# HG changeset patch
# User rnateam
# Date 1494966494 14400
# Node ID f9fdedb38919c4d19f819dc4191d5399499510c1
# Parent 3f9ef14c40dec0da84cff2a412e0ac3e16c0958e
planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/rna_tools/vienna_rna commit b'bd13ffd1c3e126a6dc59dd3c478347ec1b5824a3\n'
diff -r 3f9ef14c40de -r f9fdedb38919 macros.xml
--- a/macros.xml Wed Dec 21 17:32:20 2016 -0500
+++ b/macros.xml Tue May 16 16:28:14 2017 -0400
@@ -2,6 +2,7 @@
viennarna
+
2.2.10
diff -r 3f9ef14c40de -r f9fdedb38919 rnafold_SHAPE.py
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/rnafold_SHAPE.py Tue May 16 16:28:14 2017 -0400
@@ -0,0 +1,45 @@
+### overcoming the problem of SHAPE data working with a single line.
+### creating multiple multiple files containg SHAPE data for a single sequence and running RNAfold for every
+### single sequence.
+
+import os
+import sys
+from os import system
+from Bio import SeqIO
+import re
+from subprocess import Popen, PIPE
+
+params_list = sys.argv[1:]
+param_list_no_shape = [s for s in params_list if not "--shape=" in s ]
+shape_file = [s for s in params_list if "--shape=" in s ]
+assert (len(shape_file) == 1)
+
+shape_file = shape_file[0]
+shape_file = shape_file.replace('--shape=', '')
+
+params_no_shape = " ".join(str(x) for x in param_list_no_shape)
+
+pattern = re.compile("^>.*$")
+id_line = ""
+with open(shape_file, 'r') as f:
+ content = f.read()
+ lines = content.split('\n')
+ for line in lines:
+ if pattern.match(line):
+ id_line = line.split()[0]
+ id_line = id_line[1:]
+ continue
+ else:
+ with open(id_line +'.tmp', "a") as clFile:
+ clFile.write(line + "\n")
+
+input_file = sys.stdin
+
+for record in SeqIO.parse(input_file, "fasta"):
+ seq = ">{}\n{}".format(record.id,record.seq)
+ cmd = " RNAfold --shape=" + record.id + '.tmp ' + params_no_shape
+ p = Popen(cmd , stdin=PIPE, shell=True, stdout=PIPE, stderr=PIPE)
+ out,err = p.communicate(seq.encode())
+ if err:
+ raise RuntimeError("Error in calling RNAfold\n{}\n{}\n".format(out, err))
+ print (out.decode('utf-8').strip())
diff -r 3f9ef14c40de -r f9fdedb38919 test-data/sample_3.fa
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/sample_3.fa Tue May 16 16:28:14 2017 -0400
@@ -0,0 +1,6 @@
+>SECIS_1 test
+AUUUUAUCCAUGAAAGUGUUUCCUCUAAACCUAUGUGGAGGAACACCUGAUGUCCAGGAAAAU
+>6S_1 test1
+GAAACCCUAAUGUAUUCGAUAUAGUUCCUGAUAUUUUUGAACCGAACAAUUUUUUAUACCUAGGGAGCUUGGAGUUCCGGCGCGGCGCACAUGCCUUCACACGAGGAAGUGCAAACCGUUAGACAGAGCACCCACCUGCUUUAAUUGAGAGCGGGUUCAAAGGAAGGGAAUCCUAAACGGUACGAUUGGGGUUUCU
+>6S_2
+UUGUCCCUGCCGUGCUCGUGACUUGGCCAUACAUUCUCUGAACCUAUGUCUUACGGCAUAUGGGUUGCGGGAGUGUAGAGCUGGAGUGAUCGUCUACUCGUAGACGAACCCGAUGCUCUUCGGAUCGCGACCACCUUGAACCUCAGGGUUCGAGAUGCCGGCCUUGACGGCACAGGCGGGGCAUC
diff -r 3f9ef14c40de -r f9fdedb38919 test-data/sample_3.react
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/sample_3.react Tue May 16 16:28:14 2017 -0400
@@ -0,0 +1,447 @@
+>SECIS_1
+1 0.0657466222
+2 0.1280448842
+3 0.2786665403
