len add 0]
+  [-0.3 len sub -0.4 -90]
+  [-0.3 len sub 0.7 len add -90]
+] {
+   gsave
+    aload pop rotate translate
+    0 1 len 1 sub {
+     dup 0 moveto
+     sequence exch 1 getinterval
+     show
+    } for
+   grestore
+  } forall
+} bind def
+
+/drawgrid{
+  0.01 setlinewidth
+  len log 0.9 sub cvi 10 exch exp  % grid spacing
+  dup 1 gt {
+     dup dup 20 div dup 2 array astore exch 40 div setdash
+  } { [0.3 0.7] 0.1 setdash } ifelse
+  0 exch len {
+     dup dup
+     0 moveto
+     len lineto
+     dup
+     len exch sub 0 exch moveto
+     len exch len exch sub lineto
+     stroke
+  } for
+  [] 0 setdash
+  0.04 setlinewidth
+  currentdict /cutpoint known {
+    cutpoint 1 sub
+    dup dup -1 moveto len 1 add lineto
+    len exch sub dup
+    -1 exch moveto len 1 add exch lineto
+    stroke
+  } if
+  0.5 neg dup translate
+} bind def
+
+end
+%%EndProlog
+DPdict begin
+%delete next line to get rid of title
+270 665 moveto /Helvetica findfont 14 scalefont setfont (Anolis_carolinensis_chrUn_GL343207.trna3-A) show
+
+/sequence { (\
+GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUUGAUGCCCGCAUUCUCCA\
+) } def
+/winSize 70 def
+/len { sequence length } bind def
+
+292 416 translate
+72 6 mul len 1 add winSize add 2 sqrt mul div dup scale
+/Helvetica findfont 0.95 scalefont setfont
+
+/drawseq_turn {% print sequence at bottom
+   gsave
+   len 2 sqrt div dup neg 0.28 add exch 0.78 sub translate
+    0 1 len 1 sub {
+     dup dup 2 sqrt mul 0 moveto
+     sequence exch 1 getinterval
+     show
+    } for
+   grestore
+} bind def
+/drawgrid_turn{
+  0.01 setlinewidth
+  len log 0.9 sub cvi 10 exch exp  % grid spacing
+  dup 1 gt {
+     dup dup 20 div dup 2 array astore exch 40 div setdash
+  } { [0.3 0.7] 0.1 setdash } ifelse
+  0 exch len {    %for (0, gridspacing, len) 
+     dup dup      %duplicate what - gridspacing??
+     dup len exch sub moveto     %moveto diagonal?
+     dup winSize gt
+     {dup dup len exch sub winSize add lineto}
+     {dup len lineto}ifelse
+     dup len exch sub moveto  %moveto diagonal?
+     dup len winSize sub le
+     {dup dup len exch sub dup winSize exch sub len add exch lineto}
+     {dup dup len exch sub len exch lineto}ifelse     stroke pop pop
+  } for
+  len log 0.9 sub cvi 10 exch exp  % grid spacing
+      dup 1 gt {
+          dup dup 20 div dup 2 array astore exch 40 div setdash
+      } { [0.3 0.7] 0.1 setdash } ifelse
+      0 exch len {    %for (0, gridspacing, len) 
+     dup dup      %duplicate what - gridspacing??
+     dup len exch sub moveto     %moveto diagonal?
