Mercurial > repos > rnateam > viennarna_rnafold
diff rnafold.xml @ 7:86f517dcfdfb draft
planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/rna_tools/vienna_rna commit d9f13fd859165e4280412ec73f8f3f8b258d351d-dirty
| author | rnateam |
|---|---|
| date | Thu, 28 Sep 2017 16:24:39 -0400 |
| parents | b31dcdb31209 |
| children | bdb786715d28 |
line wrap: on
line diff
--- a/rnafold.xml Fri Sep 22 15:57:19 2017 -0400 +++ b/rnafold.xml Thu Sep 28 16:24:39 2017 -0400 @@ -1,4 +1,4 @@ -<tool id="viennarna_rnafold" name="@EXECUTABLE@" version="@VERSION@.2"> +<tool id="viennarna_rnafold" name="@EXECUTABLE@" version="@VERSION@.3"> <description>Calculate minimum free energy secondary structures and partition function of RNAs</description> <macros> <token name="@EXECUTABLE@">RNAfold</token> @@ -31,15 +31,13 @@ #if $layout_type ==0 --layout-type=$general_options.layout_type #end if - #if $measelect.mea == "yes": - --MEA=$measelect.meavalue - #if $measelect.pfScale <> 1.07 - --pfScale=$measelect.pfScale + #if $mea: + --MEA=$mea #end if - #else - $measelect.pf - #if $measelect.pfScale <> 1.07 - --pfScale=$measelect.pfScale + #if $pf + $pf + #if $pfscale: + --pfScale=$pfscale #end if #end if $advancedOptions.noconversion @@ -134,20 +132,9 @@ <option value="1" selected="true">Default: Naview layout</option> <option value="0">Simple radial layout</option> </param> - <conditional name="measelect"> - <param name="mea" type="select" label="Calculate Maximum Expected accuracy" argument="--MEA"> - <option value="no">No</option> - <option value="yes">Yes</option> - </param> - <when value="yes"> - <param name="meavalue" type="float" value="1.0" label="Gamma Value"/> - <param argument="--pfScale" type="float" value="1.07" label="Scaling factor" help="In the calculation of the pf use scale*mfe as an estimate for the ensemble free energy (used to avoid overflows). The default is 1.07, useful values are 1.0 to 1.2. Occasionally needed for long sequences."/> - </when> - <when value="no"> - <param name="pf" type="boolean" checked="false" truevalue="--partfunc" falsevalue="" label="Calculate Partition Function" help="--partfunc"/> - <param argument="--pfScale" type="float" value="1.07" label="Scaling factor" help="In the calculation of the pf use scale*mfe as an estimate for the ensemble free energy (used to avoid overflows). The default is 1.07, useful values are 1.0 to 1.2. Occasionally needed for long sequences."/> - </when> - </conditional> + <param argument="--MEA" name="mea" type="float" value="1.0" optional="true" label="Gamma Value" help="Used for the calculation of the Maximum Expected accuracy"/> + <param name="pf" type="boolean" checked="false" truevalue="--partfunc" falsevalue="" label="Calculate Partition Function" help="--partfunc"/> + <param name="pfscale" type="float" value="1.07" optional="true" label="Scaling factor" help="In the calculation of the pf use scale*mfe as an estimate for the ensemble free energy (used to avoid overflows). The default is 1.07, useful values are 1.0 to 1.2. Occasionally needed for long sequences."/> <section name="advancedOptions" title="Advanced options"> <param name="nops" type="boolean" truevalue="--noPS" falsevalue="" checked="false" label="Do not produce postscript drawing of the mfe structure (reduces run-time)" help="(--noPS)"/> <param name="nolp" type="boolean" truevalue="" falsevalue="--noLP" checked="true" label="Allow lonely base-pairs" help="(--noLP)"/> @@ -194,12 +181,12 @@ <param name="constraintSelector" type="select" label="Constraints"> <!-- <option value="fromInput">The constraints are included in the input file</option> --> <option value="fromFile">The constraints are in a seperate file</option> - <option value="inFile">The constraints are in the fasta input file</option> + <option value="inFile">The constraints are in the fasta input file</option> <option value="none" selected="true">Don't use constraints</option> </param> - <!-- <when value="fromInput"></when> --> - <when value="none"></when> - <when value="inFile"></when> + <!-- <when value="fromInput"></when> --> + <when value="none"></when> + <when value="inFile"></when> <when value="fromFile"> <param name="constraintsFile" type="data" format="txt" label="Constraints file" argument="--constraint"/> <param name="batch" type="boolean" checked="false" truevalue="--batch" falsevalue="" @@ -306,18 +293,18 @@ <test> <param name="select_fasta" value="true" /> <param name="fasta_input" value="rnafold_input1.fa"/> - <output name="out_file1" file="rnafold_result1.txt"/> + <output name="tabular_file" file="rnafold_result1.txt"/> </test> <test> <param name="select_fasta" value="true" /> <param name="fasta_input" value="rnafold_input2.fa"/> <param name="temperature" value="75"/> - <output name="out_file1" file="rnafold_result2.txt"/> + <output name="tabular_file" file="rnafold_result2.txt"/> </test> <test> <param name="select_fasta" value="false" /> <param name="input_sequence" value="TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA"/> - <output name="out_file1" file="rnafold_result3.txt"/> + <output name="tabular_file" file="rnafold_result3.txt"/> </test> <test> <param name="select_fasta" value="true" /> @@ -326,7 +313,7 @@ <param name="shapeSelector" value="isUsed"/> </conditional> <param name="shapeFile" value="sample_3.react"/> - <output name="out_file1" file="sample_3_result.txt"/> + <output name="tabular_file" file="sample_3_result.txt"/> </test> </tests> <help>