+4 0.1391216354
+5 0.0272299574
+6 0.1717063095
+7 0.488732281
+8 3.3015172695
+9 0.414494604
+10 0.1957445189
+11 0.4670328791
+12 0.1943420556
+13 0.2099109521
+14 0.5846784488
+15 0.1296563697
+16 0.0359267698
+17 0.0438238841
+18 1.6364597431
+19 1.72206594665E-17
+20 0.0099928394
+21 0.0475042774
+22 0.0065948845
+23 0.0574522715
+24 0.2126102485
+25 1.2006488448
+26 0.6040825271
+27 0.4114049219
+28 1.1514597937
+29 1.216707413
+30 0.0186005737
+31 0.0841609069
+32 0.086771667
+33 1.1672973211
+34 0.8144419625
+35 0.2583987716
+36 0.0182542709
+37 0.0875979754
+38 0.094456587
+39 0.5206337515
+40 0.000517531
+41 0.0253820905
+42 0.2076338063
+43 0.0087295599
+44 0.0129264641
+45 0.0127365182
+46 0.1193338151
+47 0.0186183812
+48 0.3581141112
+49 0.0941009884
+50 0.2050905673
+51 0.0209195644
+52 0.6030952711
+53 5.2129588113
+54 0.1747678483
+55 1.2231479801
+56 0.4978854319
+57 0.5711590135
+58 0.2793524314
+59 0.0037936012
+60 0.2158137729
+61 0.5646393912
+62 0.6229186627
+63 0.0193621982
+>6S_1
+1 0.1158690877
+2 0.0774028501
+3 0.2349947573
+4 1.72206594665E-17
+5 0.0926174169
+6 0.0505177415
+7 0.0457131819
+8 0.0194615986
+9 2.1495069267
+10 0.0409639397
+11 0.2185631969
+12 0.1776745985
+13 0.0086422926
+14 0.0241577615
+15 0.0092855631
+16 0.3453240509
+17 0.1535840586
+18 0.0180643958
+19 0.1188776616
+20 0.3091581196
+21 0.3748109806
+22 0.6187506508
+23 0.3511511383
+24 0.6512026704
+25 0.3096370415
+26 0.5283368492
+27 0.7500060952
+28 0.0352720444
+29 0.3776026196
+30 0.3489100484
+31 1.3035405919
+32 0.1023638167
+33 0.133082988
+34 0.0024118398
+35 0.0281166587
+36 0.2818828676
+37 0.1316060603
+38 0.1813992598
+39 0.0047490217
+40 0.0204058553
+41 0.0675891142
+42 0.045119933
+43 0.0266727645
+44 0.0673921107
+45 0.0085752561
+46 0.495476266
+47 0.8224799434
+48 0.5574272341
+49 0.2431151153
+50 0.256015696
+51 0.0386339787
+52 0.6618567864
+53 0.0707284393
+54 1.1215284869
+55 0.0463423016
+56 0.3338809513
+57 0.3987796157
+58 1.1046527917
+59 0.6156154318
+60 0.1179259769
+61 2.0333569471
+62 0.1224421595
+63 0.0266055429
+64 0.0298356423
+65 0.3004015135
+66 2.1966900004
+67 0.0222153137
+68 0.0095300422
+69 0.0503009918
+70 0.0418994997
+71 0.0384566069
+72 2.6211662666
+73 0.1704872628
+74 0.8386436572
+75 0.6961218859
+76 0.1995308419
+77 0.0552442152
+78 0.1937915065
+79 0.1239592493
+80 0.0782601391
+81 0.0138965117
+82 0.0231978646
+83 0.0150709773
+84 0.4084290821
+85 0.0792668417
+86 1.0630476211
+87 0.2524739666
+88 0.0229636507
+89 0.1153934877
+90 0.2693801005
+91 0.0071337145
+92 1.0279231796
+93 0.0574241281
+94 0.103312087
+95 0.2100864561
+96 0.0252070712
+97 0.6067864142
+98 0.0607860625
+99 0.5416948523
+100 0.7090251541
+101 2.0470096713
+102 0.0368697578
+103 0.1221648319
+104 0.0484836208
+105 0.7188621431
+106 0.2405585888
+107 0.1071170724
+108 0.6859305671
+109 0.0997679124
+110 0.0342400356
+111 0.0201635
+112 0.4527960874
+113 0.7018417748