+     len exch sub 0.7 sub exch 0.7 sub exch lineto
+     stroke
+   }for
+ winSize len moveto  len winSize  lineto stroke
+  [] 0 setdash
+  0.04 setlinewidth 
+  currentdict /cutpoint known {
+    cutpoint 1 sub
+    dup dup -1 moveto len 1 add lineto
+    len exch sub dup
+    -1 exch moveto len 1 add exch lineto
+   stroke
+  } if
+  0.5 neg dup translate
+} bind def 
+
+0.5 dup translate
+drawseq_turn
+45 rotate
+
+
+%draw the grid
+drawgrid_turn
+
+%start of base pair probability data
+2 70 0.1914 ubox
+2 71 0.9787 ubox
+3 69 0.1660 ubox
+3 70 0.7676 ubox
+3 72 0.8449 ubox
+4 68 0.1377 ubox
+4 69 0.7113 ubox
+4 71 0.4928 ubox
+5 67 0.1266 ubox
+5 68 0.7090 ubox
+5 70 0.3955 ubox
+6 67 0.6860 ubox
+7 66 0.6345 ubox
+10 25 0.9888 ubox
+11 24 0.9915 ubox
+12 23 0.9914 ubox
+13 22 0.9913 ubox
+15 20 0.1291 ubox
+17 73 0.1217 ubox
+18 72 0.1091 ubox
+27 43 0.9522 ubox
+28 42 0.9836 ubox
+29 41 0.9874 ubox
+30 40 0.9886 ubox
+31 39 0.9883 ubox
+33 37 0.1014 ubox
+38 73 0.1170 ubox
+39 72 0.1080 ubox
+41 71 0.1523 ubox
+42 70 0.1341 ubox
+43 69 0.1387 ubox
+43 71 0.2800 ubox
+44 68 0.1392 ubox
+44 70 0.3364 ubox
+45 67 0.1266 ubox
+45 68 0.1838 ubox
+45 69 0.3586 ubox
+45 72 0.3252 ubox
+46 67 0.2524 ubox
+46 68 0.3007 ubox
+46 69 0.1142 ubox
+46 71 0.2655 ubox
+47 66 0.2807 ubox
+48 67 0.1394 ubox
+49 65 0.9981 ubox
+50 64 0.9997 ubox
+51 63 0.9997 ubox
+52 62 0.9997 ubox
+53 61 0.9981 ubox
+54 59 0.1565 ubox
+55 60 0.3242 ubox
+showpage
+end
+%%EOF
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnaplot_input1.dbn	Tue Dec 06 12:35:35 2016 -0500
@@ -0,0 +1,3 @@
+>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872)  Ala (AGC) 73 bp  Sc: 49.55
+UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA
+.((((((..((((........)))).(((((.......))))).....(((((.......))))))))))).. (-21.90)
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnaplot_input1.fa	Tue Dec 06 12:35:35 2016 -0500
@@ -0,0 +1,4 @@
+>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872)  Ala (AGC) 73 bp  Sc: 49.55
+TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA
+>Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC (1513626-1513698)  Ala (AGC) 73 bp  Sc: 56.15
+GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnasnoop_input1a.fa	Tue Dec 06 12:35:35 2016 -0500
@@ -0,0 +1,2 @@
+>homo
+CGCGACCUCAGAUCAGACGUGGCGACCCGCUGAAUUUAAGCAUAUUAGUCAGCGGAGGAAAAGAAACUAACCAGGAUUCCCUCAGUAACGGCGAGUGAACAGGGAAGAGCCCAGCGCCGAAUCCCCGCCCCGCGGGGCGCGGGACAUGUGGCGUACGGAAGACCCGCUCCCCGGCGCCGCUCGUGGGGGGCCCAAGUCCUUCUGAUCGAGGCCCAGCCCGUGGACGGUGUGAGGCCGGUAGCGGCCGGCGCGCGCCCGGGUCUUCCCGGAGUCGGGUUGCUUGGGAAUGCAGCCCAAAGCGGGUGGUAAACUCCAUCUAAGGCUAAAUACCGGCACGAGACCGAUAGUCAACAAGUACCGUAAGGGAAAGUUGAAAAGAACUUUGAAGAGAGAGUUCAAGAGGGCGUGAAACCGUUAAGAGGUAAACGGGUGGGGUCCGCGCAGUCCGCCCGGAGGAUUCAACCCGGCGGCGGGUCCGGCCGUGUCGGCGGCCCGGCGGAUCUUUCCCGCCCCCCGUUCCUCCCGACCCCUCCACCCGCCCUCCCUUCCCCCGCCGCCCCUCCUCCUCCUCCCCGGAGGGGGCGGGCUCCGGCGGGUGCGGGGGUGGGCGGGCGGGGCCGGGGGUGGGGUCGGCGGGGGACCGUCCCCCGACCGGCGACCGGCCGCCGCCGGGCGCAUUUCCACCGCGGCGGUGCGCCGCGACCGGCUCCGGGACGGCUGGGAAGGCCCGGCGGGGAAGGUGGCUCGGGGGGCCCCGUCCGUCCGUCCGUCCUCCUCCUCCCCCGUCUCCGCCCCCCGGCCCCGCGUCCUCCCUCGGGAGGGCGCGCGGGUCGGGGCGGCGGCGGCGGCGGCGGUGGCGGCGGCGGCGGGGGCGGCGGGACCGAAACCCCCCCCGAGUGUUACAGCCCCCCCGGCAGCAGCACUCGCCGAAUCCCGGGGCCGAGGGAGCGAGACCCGUCGCCGCGCUCUCCCCCCUCCCGGCGCCCACCCCCGCGGGGAAUCCCCCGCGAGGGGGGUCUCCCCCGCGGGGGCGCGCCGGCGUCUCCUCGUGGGGGGGCCGGGCCACCCCUCCCACGGCGCGACCGCUCUCCCACCCCUCCUCCCCGCGCCCCCGCCCCGGCGACGGGGGGGGUGCCGCGCGCGGGUCGGGGGGCGGGGCGGACUGUCCCCAGUGCGCCCCGGGCGGGUCGCGCCGUCGGGCCCGGGGGAGGUUCUCUCGGGGCCACGCGCGCGUCCCCCGAAGAGGGGGACGGCGGAGCGAGCGCACGGGGUCGGCGGCGACGUCGGCUACCCACCCGACCCGUCUUGAAACACGGACCAAGGAGUCUAACACGUGCGCGAGUCGGGGGCUCGCACGAAAGCCGCCGUGGCGCAAUGAAGGUGAAGGCCGGCGCGCUCGCCGGCCGAGGUGGGAUCCCGAGGCCUCUCCAGUCCGCCGAGGGCGCACCACCGGCCCGUCUCGCCCGCCGCGCCGGGGAGGUGGAGCACGAGCGCACGUGUUAGGACCCGAAAGAUGGUGAACUAUGCCUGGGCAGGGCGAAGCCAGAGGAAACUCUGGUGGAGGUCCGUAGCGGUCCUGACGUGCAAAUCGGUCGUCCGACCUGGGUAUAGGGGCGAAAGACUAAUCGAACCAUCUAGUAGCUGGUUCCCUCCGAAGUUUCCCUCAGGAUAGCUGGCGCUCUCGCAGACCCGACGCACCCCCGCCACGCAGUUUUAUCCGGUAAAGCGAAUGAUUAGAGGUCUUGGGGCCGAAACGAUCUCAACCUAUUCUCAAACUUUAAAUGGGUAAGAAGCCCGGCUCGCUGGCGUGGAGCCGGGCGUGGAAUGCGAGUGCCUAGUGGGCCACUUUUGGUAAGCAGAACUGGCGCUGCGGGAUGAACCGAACGCCGGGUUAAGGCGCCCGAUGCCGACGCUCAUCAGACCCCAGAAAAGGUGUUGGUUGAUAUAGACAGCAGGACGGUGGCCAUGGAAGUCGGAAUCCGCUAAGGAGUGUGUAACAACUCACCUGCCGAAUCAACUAGCCCUGAAAAUGGAUGGCGCUGGAGCGUCGGGCCCAUACCCGGCCGUCGCCGGCAGUCGAGAGUGGACGGGAGCGGCGGGGGCGGCGCGCGCGCGCGCGCGUGUGGUGUGCGUCGGAGGGCGGCGGCGGCGGCGGCGGCGGGGGUGUGGGGUCCUUCCCCCGCCCCCCCCCCCACGCCUCCUCCCCUCCUCCCGCCCACGCCCCGCUCCCCGCCCCCGGAGCCCCGCGGACGCUACGCCGCGACGAGUAGGAGGGCCGCUGCGGUGAGCCUUGAAGCCUAGGGCGCGGGCCCGGGUGGAGCCGCCGCAGGUGCAGAUCUUGGUGGUAGUAGCAAAUAUUCAAACGAGAACUUUGAAGGCCGAAGUGGAGAAGGGUUCCAUGUGAACAGCAGUUGAACAUGGGUCAGUCGGUCCUGAGAGAUGGGCGAGCGCCGUUCCGAAGGGACGGGCGAUGGCCUCCGUUGCCCUCGGCCGAUCGAAAGGGAGUCGGGUUCAGAUCCCCGAAUCCGGAGUGGCGGAGAUGGGCGCCGCGAGGCGUCCAGUGCGGUAACGCGACCGAUCCCGGAGAAGCCGGCGGGAGCCCCGGGGAGAGUUCUCUUUUCUUUGUGAAGGGCAGGGCGCCCUGGAAUGGGUUCGCCCCGAGAGAGGGGCCCGUGCCUUGGAAAGCGUCGCGGUUCCGGCGGCGUCCGGUGAGCUCUCGCUGGCCCUUGAAAAUCCGGGGGAGAGGGUGUAAAUCUCGCGCCGGGCCGUACCCAUAUCCGCAGCAGGUCUCCAAGGUGAACAGCCUCUGGCAUGUUGGAACAAUGUAGGUAAGGGAAGUCGGCAAGCCGGAUCCGUAACUUCGGGAUAAGGAUUGGCUCUAAGGGCUGGGUCGGUCGGGCUGGGGCGCGAAGCGGGGCUGGGCGCGCGCCGCGGCUGGACGAGGCGCGCGCCCCCCCCACGCCCGGGGCACCCCCCUCGCGGCCCUCCCCCGCCCCACCCGCGCGCGCCGCUCGCUCCCUCCCCACCCCGCGCCCUCUCUCUCUCUCUCUCCCCCGCUCCCCGUCCUCCCCCCUCCCCGGGGGAGCGCCGCGUGGGGGCGCGGCGGGGGGAGAAGGGUCGGGGCGGCAGGGGCCGCGCGGCGGCCGCCGGGGCGGCCGGCGGGGGCAGGUCCCCGCGAGGGGGGCCCCGGGGACCCGGGGGGCCGGCGGCGGCGCGGACUCUGGACGCGAGCCGGGCCCUUCCCGUGGAUCGCCCCAGCUGCGGCGGGCGUCGCGGCCGCCCCCGGGGAGCCCGGCGGCGGCGCGGCGCGCCCCCCACCCCCACCCCACGUCUCGGUCGCGCGCGCGUCCGCUGGGGGCGGGAGCGGUCGGGCGGCGGCGGUCGGCGGGCGGCGGGGCGGGGCGGUUCGUCCCCCCGCCCUACCCCCCCGGCCCCGUCCGCCCCCCGUUCCCCCCUCCUCCUCGGCGCGCGGCGGCGGCGGCGGCAGGCGGCGGAGGGGCCGCGGGCCGGUCCCCCCCGCCGGGUCCGCCCCCGGGGCCGCGGUUCCGCGCGCGCCUCGCCUCGGCCGGCGCCUAGCAGCCGACUUAGAACUGGUGCGGACCAGGGGAAUCCGACUGUUUAAUUAAAACAAAGCAUCGCGAAGGCCCGCGGCGGGUGUUGACGCGAUGUGAUUUCUGCCCAGUGCUCUGAAUGUCAAAGUGAAGAAAUUCAAUGAAGCGCGGGUAAACGGCGGGAGUAACUAUGACUCUCUUAAGGUAGCCAAAUGCCUCGUCAUCUAAUUAGUGACGCGCAUGAAUGGAUGAACGAGAUUCCCACUGUCCCUACCUACUAUCCAGCGAAACCACAGCCAAGGGAACGGGCUUGGCGGAAUCAGCGGGGAAAGAAGACCCUGUUGAGCUUGACUCUAGUCUGGCACGGUGAAGAGACAUGAGAGGUGUAGAAUAAGUGGGAGGCCCCCGGCGCCCCCCCGGUGUCCCCGCGAGGGGCCCGGGGCGGGGUCCGCGGCCCUGCGGGCCGCCGGUGAAAUACCACUACUCUGAUCGUUUUUUCACUGACCCGGUGAGGCGGGGGGGCGAGCCCGAGGGGCUCUCGCUUCUGGCGCCAAGCGCCCGCCCGGCCGGGCGCGACCCGCUCCGGGGACAGUGCCAGGUGGGGAGUUUGACUGGGGCGGUACACCUGUCAAACGGUAACGCAGGUGUCCUAAGGCGAGCUCAGGGAGGACAGAAACCUCCCGUGGAGCAGAAGGGCAAAAGCUCGCUUGAUCUUGAUUUUCAGUACGAAUACAGACCGUGAAAGCGGGGCCUCACGAUCCUUCUGACCUUUUGGGUUUUAAGCAGGAGGUGUCAGAAAAGUUACCACAGGGAUAACUGGCUUGUGGCGGCCAAGCGUUCAUAGCGACGUCGCUUUUUGAUCCUUCGAUGUCGGCUCUUCCUAUCAUUGUGAAGCAGAAUUCGCCAAGCGUUGGAUUGUUCACCCACUAAUAGGGAACGUGAGCUGGGUUUAGACCGUCGUGAGACAGGUUAGUUUUACCCUACUGAUGAUGUGUUGUUGCCAUGGUAAUCCUGCUCAGUACGAGAGGAACCGCAGGUUCAGACAUUUGGUGUAUGUGCUUGGCUGAGGAGCCAAUGGGGCGAAGCUACCAUCUGUGGGAUUAUGACUGAACGCCUCUAAGUCAGAAUCCCGCCCAGGCGAACGAUACGGCAGCGCCGCGGAGCCUCGGUUGGCCUCGGAUAGCCGGUCCCCCGCCUGUCCCCGCCGGCGGGCCGCCCCCCCCUCCACGCGCCCCGCCGCGGGAGGGCGCGUGCCCCGCCGCGCGCCGGGACCGGGGUCCGGUGCGGAGUGCCCUUCGUCCUGGGAAACGGGGCGCGGCCGGAAAGGCGGCCGCCCCCUCGCCCGUCACGCACCGCACGUUCGUGGGGAACCUGGCGCUAAACCAUUCGUAGACGACCUGCUUCUGGGUCGGGGUUUCGUACGUAGCAGAGCAGCUCCCUCGCUGCGAUCUAUUGAAAGUCAGCCCUCGACACAAGGGUUUGUC