+114 0.2561295384
+115 0.2788440973
+116 0.2437240042
+117 0.0984135237
+118 0.1146045041
+119 0.2116296362
+120 0.0360702095
+121 0.2006613525
+122 0.0635994434
+123 0.8384420629
+124 0.3546527057
+125 0.014380068
+126 0.0041004554
+127 0.2404132813
+128 0.0016204246
+129 0.016365643
+130 0.0025333389
+131 0.0207130798
+132 0.2199275512
+133 0.2973627433
+134 1.7680018464
+135 0.3120917444
+136 0.854288287
+137 0.4309335923
+138 2.3003988746
+139 0.047166557
+140 0.7391255635
+141 0.1357653755
+142 0.4672659386
+143 0.3601080698
+144 0.9111911856
+145 0.7435427597
+146 0.3353115579
+147 1.0513358906
+148 0.1406855309
+149 0.3543459659
+150 0.0561408821
+151 0.563013834
+152 0.1549691284
+153 0.7460309808
+154 0.0486849156
+155 0.1080587915
+156 0.0699642772
+157 0.4423435657
+158 0.0171555252
+159 0.0064557797
+160 0.4739275466
+161 0.2617128164
+162 0.0879369647
+163 0.0062762841
+164 0.1060085461
+165 0.0971932081
+166 0.3139785044
+167 0.0771649003
+168 0.0753029618
+169 0.5676607679
+170 0.9836368904
+171 0.6193661835
+172 0.3890022353
+173 0.3304911731
+174 0.9354752573
+175 2.5683088408
+176 0.6777050636
+177 0.0195000778
+178 0.0532349161
+179 0.0993391181
+180 0.0667310411
+181 0.0123690861
+182 0.0165201319
+183 0.2056431695
+184 0.0114477122
+185 0.1684423923
+186 0.6236165725
+187 0.2533573459
+188 7.4644850979
+189 1.72206594665E-17
+190 0.0510513818
+191 0.071993023
+192 0.093087642
+193 0.026770297
+194 0.1003921418
+195 0.731799564
+196 0.3882654324
+>6S_2
+1 5.135077189
+2 0.0137794619
+3 0.0198585136
+4 0.0394762621
+5 0.1032256038
+6 0.0124879331
+7 0.050343991
+8 0.0266906427
+9 0.0867862234
+10 0.0250443701
+11 0.1241682715
+12 0.0888505404
+13 1.72206594665E-17
+14 0.0443782398
+15 0.0331749933
+16 1.190843321
+17 0.0083605324
+18 0.1025127456
+19 0.0318835351
+20 0.6764653014
+21 1.6659553696
+22 0.0532195755
+23 0.1306535914
+24 3.2368938797
+25 0.2999875752
+26 0.1771608894
+27 0.0735275063
+28 1.1463641343
+29 0.3436951718
+30 0.6339043401
+31 0.8229568123
+32 0.0567986298
+33 0.3413998482
+34 0.1291037675
+35 0.561127074
+36 0.0076983354
+37 0.147000237
+38 0.0214390185
+39 0.5304305785
+40 0.0785507542
+41 0.0483731004
+42 0.0976091996
+43 1.2125480978
+44 0.1865263845
+45 0.6312459899
+46 0.1817958047
+47 2.8617198725
+48 0.2055922577
+49 1.3068827801
+50 0.2629492567
+51 0.8571308379
+52 0.2726647331
+53 1.129084224
+54 0.275119436
+55 0.5874419445
+56 0.3657294569
+57 0.2500734975
+58 1.0443534711
+59 4.5331285532
+60 0.2551985691
+61 0.1800315837
+62 1.2079574507
+63 0.1377332438
+64 0.034281766
+65 0.0098202871
+66 0.9938878178
+67 0.0331980613
+68 0.2884058117
+69 0.1471099733
+70 0.0250835628
+71 0.0040433138
+72 2.1207460501
+73 0.7413016698
+74 0.2856087978
+75 0.1043896327
+76 2.5426831833
+77 0.024753755
+78 0.0197741979
+79 0.0256614712
+80 0.0931195919
+81 0.2341548619
+82 0.9442989
+83 0.6902004027
+84 0.2615426874
+85 0.1968596889
+86 0.1317761893