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnasnoop_input1b.fa	Tue Dec 06 12:35:35 2016 -0500
@@ -0,0 +1,2 @@
+>ACA51
+AACCTACCCCATATACACCTCAGCTCAGGCCCTGTGCCTGGTCTGTATTGTGAATGGGGGAACATAG
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnasnoop_result1.txt	Tue Dec 06 12:35:35 2016 -0500
@@ -0,0 +1,4 @@
+>ACA51
+>homo
+<<<<<.<<<<.|.<<.<<<&...(((>>>.>>.((((...............................))))..>>>>.>>>>>))) 4468,4486;4479 :   8,65  (-35.60 = -16.10 + -7.60 + -12.40 + -3.60 + 4.1 ) (-23.60) 
+UGUUCACCCACUAAUAGGG&AACCUACCCCAUAUACACCUCAGCUCAGGCCCUGUGCCUGGUCUGUAUUGUGAAUGGGGGAACAUAG
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnasubopt_input1.fa	Tue Dec 06 12:35:35 2016 -0500
@@ -0,0 +1,4 @@
+>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872)  Ala (AGC) 73 bp  Sc: 49.55
+TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA
+>Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC (1513626-1513698)  Ala (AGC) 73 bp  Sc: 56.15
+GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnasubopt_result1.txt	Tue Dec 06 12:35:35 2016 -0500
@@ -0,0 +1,7 @@
+>Anolis_carolinensis_chrUn_GL343590.trna2-A [0]
+UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA -22.00   0.00
+(((((((..((((........)))).(((((.......))))).....(((((.......))))))))).))) -22.00
+.((((((..((((........)))).(((((.......))))).....(((((.......))))))))))).. -22.00
+>Anolis_carolinensis_chrUn_GL343207.trna3-A [0]
+GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUUGAUGCCCGCAUUCUCCA -29.60   0.00
+(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))). -29.60
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnaup_input1.fa	Tue Dec 06 12:35:35 2016 -0500
@@ -0,0 +1,4 @@
+>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872)  Ala (AGC) 73 bp  Sc: 49.55
+TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA
+>Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC (1513626-1513698)  Ala (AGC) 73 bp  Sc: 56.15
+GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnaup_result1.txt	Tue Dec 06 12:35:35 2016 -0500
@@ -0,0 +1,6 @@
+>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC
+  55,  58 	 (0.019) 	 for u=  4
+RNAup output in file: Anolis_carolinensis_chrUn_GL343590.trna2-A_u1.out
+>Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC
+  16,  19 	 (0.004) 	 for u=  4
+RNAup output in file: Anolis_carolinensis_chrUn_GL343207.trna3-A_u1.out
Binary file vienna_rna.tar.gz has changed