+87 0.3101105886
+88 0.3109082689
+89 0.6036478733
+90 0.1383132052
+91 1.72206594665E-17
+92 1.3701244222
+93 0.0259262955
+94 0.0427849321
+95 0.0059202715
+96 0.4620195968
+97 1.1627066739
+98 0.1193652803
+99 0.5039174355
+100 0.7685843498
+101 3.3504451177
+102 0.0156110762
+103 0.0405202895
+104 0.0448853051
+105 0.1130352336
+106 0.0128895533
+107 0.0140152443
+108 0.8487385272
+109 0.5411302314
+110 0.1921994675
+111 0.0804367301
+112 2.1393979849
+113 0.657192459
+114 0.9680746376
+115 0.0181673032
+116 0.1293355582
+117 0.0385348779
+118 0.0599847607
+119 0.0286153267
+120 0.0529816257
+121 0.0738905329
+122 1.9826160191
+123 0.6850277412
+124 0.0240149916
+125 0.1003714264
+126 0.0282377438
+127 0.016091267
+128 0.0654324545
+129 1.3672926211
+130 0.3123897874
+131 0.0125997931
+132 0.0326682275
+133 0.8141700098
+134 2.7208263459
+135 0.9376426669
+136 0.2104407859
+137 0.9213456642
+138 0.9496557623
+139 0.0158974709
+140 1.0394051723
+141 3.395502997
+142 0.2786545217
+143 0.0944673368
+144 0.1658691067
+145 1.5138095878
+146 0.2388473327
+147 0.0071582802
+148 0.0399196127
+149 0.0269685694
+150 0.0343298406
+151 0.0260244978
+152 0.1131275763
+153 0.0217325853
+154 0.1015784545
+155 0.0991349861
+156 1.4195713543
+157 0.5085589945
+158 0.1250938659
+159 0.788081555
+160 0.1135816768
+161 0.0633806979
+162 2.7826494
+163 1.8003487205
+164 0.7686439584
+165 0.0397996113
+166 0.8340757785
+167 0.0060961894
+168 0.0003936337
+169 0.0179660084
+170 0.033466093
+171 0.0469772809
+172 0.1070226766
+173 0.3447929483
+174 0.8559366126
+175 0.1279778477
+176 0.2188243998
+177 0.0449863446
+178 0.0382790499
+179 0.0022221768
+180 0.0311889472
+181 0.0257878168
+182 0.0172539125
+183 0.2710934097
+184 0.0914500662
+185 0.208503114
\ No newline at end of file
diff -r 3f9ef14c40de -r f9fdedb38919 test-data/sample_3_result.txt
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/sample_3_result.txt Tue May 16 16:28:14 2017 -0400
@@ -0,0 +1,9 @@
+>SECIS_1
+AUUUUAUCCAUGAAAGUGUUUCCUCUAAACCUAUGUGGAGGAACACCUGAUGUCCAGGAAAAU
+.((((...(((.(..(((.((((((((........))))))))))).).))).....)))).. (-27.97)
+>6S_1
+GAAACCCUAAUGUAUUCGAUAUAGUUCCUGAUAUUUUUGAACCGAACAAUUUUUUAUACCUAGGGAGCUUGGAGUUCCGGCGCGGCGCACAUGCCUUCACACGAGGAAGUGCAAACCGUUAGACAGAGCACCCACCUGCUUUAAUUGAGAGCGGGUUCAAAGGAAGGGAAUCCUAAACGGUACGAUUGGGGUUUCU
+(((((((...(((((.((.....((((((....((((((((((...................(((.((((.....((.((((.(..((((.(.((((.....))))).))))...))))).))..)))).)))....(((((.....))))).))))))))))..))))))......)))))))....))))))). (-110.38)
+>6S_2
+UUGUCCCUGCCGUGCUCGUGACUUGGCCAUACAUUCUCUGAACCUAUGUCUUACGGCAUAUGGGUUGCGGGAGUGUAGAGCUGGAGUGAUCGUCUACUCGUAGACGAACCCGAUGCUCUUCGGAUCGCGACCACCUUGAACCUCAGGGUUCGAGAUGCCGGCCUUGACGGCACAGGCGGGGCAUC
+.((.(((((((((((.(((.(...((((...((.((((.((((((..(((....))).....((((((((...((.(((((.((.((..((((((......))))))))))...))))).))..)))))))).............))))))))))))..)))).).))))))).))))))))).. (-129.27)